Method for constructing haploid induction line by using RPS5a promoter to drive RNAi technology and application of haploid induction line
The RPS5a promoter-driven RNAi technology inhibits CENH3 expression, solves the problem of growth defects caused by haploid induction systems in the prior art, and creates a haploid induction system without growth defects, which improves the haploid induction efficiency and is suitable for a variety of plant species.
Patent Information
- Application Number
- CN202510238022.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-03
- Publication Date
- 2025-07-04
AI Technical Summary
The prior art often leads to plant growth defects when creating haploid induction systems, which limits its application and development. It is urgently needed to create a method that is free of growth defects and has haploid induction capabilities.
The RPS5a promoter-driven RNAi technology was used to inhibit CENH3 expression. By constructing the pRPS5a::RNAi vector and transforming plants, plants with haploid induction ability were screened to establish a CENH3-mediated haploid induction system.
It has achieved the creation of haploid induction systems with haploid induction without affecting the normal growth of plants, and improved the haploid induction efficiency, which is suitable for a variety of plant species.
Smart Images

Figure CN120249355A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biological genetic engineering, and particularly relates to a method for constructing a haploid inducer by driving RNAi technology through an RPS5a promoter and its application. Background Art
[0002] A haploid is an individual that contains only the chromosome number (n) of a single gamete. By treating with colchicine or spontaneous doubling, a homozygous doubled haploid (DH) material that can be stably inherited can be obtained. Traditional breeding techniques, such as self-crossing, hybridization, backcrossing, etc., require more than 6 - 8 generations to obtain relatively homozygous germplasm resources that can be relatively stably inherited. However, by using haploid breeding technology, after doubling the haploid offspring, a homozygous doubled haploid line that can be stably inherited can be obtained within 1 generation, thus greatly accelerating the breeding process of crop varieties.
[0003] CENH3 is a centromere-specific histone that plays a crucial role in the precise segregation of chromosomes during cell division. To date, a series of methods have been developed in Arabidopsis thaliana to create CENH3-mediated haploid induction lines. Ravi and Chan created the CENH3-based haploid induction line GFP-tailswap by replacing the N-terminal tail structure of Arabidopsis thaliana CENH3 (Ravi M, Chan S W. Haploid plants produced by centromere-mediated genome elimination[J]. Nature, 2010, 464(7288): 615-618). In addition, editing the CENH3 gene using techniques such as CRISPR / Cas9, EMS mutagenesis, TILLING, and CBE can generate a large number of different types of point mutations and fragment deletion mutations, and these mutants all have varying degrees of haploid induction ability (Karimi-Ashtiyani R, Ishii T, Niessen M, et al. Point mutation impairs centromeric cenh3 loading and induces haploid plants[J]. Proc Natl Acad Sci U S A, 2015, 112(36): 11211-11216; Kuppu S, Tan E H, Nguyen H, et al. Point mutations in centromeric histone induce post-zygotic incompatibility and uniparental inheritance[J]. PLoS Genet, 2015, 11(9): e1005494; Kuppu S, Ron M, Marimuthu M P A, et al. A variety of changes, including crispr / cas9-mediated deletions, in cenh3 lead to haploid induction on outcrossing[J]. Plant Biotechnol J, 2020; Wang S, Ouyang K. Rapid creation of cenh3-mediated haploid induction lines using a cytosine base editor (cbe)[J]. Plant Biol(Stuttg), 2023, 25(1): 226-230.).However, while these mutants acquire the ability of haploid induction, some defects often occur in the growth of the plants, such as curled leaves, dwarf plants, sterility, embryo lethality, etc. These defects limit the application and development of CENH3-based haploid induction lines. Some studies have shown that reducing the expression level of the CENH3 gene in Arabidopsis thaliana by using RNAi (RNA interference) gene silencing technology will also cause a series of growth defects in plants, hindering the normal growth of plants, but it cannot endow the plants with the ability of haploid induction (Lermontova I, Koroleva O, Rutten T, et al. Knockdown of cenh3 in arabidopsis reduces mitotic divisions and causes sterility by disturbed meiotic chromosome segregation[J]. Plant J, 2011, 68(1):40-50; Ahmadli U, Kalidass M, Khaitova L C, et al. High temperature increases centromere-mediated genome elimination frequency and enhances haploid induction in arabidopsis[J]. Plant Commun, 2023, 4(3):100507).
[0004] Based on this, there is an urgent need for a technology that can create functional haploid induction lines without affecting the normal growth of plants. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide a method for constructing a haploid induction line by driving RNAi technology with the RPS5a promoter and its application in view of the deficiencies of the above-mentioned prior art. This method uses the RPS5a promoter to drive RNAi (RNA interference) technology to inhibit the expression of CENH3, thereby creating a CENH3-mediated Arabidopsis thaliana haploid induction line without growth defects and with the ability of haploid induction. This method can also be used to improve the induction ability of low-efficiency haploid induction lines.
[0006] To solve the above technical problems, the technical solution adopted by the present invention is:
[0007] A method for constructing a haploid induction line by driving RNAi technology with the RPS5a promoter, the method comprising the following steps:
[0008] S1. Construct the pRPS5a::RNAi vector
[0009] Clone the forward sequence of the RPS5a promoter fragment and the full-length cDNA of the CENH3 gene into the modified pFGC5941_mcherry vector by Gibson homologous recombination method to obtain the pFGC5941_mCherry-pRPS5a: forward CENH3 vector; then use the Gibson method to clone the reverse sequence of CENH3 into the pFGC5941_mCherry-pRPS5a: forward CENH3 vector. The forward and reverse sequences of CENH3 are separated by the shA intron in between, and the forward and reverse sequence fragments of CENH3 are driven by the RPS5a promoter, and finally the pRPS5a::RNAi vector is obtained;
[0010] The nucleotide sequence of the CENH3 gene is shown in SEQ ID NO.1;
[0011] The RPS5a promoter uses 1760 bp bases before the start codon ATG of the RPS5a gene as the RPS5a promoter, and the sequence is shown in SEQ ID NO.2;
[0012] S2. Create a haploid inducer
[0013] Transfer the pRPS5a::RNAi vector obtained in S1 into Agrobacterium tumefaciens GV3101, and then use the floral dip method to transform wild-type plants, and screen out transgenic positive plants; then emasculate and hybridize the obtained transgenic positive plants at the full flowering stage to obtain hybrid progeny seedlings, count the haploid ratio in the hybrid progeny, and screen out plants with induction ability to obtain the haploid inducer pRPS5a::RNAi.
[0014] Preferably, the identification method of the haploid in S2: Screen out candidate haploids through the plant leaf phenotype, and then use a flow cytometer to analyze and further confirm the ploidy of the candidate haploid plants.
[0015] The present invention also provides an application of the method for constructing a haploid inducer by driving RNAi technology through the RPS5a promoter, which can be used to construct haploid inducers of any monocotyledonous and dicotyledonous plants, endow wild-type plants with induction ability, and do not cause growth defects in plants.
[0016] Due to the adoption of the above technical solutions, the present invention has significant technical effects:
[0017] 1. The present invention provides a method for creating a CENH3-mediated haploid inducer by using the RPS5a promoter to drive RNA interference (RNAi) technology to inhibit CENH3 expression, enabling the plant to acquire haploid induction ability without causing growth defects in transgenic plants. This method can be used to create haploid inducers in various species such as any monocotyledonous and dicotyledonous plants.
[0018] 2. Transferring the RPS5a promoter-driven RNAi (RNA interference) technology system of the present invention into existing haploid inducers can also optimize their induction efficiency, improve haploid induction ability, and do not cause growth defects in the inducers, which can be used for the optimization of inducers in any monocotyledonous and dicotyledonous plants and other various species.
[0019] 3. The present invention provides a novel and effective technical solution for the research of plant haploid inducers, with broad application prospects.
[0020] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Description of the Drawings
[0021] Figure 1 It is the structural diagram of the pRPS5a::RNAi vector in Example 1 of the present invention.
[0022] Figure 2 The phenotype of the pRPS5a::RNAi transgenic plants in Example 2 of the present invention;
[0023] Figure 3 It is the pollen fertility of the pRPS5a::RNAi transgenic plants in Example 2 of the present invention;
[0024] Figure 4 It is the haploid identification diagram of the hybrid offspring in Example 2 of the present invention. Among them, in Figure A, from left to right are the phenotypes of haploid, aneuploid, and diploid plants in turn, and the scale bar is 4 cm; Figure B is the flow cytometry analysis results of diploid (left) and haploid (right). Detailed Embodiments
[0025] Example 1
[0026] This example is to construct the pRPS5a::RNAi vector.
[0027] The forward sequences of the RPS5a promoter fragment and the full-length cDNA of the CENH3 gene were cloned into the modified pFGC5941_mcherry vector by Gibson homologous recombination method to obtain the pFGC5941_mCherry-pRPS5a: forward CENH3 vector. Then, the reverse sequence of CENH3 was cloned into the pFGC5941_mCherry-pRPS5a: forward CENH3 vector by Gibson method. The forward and reverse sequences of CENH3 were separated by the shA intron in between, and the forward and reverse sequence fragments of CENH3 were driven by the RPS5a promoter. Finally, the pRPS5a::RNAi vector was obtained. The structure of the pRPS5a::RNAi vector is as shown in Figure 1 shown below.
[0028] The specific steps for constructing the pRPS5a::RNAi vector are as follows:
[0029] 1. Amplification of CENH3 fragment
[0030] Using cDNA as a template, the forward CENH3 fragment and the reverse CENH3 fragment were amplified.
[0031] The amplification primers for the forward CENH3 fragment were:
[0032] Forward CENH3-F:
[0033] CATTTACAATTACCATGGGGATGGCGAGAACCAAGCATCG,
[0034] Forward CENH3-R:
[0035] CATTTAAATCATCGATTGGGTCACCATGGTCTGCCTTTTCC;
[0036] The amplification primers for the reverse CENH3 fragment were:
[0037] Reverse CENH3-F:
[0038] GGTCAATTTGCAGGTATTTGTCACCATGGTCTGCCTTTTCC,
[0039] Reverse CENH3-R:
[0040] CCCGGGTCTTAATTAACTCTATGGCGAGAACCAAGCATCG.
[0041] The PCR amplification reaction system is shown in Table 1:
[0042] Table 1 PCR amplification reaction system
[0043] Component Volume (μL) 2×PhantaMax Buffer 25 dNTP Mix (10 mM) 1 Primer-F (10 μM) 1 Primer-R (10 μM) 1 DNA 2 PhantaMax Super-Fidelity DNA Polymerase 1 <![CDATA[ddH2O]]> 19
[0044] The PCR amplification reaction procedure is shown in Table 2:
[0045] Table 2 PCR Amplification Reaction Procedure
[0046]
[0047]
[0048] The forward and reverse CENH3 fragments after PCR amplification were recovered using the SanPrep Column PCR Product Purification Kit produced by Sangon Biotech Co., Ltd. The detailed steps were carried out according to the kit instructions.
[0049] The nucleotide sequence of the CENH3 gene is shown in SEQ ID NO.1.
[0050] 2. Amplification of the promoter pRPS5a fragment
[0051] The RPS5a promoter is the 1760 bp base before the start codon ATG of the Arabidopsis thaliana pRPS5a (AT3G11940) gene as the RPS5a promoter (i.e., -1760-ATG).
[0052] Using Arabidopsis thaliana DNA as a template, the primer sequences for PCR amplification of the RPS5a promoter fragment are:
[0053] RPS5a RNAi-F:
[0054] ACCCTATGTTAATTTGGTTTCAAGATCTGGGACCAATTGTTGTTTGAT TTCA,
[0055] RPS5a RNAi-R:
[0056] GTAATTGTTGTAAAAATAGAGCTCGAGGCTGTGGTGAGAGAAACAG A;
[0057] The amplification reaction system and procedure are the same as those in Table 1 and Table 2.
[0058] The pRPS5a promoter fragment after PCR amplification was recovered using the SanPrep Column PCR Product Purification Kit produced by Sangon Biotech Co., Ltd. The detailed steps were carried out according to the kit instructions.
[0059] The RPS5a promoter sequence is shown in SEQ ID NO.2.
[0060] 3. Linearization of vector pFGC5941_mcherry
[0061] The vector pFGC5941_mCherry was digested with restriction enzymes EcoRⅠ and XhoⅠ for double digestion linearization. The restriction enzymes were purchased from NEB. The reaction system for digestion was as follows:
[0062] Table 3 Reaction system for vector digestion
[0063] Component Volume (μL) Endonuclease 1 1 Endonuclease 2 1 10×CutSmart Buffer 10 Plasmid 1000 ng <![CDATA[ddH2O]]> Make up to 50 μL
[0064] The digestion reaction procedure was: 37°C, overnight incubation, about 12 hours.
[0065] 4. Gibson homologous recombination to ligate vector pFGC5941_mCherry-pRPS5a: forward CENH3
[0066] The kit used was the Hieff Plus One Step Cloning Kit for one-step rapid cloning produced by Yisheng Company. The usage amounts of the vector and the inserted fragment were calculated according to the instruction manual. The ligation reaction system was as follows:
[0067] Table 4 Gibson homologous recombination ligation system
[0068] Component Volume (μL) pRPS5a 1 Forward CENH3 0.5 Linearized vector pFGC5941_mCherry 2 2×HieffClone Enzyme Premix 3.5
[0069] The reaction conditions were: incubation at 50°C for 30 min. If the inserted fragment was a long fragment or multiple fragments were inserted, the reaction time could be extended to 40 min.
[0070] 5. Obtaining the vector pFGC5941_mCherry-pRPS5a: forward CENH3
[0071] The commercial Escherichia coli competent cells DH5a were thawed on ice and then the ligation product obtained in step 4 was added. After heat shock at 42°C for 40 s, it was quickly placed on ice for 5 min. Then 500 μL of antibiotic-free LB was added and incubated on a shaker at 37°C for 30 min, and then spread on a solid medium with kanamycin resistance. After single colonies grew out, they were cultured in a liquid medium containing kanamycin antibiotic on a shaker overnight, and then plasmid extraction was carried out. After obtaining a sufficient amount of plasmid, it was sent to a gene company for sequencing to obtain the correctly ligated vector plasmid.
[0072] 6. Linearization of vector pFGC5941_mCherry-pRPS5a: forward CENH3
[0073] The vector pFGC5941_mCherry-pRPS5a: forward CENH3 was linearized by single digestion with restriction enzymes BamH I and Xba I. The digestion system was the same as in Table 3, and the reaction conditions were 37 °C for overnight incubation.
[0074] 7. Gibson homologous recombination to ligate the vector pRPS5a::RNAi
[0075] The reverse CENH3 fragment was ligated into the linearized vector pFGC5941_mCherry-pRPS5a: forward CENH3 using the Hieff Plus One Step Cloning Kit, a one-step rapid cloning kit produced by Yeasen Biotech Co., Ltd. The usage amounts of the vector and the inserted fragment were calculated according to the instructions. The reaction system was:
[0076] Table 5 Gibson homologous recombination ligation system
[0077] Component Volume (μL) Reverse CENH3 0.5 Linearized vector pFGC5941_mCherry-pRPS5a: Forward CENH3 2 2×HieffClone Enzyme Premix 2.5
[0078] The reaction program was: incubate at 50 °C for 30 min.
[0079] 8. Obtain the vector pRPS5a::RNAi
[0080] The ligation product from step 7 was transformed into Escherichia coli competent cells DH5α, and the operation was the same as in step 5. After obtaining a sufficient amount of plasmid, it was sent to a gene company for sequencing to obtain the correctly ligated vector plasmid, which was the pRPS5a::RNAi vector.
[0081] Example 2
[0082] This example was to create a CENH3-based haploid inducer.
[0083] 1. Obtain transgenic positive seedlings
[0084] The constructed pRPS5a::RNAi vector in Example 1 was transferred into Agrobacterium tumefaciens GV3101, and the vector was transferred into wild-type Arabidopsis thaliana Col-0 by the floral dip method. Since the modified pFGC5941 vector carried an mcherry fluorescence screening marker, transgenic positive seeds were selected under a microscope by the fluorescence of mature seeds, and the seeds were sown to obtain T1 generation transgenic positive seedlings pRPS5a::RNAi.
[0085] Figure 2 This is the phenotype of the pRPS5a::RNAi transgenic plants in this example.
[0086] 2. Pollen viability detection
[0087] The pollen Alexander staining method was used, and the steps were as follows: Use forceps to take out the anthers from mature flower buds and place them on a glass slide. Drop 50 μL of Alexander Stain solution (Solarbio, G3050) on the glass slide, immerse the anthers in the staining solution, and cover with a coverslip. Place the slide in a 4°C refrigerator and incubate overnight in the dark. Use a stereomicroscope (Olympus, SZX16) to collect images.
[0088] Figure 3 is the pollen fertility of pRPS5a::RNAi transgenic plants in this example; it shows that the transgenic plants constructed by the present invention have no obvious growth defects and do not affect the fertility of plants.
[0089] 3. Hybridization
[0090] Grow the transgenic plants (male) in a 22°C greenhouse. Remove the immature flower buds and the opened flowers on the transgenic plants during the full bloom period, leaving 1 - 3 unopened large flower buds. Use forceps to remove the petals and stamens of the flower buds. Place the emasculated plants in a 22°C greenhouse to grow for 2 days, and then between 10 am and 4 pm, take the blooming flowers on Arabidopsis gl1 mutants to pollinate the stigmas of the transgenic plants. After pollination, place the plants in incubators at different temperatures for temperature treatment.
[0091] 4. Haploid identification
[0092] First, screen out candidate haploids by judging the leaf phenotypes. The phenotypes of haploid plants are short plants, narrow and hairless leaves, small flowers, and sterile siliques.
[0093] Screen out haploids by phenotype, and then use flow cytometry analysis to further confirm the ploidy of candidate haploids. The method is as follows: Extract the nuclei of young leaves of the plants to be tested, use the leaves of gl1 diploid plants as a control, and detect the PI (propidium iodide) signal with a flow cytometer. The diploid nuclear signal peak appears around 50. Since the number of chromosomes in the cells of haploids is halved, the haploid nuclear signal peak appears around 25. If the nuclear signal peak of the plant to be tested appears around 25, then the plant is a haploid.
[0094] Figure 4 is the haploid identification diagram of the hybrid offspring. Among them, in Figure A, from left to right are the phenotypes of haploid, aneuploid, and diploid plants in turn, and the scale bar is 4 cm; Figure B is the flow cytometry analysis results of diploid (left) and haploid (right).
[0095] 5. Statistical analysis of haploid induction efficiency
[0096] Haploid induction efficiency = number of haploid offspring / total number of offspring * 100%.
[0097] Table 6 Induction efficiency of pRPS5a::RNAi transgenic plants
[0098]
[0099] The above results show that the method of the present invention can create a CENH3-mediated haploid induction system by using the RPS5a promoter to drive RNAi (RNA interference) technology to inhibit CENH3 expression, enabling the plant to obtain haploid induction ability without causing growth defects in transgenic plants. This method can be used to create haploid induction systems for a variety of species such as any monocotyledonous and dicotyledonous plants.
[0100] Transferring the RPS5a promoter-driven RNAi technology system of the present invention into existing haploid induction systems can also optimize their induction efficiency, improve haploid induction ability, and do not cause growth defects in the induction systems, and can be used for the optimization of induction systems for any monocotyledonous and dicotyledonous plants and other species.
[0101] The method for inhibiting gene expression in the present invention is not only RNAi gene silencing technology, but also a series of reported technologies that can reduce the expression level of target genes in vivo, such as MIGS (miRNA-induced gene silence), VIGS (virus-induced gene silence), amiRNA (artificial RNA), CRISPR / Cas13, CRISPR interference, etc.; haploid induction systems can also be created by inhibiting other inducer genes, such as the reported inducer genes KNL2, MTL, PLD3, PLA, DMP, etc.; the promoter used can be the Arabidopsis RPS5a promoter or other promoters with an expression pattern similar to that of RPS5a but with a higher expression level than RPS5a; the present invention can also optimize haploid induction systems generated by any technical means to manipulate CENH3, such as cenh3-1, cenh3-8, GFP-tailswap, etc. The embodiments of the present invention only illustrate the construction and optimization of haploid induction systems in Arabidopsis wild-type plants, and this method can also be used for any monocotyledonous and dicotyledonous plants.
[0102] The above description is only a preferred embodiment of the present invention and does not impose any limitation on the present invention. Any simple modification, change, and equivalent change made to the above embodiments according to the technical essence of the invention still fall within the protection scope of the technical solution of the present invention.
Claims
1. A method for constructing a haploid inducer by driving RNAi technology through the RPS5a promoter, characterized in that, Comprising the following steps: S1. Construct a pRPS5a::RNAi vector Clone the RPS5a promoter fragment and the forward sequence of the full-length cDNA of the CENH3 gene into the modified pFGC5941_mcherry vector by Gibson homologous recombination method to obtain the pFGC5941_mCherry-pRPS5a: forward CENH3 vector; then clone the reverse sequence of CENH3 into the pFGC5941_mCherry-pRPS5a: forward CENH3 vector by Gibson method. The forward sequence and the reverse sequence of CENH3 are separated by the shA intron in between. Drive the forward sequence and the reverse sequence fragments of CENH3 by the RPS5a promoter to finally obtain the pRPS5a::RNAi vector; The nucleotide sequence of the CENH3 gene is shown in SEQ ID NO.1; The RPS5a promoter uses 1760 bp bases before the start codon ATG of the RPS5a gene as the RPS5a promoter, and the sequence is shown in SEQ ID NO.2; S2. Create a haploid inducer Transfer the pRPS5a::RNAi vector obtained in S1 into Agrobacterium tumefaciens GV3101, and then transform wild-type plants by the floral dip method, and screen for transgenic positive plants; then emasculate and hybridize the obtained transgenic positive plants at the full flowering stage to obtain hybrid progeny seedlings, count the haploid ratio in the hybrid progeny, and screen for plants with induction ability to obtain the haploid inducer pRPS5a::RNAi.
2. The method according to claim 1, characterized in that, The identification method of the haploid in S2: Screen candidate haploids through the plant leaf phenotype, and then further confirm the ploidy of the candidate haploid plants by flow cytometry analysis.
3. Use of the method for constructing a haploid inducer by RNAi technology driven by the RPS5a promoter according to any one of claims 1 to 2, characterized in that, It can be used to construct haploid inducers for any monocotyledonous and dicotyledonous plants, endow wild-type plants with induction ability, and do not cause growth defects in plants.