Application of SlBIW gene in regulation and control of lateral branch growth of tomato

By overexpressing or knocking out the SlBIW gene in tomatoes, and using CRISPR/Cas9 technology to regulate tomato branch growth, the problem of excessive branch growth in the existing technology is solved, and the formation and cost optimization of ideal plant types are achieved.

CN120249371APending Publication Date: 2025-07-04ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510499440.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-21
Publication Date
2025-07-04

AI Technical Summary

Technical Problem

In the prior art, the methods for regulating the growth of tomato branches are insufficient, resulting in excessive lateral branches consume nutrients, inhibiting the development of main stems and fruits, affecting the height and fruit quality of plants, increasing the cost of artificial branching, and limiting industrial development.

Method used

By overexpressing or knocking out the SlBIW gene, gene editing is performed in tomatoes using CRISPR/Cas9 technology to achieve overexpression or deletion of the SlBIW gene and regulate the growth of tomato branches.

Benefits of technology

Overexpression of the SlBIW gene can significantly inhibit the growth of tomato branches, form an ideal plant type, reduce pruning costs, promote the rational transformation of photosynthetic products, and adapt to high-density planting and mechanized operations.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249371A_ABST
    Figure CN120249371A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to application of an SlBIW gene in regulation and control of lateral branch growth of tomatoes, and the CDS sequence of the SlBIW gene is shown as SEQ ID NO.1. The invention also relates to application of the SlBIW gene in regulation and control of lateral branch growth of tomatoes. According to the invention, a transgenic tomato plant with overexpression and gene knockout of the SlBIW gene is constructed and obtained, observation and mathematical statistics are carried out on the phenotype of the lateral branch to find that the SlBIW gene can inhibit the growth of the lateral branch of the tomato, the function of regulating and controlling the growth of the lateral branch of the tomato by the SlBIW gene and the encoded protein thereof is disclosed, and the regulation and control of the plant type of the tomato are realized; and a reference basis is provided for cultivation of new varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and specifically relates to the application of the SlBIW gene in regulating the growth of tomato lateral branches. Background Art

[0002] Tomato (Solanum lycopersicum) is the vegetable crop with the largest cultivation area in protected facilities in China. Its plant type structure, especially the growth characteristics of lateral branches, significantly affects the yield. Excessive lateral branches consume nutrients, inhibit the development of the main stem and fruits, resulting in short plants, uneven fruits, and reduced quality. Manual pruning increases costs and restricts the development of the industry. Controlling the growth of lateral branches and optimizing the plant type can promote the reasonable conversion of photosynthetic products, reduce pruning costs, and adapt to high-density planting and mechanized operations. Therefore, studying the branching mechanism and breeding varieties with fewer lateral branches is of great significance.

[0003] The formation of plant lateral branches mainly includes stages such as the formation of axillary meristems (AM), axillary bud dormancy, activation, and growth (Barbier et al., 2019). AM is laterally differentiated from the shoot apical meristem (SAM), and its formation requires the establishment of a boundary between the main stem and leaf primordia, relying on the regulation of transcription factors such as GRAS and MYB (Schumacher et al., 1999; Schmitz et al., 2002). The WUSCHEL gene (WUS) and the SHOOT MERISTEMLESS gene (STM) are key markers for the establishment of AM. WUS interacts with STM under the induction of cytokinin, activates CLAVATA3 (CLV3), and promotes the differentiation of AM into axillary buds (Leibfried et al., 2005; Su et al., 2020). The growth and development of axillary buds are regulated by endogenous hormones, sugar signals, and exogenous factors such as light and temperature.

[0004] TEOSINTE BRANCHED1 (TB1) and its homologous gene BRANCHED1 (BRC1) are core elements of the axillary bud regulatory network, encoding TCP transcription factors that inhibit axillary bud formation. In tomatoes, the key transcription factor BZR1 of the brassinosteroid (BR) signal directly binds to the BRC1 promoter and inhibits its expression to promote lateral branch development (Xia et al., 2021); overexpression of cytokinin (CKs) synthesis genes significantly weakens apical dominance (Eviatar-Ribak et al., 2013). In addition, HY5 in the light signaling pathway promotes axillary bud growth by binding to the BRC1 promoter and inhibiting its expression (Dong et al., 2023).

[0005] BIW is a WD40 protein, and such proteins are involved in various processes such as cell cycle control, transcriptional regulation, chromatin modification, and signal transduction (Park et al., 2018; Jain and Pandey, 2018; LaFountain and Yuan, 2021). The cucumber LITTLELEAF (LL) gene encodes a WD40 protein, and the ll mutant exhibits a significantly increased number of lateral branches compared to the wild type (Yang et al., 2018). The BOQ gene encodes the WD40 protein VIP3, and its special mutant boq-1 forms multiple additional SAMs at the apex, resulting in an increase in the number of lateral branches and inflorescences (Takagi et al., 2012). OsWDR5a interacts with OsTrx1 / SDG723 to form a COMPASS-like complex that promotes rice flowering and tillering (Jiang et al., 2018).

[0006] In the Chinese patent application "2024100712194", the function of the SlBIW gene in regulating tomato fruits was studied, but whether the SlBIW gene has a regulatory effect on tomato lateral branch growth remains unknown. Summary of the Invention

[0007] In view of the need for technical methods for regulating the growth and development of tomato lateral branches in the prior art, the present invention provides the application of the SlBIW gene in regulating tomato lateral branch growth. The specific technical solutions are as follows:

[0008] In a first aspect, the present invention provides the application of the SlBIW gene in regulating tomato lateral branch growth, and the CDS sequence of the SlBIW gene is as shown in SEQ ID NO.1.

[0009] Furthermore, the application approach is as follows:

[0010] (1) By overexpressing the SlBIW gene, the growth of tomato lateral branches is inhibited;

[0011] (2) By knocking out the SlBIW gene, the growth of tomato lateral branches is promoted.

[0012] In this application, for the regulation of the SlBIW gene

[0013] Furthermore, the method for overexpressing the SlBIW gene is as follows:

[0014] (1) Design an overexpression primer sequence using wild-type tomato cDNA as a template, and construct an overexpression vector for the SlBIW gene;

[0015] (2) Transfer the vector into Agrobacterium competent cells to obtain Agrobacterium overexpressing the SlBIW gene;

[0016] (3) Infect the cotyledons of common wild-type tomatoes with Agrobacterium, regenerate seedlings through tissue culture, and screen for overexpressing plants of the SlBIW gene.

[0017] Further, the method for knocking out the SlBIW gene is as follows:

[0018] (1) According to the SlBIW genomic sequence, design the target sequence sgRNA, and construct a CRISPR / Cas9 vector for editing the SlBIW gene in tomatoes;

[0019] (2) Transfer the vector into Agrobacterium competent cells to obtain Agrobacterium containing the CRISPR / Cas9 vector for editing the SlBIW gene;

[0020] (3) Infect the cotyledons of common wild-type tomatoes with Agrobacterium, regenerate seedlings through tissue culture, and screen for SlBIW gene deletion mutants.

[0021] Further, the sgRNA is as shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7.

[0022] In the present invention, it is found that the SlBIW gene has the function of regulating the growth of tomato lateral buds. Compared with wild-type plants, the length of lateral buds of plants overexpressing the SlBIW gene can be reduced by more than 50%, which is beneficial to forming an ideal plant type of tomatoes. And through further experiments, it is found that after overexpressing the SlBIW gene, the expression level of the SlBRC1 gene in tomatoes is significantly higher than that of the wild type, while after knocking out the SlBIW gene, the expression level of the SlBRC1 gene is significantly lower than that of the wild type.

[0023] In the second aspect, the present invention provides the application of the SlBIW protein in regulating the growth of tomato lateral branches. The amino acid sequence of the SlBIW protein is as shown in SEQ ID NO.2.

[0024] In the third aspect, the present invention provides the application of a recombinant vector in regulating the growth of tomato lateral branches. The recombinant vector contains the SlBIW gene, and the CDS sequence of the SlBIW gene is as shown in SEQ ID NO.1.

[0025] In the fourth aspect, the present invention provides the application of a genetically engineered bacterium in regulating the growth of tomato lateral branches. The genetically engineered bacterium contains the SlBIW gene, and the CDS sequence of the SlBIW gene is as shown in SEQ ID NO.1.

[0026] Fifth aspect, the present invention provides a method for inhibiting the growth of tomato lateral branches, comprising: overexpressing the SlBIW gene in tomatoes by means of genetic engineering; the CDS sequence of the SlBIW gene is as shown in SEQ ID NO.1.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] (1) The present invention constructs transgenic tomato plants with overexpression and gene knockout of the SlBIW gene, observes and statistically analyzes the lateral branch phenotypes, and finds that the SlBIW gene can inhibit the growth of tomato lateral branches;

[0029] (2) The present invention reveals that the SlBIW gene and its encoded protein regulate the growth of tomato lateral branches, realizes the regulation of tomato plant type, and provides a reference basis for the cultivation of new varieties. Description of the Drawings

[0030] Figure 1 Schematic diagram of gene editing sites and amino acid changes in homozygous mutant plants with the SlBIW gene knocked out; among them, WT is the common wild-type tomato variety Condine Red; biw is the SlBIW gene knockout mutant, where the biw 5# mutant lacks 5 bases, and biw 7# inserts 1 base into the gene, and these mutations all lead to premature termination of protein translation.

[0031] Figure 2 Western blot analysis result diagram of SlBIW gene overexpressing plants; among them, WT is the common wild-type tomato variety Condine Red, OE-SlBIW is the SlBIW gene overexpressing plant, and Actin protein is used as an internal reference to verify the consistency of the loading amount. The results show that there is an overexpressed BIW protein with an HA tag in the OE-SlBIW plants.

[0032] Figure 3 Schematic diagram of tomato lateral branch phenotypes (A), total lateral branch length (B), and BRC1 gene expression level (C); among them, the experimental materials include wild-type tomatoes (WT), SlBIW overexpressing plants (OE-SlBIW), and SlBIW mutant plants (biw5#, biw7#); scale bar: 1 cm. The experiment adopts a completely randomized design and sets multiple replicates (in Figure B, n = 12; in Figure C, n = 3); the data is statistically analyzed for variance using the Graphpad software package (Graphpad 9.0); the differences between two groups are detected by Student’s t-test, and the significance of the differences is indicated by different numbers of * (*P<0.05, **P<0.01, ***P<0.001). Detailed implementation manners

[0033] To enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be clearly and completely described below in conjunction with specific embodiments. It should be noted that the following detailed descriptions are all exemplary and only represent some embodiments of the present invention, rather than all embodiments.

[0034] All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the scope of protection of the present invention.

[0035] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which this application belongs. The experimental materials used in the embodiments of the present invention are all conventional experimental materials in the art and can be obtained through commercial channels. The experimental methods without detailed conditions are carried out according to conventional experimental methods or according to the operation manuals recommended by the suppliers.

[0036] The CDS sequence of the SlBIW gene in the present invention is shown in SEQ ID NO.1, the amino acid sequence is shown in SEQ ID NO.2, and the genomic sequence is shown in SEQ ID NO.3.

[0037] SEQ ID NO.1:

[0038]

[0039] SEQ ID NO.2:

[0040] MDKKKVVAPLVCHGHSRPVVDLSYSPITPDGFFLISASKDSTPMLRNGETGDWIGTFEGHKGAVWSCCLDKHALRAASASADFSAKLWDALTGDVLHSFDHKHIVRACAFSEDTNLLLTGGFEKILRIFDLNRPDAPPREIDSSPGSVRTVAWLHSDQTILSSSGDAGGLRLWDVRTGKVVQILETKFPVTSAEVSQDGRYITTADGSSVKFWDANHFGLVKSHELPCKVESASLEPKFGNRFIAGGEDMWVHVFDFHTGEEIGCNKGHHGPVHCLRFSPGGESYASGSEDGTIRIWQLGPLGQIEDNSTANGSTTANANDGMGEVTQKIDELAVSETKKKEETQVDGVEQKVVDA*。

[0041] SEQ ID NO.3:

[0042]

[0043] Example 1 Obtaining and Identification of SlBIW Gene Deletion Mutants

[0044] 1. Construction of CRISPR / Cas9 Gene Editing Vector for SlBIW Gene and Transformation of Agrobacterium

[0045] The genomic sequence of SlBIW was obtained through the SGN website https: / / solgenomics.net / , as shown in SEQ ID NO.3.

[0046] Using the CRISPR-P website crispr.hzau.edu.cn / CRISPR2 / , the corresponding target sites were found (1: TCTACGCCAATGCTGAGAAA; 2: TCGAGCATGTGCCTTTTCAG). Using tRNA as a template, the target fragment was amplified with the corresponding primers. Subsequently, the amplified fragment was ligated to the pHEE401 vector using NEB enzymes. The specific primer sequences are shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7.

[0047] SEQ ID NO.4:

[0048] CTGGTCTCTATTGAACAAAGCACCAGTGGTCTAGTG;

[0049] SEQ ID NO.5:

[0050] CTGGTCTCTATGGCAAACAAGCGGTGCCATGCACCAGCCGGGAA;

[0051] SEQ ID NO.6:

[0052] GCTGGTCTCTCCATGTTTTAGAGCTAGAAATAGCAAGTTA;

[0053] SEQ ID NO.7:

[0054] GCTGGTCTCTAAACTCAGGAGTGATTGGACTGTATGCACCAGCCGGGAATCG.

[0055] 2. Obtaining of SlBIW Gene Deletion Mutants

[0056] Through plant tissue culture technology, the constructed Agrobacterium (infection concentration OD 600Infect the leaves of wild - type tomato Condine Red (CR) with Agrobacterium tumefaciens strain EHA105 (OD600 is approximately 0.8 - 1.0), and carry out the processes of dedifferentiation and redifferentiation in the medium containing different proportions of hormones to induce tissue growth until rooting. Obtain T0 generation transgenic plants.

[0057] 3. Verification of the SlBIW gene deletion mutants

[0058] Using the genomic DNA of transgenic plants as a template, perform PCR amplification with verification primers and determine the sequence of the product fragment. Compare it with the wild - type sequence to select positive plants. Detect the T1 generation plants obtained by self - crossing of heterozygous mutants to obtain homozygous mutants. The verification primer sequences are shown in SEQ ID NO.8 and SEQ ID NO.9, and the results are as Figure 1 shown, and the SlBIW gene deletion mutants biw 5# and biw 7# are obtained.

[0059] SEQ ID NO.8: TGTTGAATCGAGATGAAT;

[0060] SEQ ID NO.9: TCAAACAAAGTGCAACAG.

[0061] Example 2 Obtaining and identification of SlBIW gene over - expression plants

[0062] 1. Construction of the SlBIW gene over - expression vector and obtaining of Agrobacterium tumefaciens containing the gene - editing vector

[0063] Retrieve the full - length CDS sequence of the SlBIW gene (shown in SEQ ID NO.1) through the SGN website (http: / / solgenomics.net). Select AscI and KpnI as restriction enzyme sites, and design specific homologous recombination primers HA - BIW - F (nucleotide sequence shown in SEQ ID NO.10) and HA - BIW - R (nucleotide sequence shown in SEQ ID NO.11) through CE design. Perform PCR amplification using wild - type tomato cDNA as a template.

[0064] SEQ ID NO.10:

[0065] TTACAATTACCATGGGGCGCGCCATGGATAAGAAGAAAGTTGTGGCA;

[0066] SEQ ID NO.11:

[0067] AACATCGTATGGGTAGGTACCGGCATCAACTACCTTCTGCTCC.

[0068] The overexpression vector pAC004-HA37℃ was digested with restriction endonucleases AscI and KpnI for 3 hours. The PCR products and digested vectors were purified, and the ligation products were obtained by reacting with Exnase II homologous recombinase (vazyme) at 37℃ for 30 min. The ligation products were mixed with Escherichia coli competent cells trans5α at a ratio of 1:10 (v:v), heat-shocked in a 42℃ water bath for 60 - 90 s, quickly inserted on ice, left standing for 2 min, 600 ml of liquid LB was added, cultured at 37℃ on a shaker at 200 rpm for 1 h, centrifuged at 4000g at room temperature for 2 minutes, half of the supernatant was discarded, and the cells were resuspended and spread on a chloramphenicol-resistant plate for overnight culture. Single colonies were picked and inoculated into liquid media with corresponding resistance for colony PCR verification to obtain positive plasmids. The sequencing primer sequences correspond to those shown in SEQ ID NO.4 and SEQ ID NO.5. The successfully constructed SlBIW overexpression vector was transformed into Agrobacterium tumefaciens GV3101 by electroporation at 2.5 Kv.

[0069] 2. Obtaining and verification of SlBIW gene overexpressing plants

[0070] The process of obtaining overexpressing plants by plant tissue culture technology was the same as in Example 1. Western Blot technology was used to verify the T0 generation plants. Specific bands would appear in OE-SlBIW positive plants after incubation with anti-HA antibody, as Figure 2 shown, and the SlBIW gene overexpressing plants OE-SlBIW were obtained.

[0071] Example 3 Observation and statistical analysis of axillary bud phenotypes of SlBIW gene overexpressing plants and deletion mutants

[0072] The experimental materials included wild-type tomatoes (WT), the SlBIW gene deletion mutants biw5# and biw7# constructed in Example 1, and the SlBIW gene overexpressing plants OE-SlBIW constructed in Example 2. The seeds were soaked in a conical flask filled with water and germinated on a shaker at 28℃ and 200 rpm for 3 days. When the radicle length reached about 0.5 cm, the seeds were sown in a seedling tray filled with a mixture of peat and vermiculite (volume ratio 2:1). After the second true leaf was fully expanded, the seedlings were transferred to flower pots filled with the same mixture. Hoagland nutrient solution was watered 2 - 3 times a week. Plant growth environment: light intensity (PPFD) was 200 μmol m -2 s -1 , the light cycle was 12 hours light / 12 hours dark, and the temperature was 23℃ / 20℃ (day / night).

[0073] When the plants grew to 7 leaves and 1 heart, the phenotypes were photographed, and the phenotypes of each plant were as Figure 3As shown in A, use a vernier caliper to measure the lengths of the lateral buds from the first node to the fifth node (from bottom to top), calculate the total, and analyze the differences. As Figure 3 As shown in B, the average total length of the lateral buds of biw5# is 4.575 cm, that of biw7# is 3.742 cm, that of WT is 3.258 cm, and that of OE-SlBIW plants is 1.467 cm. The statistical results show that there are significant differences in the lateral bud lengths between the deletion mutants and overexpressing plants and the wild type.

[0074] Example 4 Detection of SlBRC1 Gene Expression

[0075] 1. Plant RNA extraction: Grind tomato lateral buds in liquid nitrogen, and use a plant total RNA extraction kit (DP432, RNApreppure Plant Kit, Tiangen, Beijing) to extract the samples.

[0076] 2. cDNA synthesis: According to the instructions of the Novizan reverse transcription kit (HiScript II Q RT SuperMix for qPCR, R223-01, Vazyme, Nanjing), remove genomic DNA and synthesize cDNA using reverse transcriptase.

[0077] 3. Gene expression detection: Use the SYBR reaction system (ChamQ Universal SYBR qPCR Master Mix, Vazyme, Nanjing) to perform quantitative real-time PCR reactions on a LightCycler 480II real-time PCR instrument. Select the housekeeping gene Actin as the internal reference gene for calculating the relative expression of the target gene. The specific analysis method is the 2 -ΔΔC T method, referring to (Livak et al., 2001).

[0078] The primer sequences of the gene and Actin are shown in SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, and SEQ ID NO.15. The results are as Figure 3 shown in C: The trend of SlBRC1 gene expression is opposite to the trend of the total length of lateral buds, that is, the expression level of the SlBRC1 gene in biw lateral buds is lower than that in the wild type, and the expression level in OE-SlBIW lateral buds is higher than that in the wild type, and there are significant differences in both cases.

[0079] SEQ ID NO.12: TGGTGCAATTTGTGCATCTA;

[0080] SEQ ID NO.13: ATCTTGAGCGGTTTCCTTGT;

[0081] SEQ ID NO.14: TGTCCCTATTTACGAGGGTTATGC;

[0082] SEQ ID NO.15: CAATCGCCTCCAGCCTTGTTGTAA.

[0083] The present invention discovers that the SlBIW gene of tomato has the function of regulating the growth of tomato lateral branches. After knocking it out, the length of tomato lateral branches is increased, while overexpressing it can effectively inhibit the growth of tomato lateral branches, which is beneficial to forming an ideal plant type and lays a foundation for creating excellent germplasm resources.

Claims

1. Application of the SlBIW gene in regulating the growth of tomato lateral branches, characterized in that, The CDS sequence of the SlBIW gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, wherein The application method is as follows: (1) By overexpressing the SlBIW gene, the growth of tomato lateral branches is inhibited; (2) By knocking out the SlBIW gene, the growth of tomato lateral branches is promoted.

3. The application according to claim 2, characterized in that, The method for overexpressing the SlBIW gene is as follows: (1) Design an overexpression primer sequence using wild-type tomato cDNA as a template, and construct an overexpression vector of the SlBIW gene; (2) Transfer the vector into Agrobacterium competent cells to obtain Agrobacterium overexpressing the SlBIW gene; (3) Use Agrobacterium to infect the cotyledons of ordinary wild-type tomatoes, and regenerate seedlings through tissue culture, and screen for overexpression plants of the SlBIW gene.

4. The application according to claim 2, characterized in that The method for knocking out the SlBIW gene is as follows: (1) According to the SlBIW genomic sequence, design the target sequence sgRNA, and construct a CRISPR / Cas9 vector for editing the tomato SlBIW gene; (2) Transfer the vector into Agrobacterium competent cells to obtain Agrobacterium containing the CRISPR / Cas9 vector for editing the SlBIW gene; (3) Use Agrobacterium to infect the cotyledons of ordinary wild-type tomatoes, and regenerate seedlings through tissue culture, and screen for SlBIW gene deletion mutants.

5. The application according to claim 4, wherein The sgRNA is shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.

7.

6. Application of SlBIW protein in regulating the growth of tomato lateral branches, characterized in that, The amino acid sequence of the SlBIW protein is shown in SEQ ID NO.

2.

7. Use of a recombinant vector in regulating the growth of tomato lateral branches, characterized in that, The recombinant vector contains the SlBIW gene, and the CDS sequence of the SlBIW gene is shown in SEQ ID NO.

1.

8. Use of a genetically engineered bacterium in regulating the growth of tomato lateral branches, characterized in that, The genetically engineered bacterium contains the SlBIW gene, and the CDS sequence of the SlBIW gene is shown in SEQ ID NO.

1.

9. A method for inhibiting the growth of tomato lateral branches, characterized in that, Including: Using genetic engineering means to overexpress the SlBIW gene in tomatoes; The CDS sequence of the SlBIW gene is shown in SEQ ID NO.1.