Application of cucumber CsAPRR2 gene in regulating and controlling peel color

The CRISPR-Cas9 technology knocked out the cucumber CsAPRR2 gene and created a yellow peel cucumber, solving the problem of underexploring the color regulation gene of cucumber peel, and achieving the improvement of the color diversity and economic value of the peel.

CN120249365APending Publication Date: 2025-07-04CHINA AGRI UNIV +1
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510460807.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-14
Publication Date
2025-07-04

AI Technical Summary

Technical Problem

The existing technology has not yet fully explored and cloned the color regulation gene of cucumber peel, which makes it difficult to meet the market diversity needs of the peel color, affecting the market competitiveness and variety improvement of cucumbers.

Method used

CRISPR-Cas9-mediated gene editing technology knocks out or reduces the expression and activity of cucumber CsAPRR2 protein, and uses CRISPR/Cas9 editing tools or siRNA/shRNA and other substances to achieve inhibition of the CsAPRR2 gene and create a yellow peeled cucumber.

Benefits of technology

The successful creation of yellow peel cucumber reveals the regulatory mechanism of peel yellowing, provides molecular tools and genetic resources for the color research and variety improvement of cucumber peels, and enhances the color diversity and economic value of peels.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses an application of a cucumber CsAPRR2 gene in regulating and controlling the color of pericarp. The invention relates to the field of plant genetic engineering, and provides application of inhibiting expression and / or activity of CsAPRR2 protein in creation of yellow peel cucumber. CsAPRR2 is knocked out through a CRISPR-Cas9 mediated gene editing technology, all knockout mutation lines show the pericarp yellowing character, a transmission electron microscope (TEM) shows that the chloroplast structure of the CsAPRR2 knockout line is damaged, and it is proved that the CsAPRR2 gene can regulate and control the color of the pericarp of the cucumber. The invention provides a molecular tool and a gene resource for researching a cucumber peel yellowing regulation mechanism and cultivating a new variety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of plant genetic engineering, and particularly to the application of cucumber CsAPRR2 genes in regulating fruit peel color. Background Art

[0002] Cucumber ( Cucumis sativus L.) is an important vegetable crop, and its fruit peel color is an important factor affecting market value and consumer choice. Consumers in different regions have strong regional characteristics in their preference for fruit peel color, which further illustrates the importance of fruit peel color in commodity value. In addition, cucumber fruit peel color is not only controlled by genetics, but also greatly affected by environmental factors. For example, cucumbers with yellow-brown fruit peel have bright colors and high flavonoid content in the fruit peel, and have high economic value and nutritional value (Cui Y, Li S, Dong Y, et al. 2023. Genetic regulation and molecular mechanism of immature cucumber peel color: A review. Vegetable Research 3:9 doi: 10.48130 / VR-2023-0009). Therefore, by utilizing target genes or beneficial mutations, the diversity of horticultural vegetable crop products can be increased, thereby enhancing their market competitiveness.

[0003] Significant progress has been made in the research on cucumber peel color, covering aspects such as gene mapping, candidate gene screening, and genetic analysis. These research results provide important theoretical basis and technical support for the basic research and genetic improvement of cucumber peel color.Five major genes controlling cucumber fruit peel color have been cloned, including CsARC5 and CsYcf54 (controlling light green peel), the w gene (controlling white peel), CsMYB36 (controlling yellow-green peel), and CsMYB60 (controlling orange peel) (Zhou Q, Wang S, Hu B, et al. 2015. An ACCUMULATION AND REPLICATION OFCHLOROPLASTS 5 gene mutation confers light green peel in cucumber. Journal ofIntegrative Plant Biology 57: 936-942; Lun Y, Wang X, Zhang C, et al. 2015. ACsYcf54 variant conferring light green coloration in cucumber. Euphytica 208:509-517; Liu H, Jiao J, Liang X, et al. 2016. Map-based cloning,identification and characterization of the w gene controlling white immaturefruit color in cucumber (Cucumis sativus L.). Theoretical and AppliedGenetics 129: 1247-1256; Hao N, Du Y, Li H, et al. 2018. CsMYB36 is involvedin the formation of yellow green peel in cucumber (Cucumis sativus L.).Theoretical and Applied Genetics 131: 1659-1669;Xu X, Zhu Y, Yuan Y, et al.R2R3-MYB transcription factor CsMYB60 controls mature fruit skin color byregulating flavonoid accumulation in cucumber. Plant Journal 2024;119(2):796-813.).

[0004] Therefore, further exploring and cloning the regulatory genes of cucumber peel color and verifying their functions are of great significance for deeply understanding the molecular mechanism of cucumber peel color formation. This not only helps to reveal the basic biological processes of plant pigment synthesis and distribution, but also provides new molecular breeding tools for cucumber variety improvement, promoting the development and optimization of agricultural production. Summary of the Invention

[0005] The object of the present invention is to provide the application of cucumber CsAPRR2 genes in regulating peel color.

[0006] In the first aspect, the present invention claims the application of inhibiting the expression and / or activity of CsAPRR2 protein in creating cucumbers with yellow peel. Among them, inhibiting the expression and / or activity of CsAPRR2 protein can be achieved through at least one of the following 6 regulatory levels: 1) inhibiting the expression of the CsAPRR2 protein-coding gene (i.e., CsAPRR2 gene) at the gene transcription level; 2) inhibiting the CsAPRR2 gene expression at the post-transcriptional level (that is, inhibiting the expression of CsAPRR2 protein by splicing or processing the primary transcripts of related genes); 3) inhibiting the expression of the protein encoded by the CsAPRR2 gene at the RNA transport level of the gene (that is, inhibiting the expression of the protein encoded by the CsAPRR2 gene by regulating the transport of the mRNA of related genes from the nucleus to the cytoplasm); 4) regulating at the translation level of the gene to inhibit the expression of the protein encoded by the CsAPRR2 gene; 5) regulating at the mRNA degradation level of the gene to inhibit the expression of the protein encoded by the CsAPRR2 gene; 6) regulating at the post-translational level of the gene to inhibit the activity of the protein encoded by the CsAPRR2 gene. The same applies hereinafter.

[0007] In the second aspect, the present invention claims the application of substances capable of inhibiting the expression level and / or activity of CsAPRR2 protein in creating cucumbers with yellow peel.

[0008] In the first and second aspects above, inhibiting the expression and / or activity of the CsAPRR2 protein may include reducing the degree of the expression and / or activity of the CsAPRR2 protein, but still having expression and / or partial activity; or may include reducing the expression and / or activity of the CsAPRR2 protein to 0, that is, having no expression and / or completely losing activity. The same applies hereinafter.

[0009] Furthermore, in the first and second aspects described above, the inhibition of the expression and / or activity of the CsAPRR2 protein can be achieved by knocking out or reducing the expression of the coding gene of the CsAPRR2 protein in the cucumber genome.

[0010] Furthermore, in the second aspect described above, the substance can be a substance capable of knocking out or reducing the expression of the coding gene of the CsAPRR2 protein in the cucumber genome.

[0011] Even further, the inhibition of the expression and / or activity of the CsAPRR2 protein can be achieved by introducing into the cucumber a CRISPR / Cas9 editing tool or siRNA or shRNA targeting the coding gene of the CsAPRR2 protein in the cucumber genome. Correspondingly, the substance can be a CRISPR / Cas9 editing tool or siRNA or shRNA targeting the coding gene of the CsAPRR2 protein in the cucumber genome.

[0012] In one embodiment of the present invention, the target sequences of the CRISPR / Cas9 editing tool are as shown in SEQ ID No.3 and / or SEQ ID No.4.

[0013] In a third aspect, the present invention claims protection for a method for creating a cucumber with yellow peel.

[0014] The method for creating a cucumber with yellow peel claimed by the present invention may include the following steps: inhibiting the expression level and / or activity of the CsAPRR2 protein in the cucumber genome, thereby achieving the creation of a cucumber with yellow peel.

[0015] Furthermore, in the method, the inhibition of the expression level and / or activity of the CsAPRR2 protein in the cucumber genome can be achieved by knocking out or reducing the expression of the coding gene of the CsAPRR2 protein in the cucumber genome.

[0016] Even further, in the method, the inhibition of the expression level and / or activity of the CsAPRR2 protein in the cucumber genome can be achieved by introducing into the cucumber a CRISPR / Cas9 editing tool or siRNA or shRNA targeting the coding gene of the CsAPRR2 protein in the cucumber genome.

[0017] In one embodiment of the present invention, the target sequences of the CRISPR / Cas9 editing tool are as shown in SEQ ID No.3 and / or SEQ ID No.4.

[0018] In one embodiment of the present invention, suppressing the expression level and / or activity of the CsAPRR2 protein in the cucumber genome is specifically achieved by deleting 3 bp at positions 4208 - 4210 and 19 bp at positions 4575 - 4593 in the coding gene of the CsAPRR2 protein shown in SEQ ID No.6 in the cucumber genome (thus forming a frameshift mutation) (corresponding to the mutant line in the example csaprr2#1 ), or by deleting 1 bp at position 4210 and 2 bp at positions 4592 - 4593 in the coding gene of the CsAPRR2 protein shown in SEQ ID No.6 in the cucumber genome (thus forming a frameshift mutation) (corresponding to the mutant line in the example csaprr2#2 ), or by deleting 8 bp at positions 4205 - 4212 and 1 bp at position 4593 in the coding gene of the CsAPRR2 protein shown in SEQ ID No.6 in the cucumber genome (thus forming a frameshift mutation) (corresponding to the mutant line in the example csaprr2#3 ).

[0019] In the above - mentioned related aspects, the CsAPRR2 protein can be any of the following: (A1) A protein with an amino acid sequence of SEQ ID No.1; (A2) A protein derived from cucumber, which has the same function as the amino acid sequence shown in SEQ ID No.1 after substitution and / or deletion and / or addition of one or several amino acid residues; (A3) A protein derived from cucumber, which has the same function as the amino acid sequence defined in any of (A1) - (A2) and has an identity of more than 99%, more than 95%, more than 90%, more than 85% or more than 80% with the amino acid sequence defined in any of (A1) - (A2).

[0020] In the above - mentioned proteins, identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using identity search sites on the Internet, such as the BLAST web page on the NCBI home page website. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and performing a search to calculate the identity of a pair of amino acid sequences, and then the identity value (%) can be obtained.

[0021] Among the above-mentioned proteins, the identity of more than 80% may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The identity of more than 85% may be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The identity of more than 90% may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The identity of more than 95% may be at least 95%, 96%, 97%, 98% or 99% identity.

[0022] In each of the above relevant aspects, the coding gene of the CsAPRR2 protein may be any of the following: (B1) a DNA molecule shown in SEQ ID No. 2 (CDS sequence) or SEQ ID No. 6 (genomic sequence); (B2) a DNA molecule that hybridizes with the DNA molecule defined in (B1) under stringent conditions and encodes the CsAPRR2 protein; (B3) a DNA molecule that has more than 99%, more than 95%, more than 90%, more than 85% or more than 80% identity with any of the DNA sequences defined in (B1)-(B2) and encodes the CsAPRR2 protein.

[0023] Among the above genes, the identity of nucleotide sequences can be determined using identity search sites on the Internet, such as the BLAST web page of the NCBI home page website. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and performing a search to calculate the identity of a pair of nucleotide sequences, and then the identity value (%) can be obtained.

[0024] Among the above genes, the identity of more than 80% may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The identity of more than 85% may be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The identity of more than 90% may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The identity of more than 95% may be at least 95%, 96%, 97%, 98% or 99% identity.

[0025] The present invention uses the F2 segregation population of cucumber near-isogenic lines 6101-11 (mainly showing yellow) and 6101-12 (mainly showing green) for genetic analysis, indicating that the yellowing gene contained in 6101-11 is a single recessive gene. Through BSA resequencing analysis and genetic linkage analysis, CsAPRR2 is located within a 198.7 Kb interval at the end of chromosome 3 of cucumber. Through RNA-seq and functional annotation of the genes within the mapped interval, a gene regulating pericarp yellowing was screened and named CsAPRR2 . The present invention further uses CRISPR-Cas9-mediated gene editing technology to CsAPRR2 knock out. All knockout mutant lines showed the trait of pericarp yellowing. Transmission electron microscopy (TEM) showed that CsAPRR2 the chloroplast structure of the knockout lines was damaged, confirming that CsAPRR2 genes can regulate the cucumber pericarp color. The present invention provides a molecular tool and gene resource for studying the regulation mechanism of cucumber pericarp yellowing and breeding new varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 is the field growth diagram of the two parental lines 6101-11 and 6101-12.

[0027] Figure 2 is the chlorophyll content diagram of the pericarps of the two parental materials. ** indicates P < 0.01; **** indicates P < 0.0001.

[0028] Figure 3 is the transmission electron microscopy diagram of the chloroplasts of the pericarps of the two parental materials.

[0029] Figure 4 is for CsAPRR2 the expression quantity diagram of genes in various tissue parts and different periods of the pericarp. In the figure, significant differences are indicated between different lowercase letters (P < 0.05).

[0030] Figure 5 For CsAPRR2 functional verification of genes. Among them, A is the gene structure and editing type; B is the phenotype diagram of WT and csaprr2 knockout lines; C is the chlorophyll content diagram of WT and csaprr2 knockout lines; D is the ultrastructure of WT chloroplasts; E is the ultrastructure of csaprr2 knockout line chloroplasts (csaprr2 is csaprr2#1 , csaprr2#2 and csaprr2#3 the ultrastructure of chloroplasts is the same as csaprr2#1 here only one figure is shown). In the figure, significant differences are indicated between different lowercase letters (P < 0.05). Specific embodiments

[0031] The present invention will be further described in detail below in conjunction with specific embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0032] The experimental methods in the following embodiments, unless otherwise specified, are all conventional methods, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following embodiments, unless otherwise specified, can all be obtained from commercial channels.

[0033] The pKSE402 vector involved in the following embodiments is described in the article "Songlin Yang, et al. The CsTM alters multicellular trichome morphology and enhances resistance against aphid by interacting with CsTIP1;1 in cucumber. Journal of Advanced Research 69(2025)17 - 30", which can be obtained from the applicant by the public and can only be used for repeating the experiments of the present invention and cannot be used for other purposes.

[0034] Example 1. Screening genes regulating cucumber peel color I. Obtaining two parental materials The cucumber materials used in the present invention are two near - isogenic line materials obtained by continuous self - crossing for multiple generations, differing only in peel color, 6101 - 11 (mainly showing yellow) and 6101 - 12 (mainly showing green) ( Figure 1 ). All experimental materials are provided by the Cucumber Genetic Improvement and Molecular Regulation Research Group of China Agricultural University.

[0035] II. Phenotypic analysis of peel yellowing materials Compared with 6101-12, the peel color of 6101-11 showed a yellowing trait starting from the day of flowering. And with the increase of developmental days, the difference in peel color became more significant. At 12 days after flowering, the chlorophyll content in the peel of 6101-11 was extremely significantly lower than that of 6101-12 ( Figure 2 ). Transmission electron microscopy was further used to observe the chloroplast structure of the peel of the two parental materials. The chloroplasts of the 6101-12 material presented regular oval shapes, with thick and well-stacked internal grana lamellae, regular stacking, high degree of stacking, and good development. While the internal grana lamellae of the chloroplasts of the 6101-11 material were thin and sparse, with a low degree of stacking and loose structure ( Figure 3 ).

[0036] III. Population construction and genetic analysis 6101-11 and 6101-12 were crossed and mated. All F1 plants showed the phenotype of 6101-12, indicating that the target gene is controlled by a recessive nuclear gene. The segregation ratio of the F2 segregation population was statistically analyzed (Table 1). The results showed that the segregation ratio of green peel plants and yellow peel plants was close to 3:1 after chi-square test, indicating that the target gene is controlled by a single recessive nuclear gene.

[0037] Table 1. Genetic analysis of peel yellowing gene

[0038] IV. CAPRR2 Gene mapping Combined with the resequencing data, available InDel markers were screened within the initial mapping linkage interval from 37.05 Mb to 39.78 Mb. A total of 188 pairs of InDel marker primers were designed to detect their polymorphisms between the two parents 6101-11 and 6101-12. After polymorphism screening of the two parents and linkage detection of 30 single-plant small populations, finally 30 pairs of InDel markers with polymorphisms between the two parents, linked to the target trait, and with good repeatability and clear and stable bands in the population were obtained.

[0039] Due to the relatively short physical distances between some of the above-mentioned markers, 9 pairs of them were selected for detection in all the recessive individuals of the F2 population. The target gene locus was finally narrowed down to a 198.7 kb region. To further screen for the target gene, we took pericarp samples at three stages after pollination (0, 6, and 12 DAF) of 6101-11 and 6101-12 for RNA-seq. We identified 3959 differentially expressed genes. After intersecting these differentially expressed genes with the 26 genes in this interval, only 5 genes remained. Among them, only the gene sequences of Csa3G903460 and Csa3G904140 were different between the two parental lines. Further investigation found that the mutation of Csa3G903460 was a nonsense mutation, while there was a single-base G insertion in Csa3G904140 in the 6101-11 material. This type of mutation would lead to premature termination of protein translation, resulting in the lack of 101 amino acid residues at the C-terminus. The qRT-PCR results showed that this gene was highly expressed in the pericarp 6 days after flowering ( Figure 4 ), so we considered this gene as a candidate gene for the pericarp gene and named it CsAPRR2 according to the naming rules in Arabidopsis thaliana.

[0040] The amino acid sequence of the CsAPRR2 protein is shown in SEQ ID No.1, and the CDS sequence of its encoding gene (named CsAPRR2 gene) is shown in SEQ ID No.2, and its sequence on the cucumber genome is shown in SEQ ID No.6.

[0041] Example 2. Cucumber CsAPRR2 Application of the gene in regulating pericarp color I. Construction of the CsAPRR2 gene knockout vector mediated by CRISPR / Cas9 1. Design of the target sequences of the sgRNA sequences Using the CsAPRR2 gene as the target gene, the online website CRISPR-P 2.0 (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR) was used to predict and design target sequences with a length of 19 bp. The target nucleotide sequences are shown in SEQ ID No.3 and SEQ ID No.4.

[0042] Target sequence 1: 5’-ATTGCAAGTCATCTCCAGG-3’ (SEQ ID No.3); Target sequence 2: 5’-CCCTGGAATTCCTACGCAG-3’ (SEQ ID No.4).

[0043] 2. Construction of CRISPR / Cas9-mediated CsAPRR2 gene knockout vector According to the above two target sequences, the following four primers (5'-3') were designed: CsAPRR2-DT1-BsF: ATATATGGTCTCGATTG ATTGCAAGTCATCTCCAGG GTT; CsAPRR2-DT1-F0: TG ATTGCAAGTCATCTCCAGG GTTTTAGAGCTAGAAATAGC; CsAPRR2-DT2-R0: AAC CTGCGTAGGAATTCCAGGG CAATCTCTTAGTCGACTCTAC; CsAPRR2-DT2-BsR: ATTATTGGTCTCGAAAC CTGCGTAGGAATTCCAGGG CAA.

[0044] Note: The underlined part corresponds to the target sequence.

[0045] Four-primer PCR amplification: Using the pCBC-DT1T2 plasmid as a template, PCR amplification was carried out with the above four primers. Among them, the concentrations of CsAPRR2-DT1-BsF / CsAPRR2-DT2-BsR in the reaction system were 2 μM, and the concentrations of CsAPRR2-DT1-F0 / CsAPRR2-DT2-R0 in the reaction system were 100 nM. The total volume of the reaction system was 50 μL.

[0046] Purify and recover the above PCR product (626 bp), as shown in SEQ ID No.5, and establish a digestion-ligation system, as shown in Table 2.

[0047] Table 2. Digestion-ligation system

[0048] Take the above digestion-ligation product, transform the DH5α Escherichia coli competent cells, and use the primers U626-F / U629-R for colony PCR to identify positive recombinants. Those with a 726 bp target product amplified are positive. The obtained CRISPR / Cas9-mediated CsAPRR2 gene knockout vector was named pKSE402-CsAPRR2.

[0049] Colony PCR primer sequences (5'-3'): U626-F: TGTCCCAGGATTAGAATGATTAGGC; U629-R: AGCCCTCTTCTTTCGATCCATCAAC.

[0050] The structure of the recombinant vector pKSE402-CsAPRR2 is described as follows: a recombinant plasmid obtained by replacing two 19-bp N sequences in the pKSE402 vector sequence with two 19-bp target sequences (i.e., SEQ ID No.3 and SEQ ID No.4).

[0051] II. CsAPRR2 Obtaining of gene knockout cucumber mutant lines 1. Transformation of Agrobacterium tumefaciens GV3101 with the recombinant vector pKSE402-CsAPRR2 The CRISPR / Cas9 recombinant plasmid pKSE402-CsAPRR2 obtained in the above step I was transformed into Agrobacterium tumefaciens competent cells GV3101 by the freeze-thaw method. The specific operation steps were carried out according to the Agrobacterium tumefaciens competent cell transformation instruction manual provided by the biological company.

[0052] 2. Agrobacterium-mediated genetic transformation of cucumber Cucumber genetic transformation was carried out according to the method described in (Wang Z, Zhou Z, Wang L, et al. 2022. The CsHEC1-CsOVATE module contributes to fruit neck length variation via modulating auxin biosynthesis in cucumber. Proceedings of the National Academy of Sciences of the United States of America 119(39)), and the cucumber variety was 'Changchun Mici'. GFP fluorescent buds were preliminarily identified using a fluorescent flashlight. Plant genomic DNA was extracted, the sequences before and after the target site were amplified and sent for sequencing to identify positive knockout plants. The sequencing results showed that gene editing of cucumber was successfully achieved using the CRISPR / Cas9 technology, and 3 non-transgenic homozygous mutant lines were identified, namely CsAPRR2 and csaprr2#1, csaprr2#2 and csaprr2#3 ( Figure 5 in A).

[0053] Mutant line csaprr2#1 had a 3-bp deletion at positions 4208-4210 and a 19-bp deletion at positions 4575-4593 in the coding gene of the CsAPRR2 protein shown in SEQ ID No.6 in the cucumber genome (corresponding to a 3-bp deletion at positions 976-978 and a 19-bp deletion at positions 1228-1246 of SEQ ID No.2), resulting in a frameshift mutation.

[0054] Mutant line csaprr2#2To delete 1 bp at the 4210th position and delete 2 bp at the 4592-4593rd positions (corresponding to deleting 1 bp at the 978th position and deleting 2 bp at the 1245-1246th positions of SEQ ID No. 2) in the coding gene of the CsAPRR2 protein shown in SEQ ID No. 6 in the cucumber genome, resulting in a frameshift mutation.

[0055] mutant line csaprr2#3 To delete 8 bp at the 4205-4212th positions and delete 1 bp at the 4593rd position (corresponding to deleting 8 bp at the 973-980th positions and deleting 1 bp at the 1246th position of SEQ ID No. 2) in the coding gene of the CsAPRR2 protein shown in SEQ ID No. 6 in the cucumber genome, resulting in a frameshift mutation.

[0056] III. CsAPRR2 Observation of the pericarp color of gene knockout plants Compared with WT (‘Changchun Mici’), the pericarp colors of the three CsAPRR2 gene knockout mutant lines were all yellowed ( Figure 5 in B), and the chlorophyll content was significantly lower than that of WT ( Figure 5 in C). Further transmission electron microscopy observation found that the chloroplasts of WT were oval, with the internal thylakoids tightly stacked to form a flattened grana structure and containing starch grains, while in CsAPRR2 the gene knockout mutant lines, both the chloroplast membrane and thylakoids were blurred, the chloroplasts were significantly reduced and malformed, and the number of grana was small and irregular in shape ( Figure 5 in D and E). The above indicates that CsAPRR2 the gene is the core gene causing the yellowing of the cucumber pericarp.

[0057] The above data together support that CsAPRR2 the gene is the core gene causing the yellowing of the cucumber pericarp. This helps to deeply understand the formation mechanism of cucumber fruit color, and at the same time provides gene resources and molecular design breeding references for agricultural production and genetic breeding.

[0058] The above has detailed the present invention. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although the present invention gives specific embodiments, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by using conventional techniques known in the art that are outside the scope disclosed in this application.

Claims

1. Use of inhibiting the expression and / or activity of CsAPRR2 protein in creating cucumbers with yellow peel.

2. Use of a substance capable of inhibiting the expression level and / or activity of CsAPRR2 protein in creating cucumbers with yellow peel.

3. The application according to claim 1 or 2, characterized in that: Inhibiting the expression and / or activity of the CsAPRR2 protein is achieved by the following means: knocking out or reducing the expression of the coding gene of the CsAPRR2 protein in the cucumber genome; The substance is a substance capable of knocking out or reducing the expression of the coding gene of the CsAPRR2 protein in the cucumber genome.

4. The application according to any one of claims 1 to 3, characterized in that: Inhibiting the expression and / or activity of the CsAPRR2 protein is achieved by introducing a CRISPR / Cas9 editing tool targeting the coding gene of the CsAPRR2 protein in the cucumber genome into the cucumber; The substance is a CRISPR / Cas9 editing tool targeting the coding gene of the CsAPRR2 protein in the cucumber genome; Furthermore, the target sequence of the CRISPR / Cas9 editing tool is as shown in SEQ ID No.3 and / or SEQ ID No.

4.

5. A method for creating cucumbers with yellow peel, comprising the following steps: inhibiting the expression level and / or activity of CsAPRR2 protein in the cucumber genome, thereby achieving the creation of cucumbers with yellow peel.

6. The method according to claim 5, characterized in that: In the method, inhibiting the expression level and / or activity of the CsAPRR2 protein in the cucumber genome is achieved by the following means: knocking out or reducing the expression of the coding gene of the CsAPRR2 protein in the cucumber genome.

7. The method according to claim 5 or 6, characterized in that: In the method, inhibiting the expression level and / or activity of the CsAPRR2 protein in the cucumber genome is achieved by introducing a CRISPR / Cas9 editing tool targeting the coding gene of the CsAPRR2 protein in the cucumber genome into the cucumber.

8. The method according to any one of claims 5 to 7, characterized in that: The target sequence of the CRISPR / Cas9 editing tool is as shown in SEQ ID No.3 and / or SEQ ID No.

4.

9. The application or method according to any one of claims 1-8, characterized in that: The CsAPRR2 protein is any one of the following: (A1) A protein with an amino acid sequence of SEQ ID No.1; (A2) A protein derived from cucumber that has the same function and has one or several amino acid residues substituted and / or deleted and / or added to the amino acid sequence shown in SEQ ID No.1; (A3) A protein derived from cucumber that has the same function and has more than 99%, more than 95%, more than 90%, more than 85% or more than 80% identity with the amino acid sequence defined in any one of (A1)-(A2).

10. The application or method according to any one of claims 1-9, characterized in that: The coding gene of the CsAPRR2 protein is any one of the following: (B1) The DNA molecule shown in SEQ ID No.2 or SEQ ID No.6; (B2) A DNA molecule that hybridizes with the DNA molecule defined in (B1) under stringent conditions and encodes the CsAPRR2 protein. A DNA molecule that has more than 99%, more than 95%, more than 90%, more than 85% or more than 80% identity with any of the DNA sequences defined in (B1)-(B2) and encodes the CsAPRR2 protein.

Citation Information

Cited By

  • Regulation and control effect of McCAB1 gene on bitter gourd peel color

    CN121064306A