Isothermal miRNA detection system based on CRISPR-Cas system and application thereof
By combining isothermal amplification technology and the CRISPR-Cas13a system, specific template strands and RNA reporter probes are designed, and the sequence-specific cleavage activity of LwaCas13a is used to achieve efficient, specific and sensitivity detection of miRNAs, solving the problem of insufficient complexity and sensitivity of miRNA detection in the prior art, and achieving efficient and flexible miRNA detection.
Patent Information
- Application Number
- CN202510269003.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-07
- Publication Date
- 2025-07-04
AI Technical Summary
The existing miRNA detection methods have problems such as complex operation, low sensitivity, low throughput, expensive equipment, easy contamination and the need for specific nucleic acid probes, making it difficult to achieve efficient, specific and sensitive miRNA detection.
Combining isothermal amplification technology and the CRISPR-Cas13a system, specific template strands, RNA reporter probes and crRNA are designed, and the sequence-specific cleavage activity of LwaCas13a is used, and fluorescent labeling technology is combined to achieve efficient, specific and sensitive detection of miRNAs, and the thermal cycle process in the traditional PCR amplification step is omitted.
Accurate detection of extremely low concentration miRNAs is achieved, experimental steps are simplified, detection efficiency and flexibility are improved, detection limit reaches 1aM, exceeding the performance of existing products, and it can detect multiple miRNAs simultaneously in a single reaction system.
Smart Images

Figure CN120249485A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of nucleic acid detection, and particularly relates to an isothermal miRNA detection system based on the CRISPR-Cas system and its application. Background Art
[0002] MicroRNA (miRNA) is a class of small molecule single-stranded non-coding RNAs, 18-22 nucleotides in length, and is widely present in animals, plants and some viruses. miRNA does not encode proteins and regulates gene expression by binding to the 3'-untranslated region (UTR) of the target mRNA to inhibit protein translation. A large number of studies have shown that miRNA is closely related to the occurrence and development of various diseases, such as cancer, cardiovascular diseases, etc. For example, during the occurrence of diseases, the expression of miR-21 is abnormally increased in cancers such as breast cancer and lung cancer. By inhibiting the expression of tumor suppressor genes such as PTEN and PDCD4, it promotes the proliferation, migration and invasion of tumor cells. The up-regulation of miR-21 expression in cardiomyocytes promotes the proliferation of fibrotic cells, thus exacerbating cardiac pathological fibrosis and hypertrophy. miR-143 / 145 can target multiple mRNAs involved in the proliferation and differentiation of vascular smooth muscle cells. The down-regulation of the expression of this cluster of miRNAs will cause cardiovascular diseases such as hypertension and heart failure. In B-cell leukemia, the expressions of miR-15a and miR-16-1 are down-regulated, thus affecting the expressions of anti-apoptotic proteins BCL2 and MCL1, resulting in increased cell survival and drug resistance to chemotherapy drugs. miR-7a2 targets genes related to insulin secretion and release, affects the fusion of insulin granules with the plasma membrane and the activity of the SNARE complex. In obese / diabetic mouse models and human islets, a decrease in the level of miR-7a has been observed. miR-155 can regulate the differentiation, activation of B cells and T cells, as well as the intensity of immune responses. Its high expression is related to the malignancy of tumors and poor prognosis. miR-34a can target and regulate multiple genes related to the cell cycle, apoptosis and DNA repair, such as CDK6, Bcl-2, etc., thereby inhibiting the proliferation of tumor cells and promoting the apoptosis of tumor cells. Therefore, the detection of miRNA is crucial for its application in disease diagnosis and prognosis.
[0003] However, the methods commonly used to detect miRNA currently include Northern blotting, fluorescence quantitative PCR, and microarray technology. The biggest advantage of the Northern blotting technique is that it does not require specialized equipment, but it has disadvantages such as a complex operation process, low sensitivity, and low throughput. The open operation process causes the samples to be easily degraded or contaminated. Therefore, its usage scenario is very limited. Compared with the Northern blotting technique, fluorescence quantitative PCR simplifies the operation process to a certain extent, and both the sensitivity and specificity are greatly improved. However, due to the short sequence of miRNA, generally only about 20 nt, random primers or oligo(T) primers cannot be used for amplification. Therefore, before performing the fluorescence quantitative PCR procedure, not only transcription but also tailing at the 3' end by Poly(A) DNA polymerase is required. Since the transcription product cDNA needs to be transferred with the lid open, there is still a certain risk of contamination. Moreover, fluorescence quantitative PCR requires specialized nucleic acid transcription equipment and amplification equipment, and the transcription and amplification processes take 1 - 2 hours. Microarray technology is at the forefront of the development of nucleic acid detection technology in the past ten years. The most significant feature of this technology is high throughput and high sensitivity. Combined with computer technology, it can quickly analyze a large amount of data. However, expensive equipment is not suitable for point-of-care testing in multiple scenarios.
[0004] To address these technical issues, in recent years, isothermal amplification techniques and the CRISPR-Cas system have been introduced into the field of miRNA detection. Isothermal amplification techniques such as rolling circle amplification, loop-mediated isothermal amplification, recombinase polymerase isothermal amplification, etc., are novel methods for miRNA detection currently. SYBR Green is often used as a DNA fluorescent intercalating dye for real-time fluorescence detection. However, this dye has low specificity. To achieve specific detection of amplification products, specific nucleic acid probes are usually designed to detect the amplification products to prevent the generation of false positive products. Therefore, although isothermal amplification techniques have the advantages of simple operation, rapidity, and sensitivity, specific nucleic acid probes still need to be designed to achieve specific detection of amplification products. The CRISPR-Cas (clustered regularly interspaced short palindromic repeats associated proteins system) system is a currently known gene editing tool, and the research on the CRISPR-Cas9 system for targeted DNA genome editing is relatively mature. Compared with the CRISPR-Cas9 system for targeted DNA genome editing, in recent years, the research on the type VI-CRISPR family CRISPR-C2c2 / Cas13a system for targeted RNA has been increasing. The Cas13a system is relatively simple and only requires a Cas13a protein, a crRNA molecule, and a target sequence to produce an effect. Cas13a proteins all have two different ribonuclease activities: one is the ribonuclease activity responsible for processing precursor crRNA, which assists in the assembly of crRNA and the Cas13a protein into a mature interference complex; the other is the ribonuclease activity provided by the higher eukaryotes and prokaryotes nucleotide-binding domain (HEPN). Cas13a contains two HEPNs, which are essential for Cas13a to exert its function of cleaving RNA sequences. When Cas13a does not bind to the targeted single-stranded RNA, there is no activity of cleaving RNA sequences; but when the complex of Cas13a and crRNA binds to the targeted single-stranded RNA, the spacer sequence of crRNA is complementary to the targeted RNA, triggering a conformational change in the ribonucleoprotein (RNP) complex, and the two HEPN domains approach each other, thus forming a catalytic site. Since this site is at a certain distance from the RNA duplex targeted by crRNA, it will cause conformational changes in crRNA and the Cas13a protein, activating the activity of Cas13a to cleave the target RNA, making it cleave not only the target RNA but also any other single-stranded RNA.The CRISPR-Cas13a system has extremely high specificity, with a sensitivity reaching the aM level, and can be used for the precise detection of pathogens, early diagnosis of cancer, and treatment of genetic diseases, etc. It can be seen that the CRISPR-Cas system, especially the RNA-targeting CRISPR-C2c2 / Cas13a system, has extremely high specificity and sensitivity, and can be used for the precise detection of pathogens, early diagnosis of cancer, etc.
[0005] On this basis, by combining the advantages of isothermal amplification technology and the CRISPR-Cas13a system, an innovative miRNA detection method is developed to achieve efficient, highly specific, and highly sensitive detection of miRNA, thus providing strong support for the early screening and precise diagnosis of cancer patients, which is of great significance. Summary of the Invention
[0006] Aiming at the deficiencies of the prior art, the present invention aims to provide an isothermal miRNA detection system based on the CRISPR-Cas system and its application. By combining isothermal amplification technology and the CRISPR-Cas13a system, it can achieve accurate detection of extremely low-concentration miRNA. In addition, by combining isothermal amplification technology and the CRISPR-Cas13a system, the thermal cycling process in the traditional PCR amplification step can be omitted. At the same time, the cleavage reaction and fluorescence signal detection of the CRISPR-Cas13a system can be carried out in the same tube, realizing the simplification of experimental steps and the shortening of detection time.
[0007] To achieve the above object, the present invention adopts the following technical solutions: The first object of the present invention is to provide an isothermal miRNA detection system based on the CRISPR-Cas system, including: reaction mixture I, DNA polymerase, thermostable flap endonuclease-1, auxiliary DNA strand, RNA polymerase, reaction mixture II, and LwaCas13a; The preparation method of the reaction mixture I includes incubating and hybridizing the template strand and the substrate strand with equal concentrations at 35-40°C for 12-24 h to prepare the reaction mixture I; The preparation method of the reaction mixture II includes incubating and hybridizing the RNA reporter probe and crRNA with equal concentrations at 35-40°C for 12-24 h to prepare the reaction mixture II.
[0008] Preferably, the sequence information of the template strand includes nucleic acid sequences as shown in SEQ ID NO.1 to SEQ ID NO.3; the sequence information of the substrate strand includes nucleic acid sequences as shown in SEQ ID NO.4 to SEQ ID NO.6; the sequence information of the RNA reporter probe includes nucleic acid sequences as shown in SEQ ID NO.7 to SEQ ID NO.9; the sequence information of the crRNA sequence includes nucleic acid sequences as shown in SEQ ID NO.10 to SEQ ID NO.12; the sequence information of the auxiliary DNA strand includes nucleic acid sequences as shown in SEQ ID NO.13 to SEQ ID NO.15.
[0009] The sequence information of the template strand: 5’-TTTTTTTTCACTCGATTGCTACTCTACAACCCCTATCTATCTCAACATCAGTCTGATAAGCTA-3’ (SEQ ID NO.1); 5’-TTTTTTTTCACTCGATTGCTACTCTACAACCCCTATCTATCTTTTTTTTCACTCGATTGCTACTCTACAACCCCTATCTATCTCAACATCAGTCTGATAAGCTA-3’ (SEQ ID NO.2); 5’-TTTTTTTTCACTCGATTGCTACTCTACAACCCCTATCTATCTTTTTTTTCACTCGATTGCTACTCTACAACCCCTATCTATCTTTTTTTTCACTCGATTGCTACTCTACAACCCCTATCTATCTCAACATCAGTCTGATAAGCTA-3’ (SEQ ID NO.3).
[0010] The sequence information of the substrate strand: 5’-GCAGTGCAGATCGATGATTGGTAGAGTAGCAATCGAGTG-3’ (SEQ ID NO.4); 5’-GTACTACACATCGATGATTGGTAGAGTAGCAATCGAGTG-3’ (SEQ ID NO.5); 5’-GTGACTGTGATCTACGAGTGGTAGAGTAGCAATCGAGTG-3’ (SEQ ID NO.6).
[0011] The sequence information of the RNA reporter probe: 5’-FAM-UAGCAGGUCGUC-BHQ1-3’ (SEQ ID NO.7); 5’-FAM-GCAGGUCGUC-BHQ1-3’ (SEQ ID NO.8); 5’-FAM-GCAGGUCG-BHQ1-3’ (SEQ ID NO.9).
[0012] The sequence information of the crRNA: 5’-GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGUUCUACUGACGACCUGCUA-3’ (SEQ ID NO.10); 5’-GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACACGUUCUACUGACGACCUGC-3’ (SEQ ID NO.11); 5’-GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUCACGUUCUACUCGACCUGC-3’ (SEQ ID NO.12).
[0013] The sequence information of the auxiliary DNA strand: 5’-TGTACGTGATCACGTTCTACTAGAGGGATATCACTCAGCATAATCCAATCATCGATCTGCACTGC-3’ (SEQ ID NO.13); 5’-TGTACGTGATCACGTTCTACTAGAGGGATATCACTCAGCATAATCCAATCATCGATGTGTAGTAC-3’ (SEQ ID NO.14); 5’-TGTACGTGATCACGTTCTACTAGAGGGATATCACTCAGCATAATCCACTCGTAGATCACAGTCAC-3’ (SEQ ID NO.15).
[0014] Preferably, the RNA polymerase is selected from one of T7 RNA polymerase, T3 RNA polymerase or SP6 RNA polymerase; the DNA polymerase is selected from one of phi29 DNA polymerase, Bst 2.0 WarmStart DNA polymerase or large fragment of DNA polymerase I.
[0015] Preferably, the isothermal miRNA detection system based on the CRISPR-Cas system further comprises dNTP and NTP.
[0016] The second object of the present invention is to provide a miRNA detection kit, comprising the above-mentioned isothermal miRNA detection system based on the CRISPR-Cas system.
[0017] Another object of the present invention is to provide an application of the above-mentioned isothermal miRNA detection system based on the CRISPR-Cas system in multiplex miRNA detection.
[0018] Another object of the present invention is to provide a method for multiplex miRNA detection based on the above-mentioned system for non-diagnostic purposes, which is characterized by comprising the following steps: S1. Sample preparation: Extract the target miRNA from the sample to be detected. S2. Prepare reaction mixture I: Hybridize the template strand and the substrate strand with equal concentration at 35-40 °C for 12-24 h to prepare reaction mixture I. S3. Prepare reaction mixture II: Hybridize the RNA reporter probe and crRNA with equal concentration at 35-40 °C for 12-24 h to prepare reaction mixture II. S4. Prepare reaction mixture III: Mix 1-5 μl of reaction mixture I prepared in step S2, 1-4 μl of DNA polymerase, 0.5-2.5 μl of thermostable flap endonuclease-1, 1-5 μl of auxiliary DNA strand, 0.5-3 μl of RNA polymerase, 1-5 μl of reaction mixture II prepared in step S3, 0.5-3 μl of LwaCas13a, 1-5 μl of reaction buffer, 1-5 μl of dNTP, 1-5 μl of NTP and the balance of ddH2O, and mix evenly to prepare a reaction mixture III with a volume of 25-30 μl. S5. Fluorescence detection: Take 2-8 μl of the target miRNA extracted in step S1 and 20-30 μl of the reaction mixture III prepared in step S4, mix evenly, and use a fluorescence detection device to record the change in fluorescence intensity within 30-60 min.
[0019] Preferably, the product formed by the preparation of reaction mixture I in step S2 is diluted with 1×TE solution, and its working concentration is 10-500 nM. The product formed by the preparation of reaction mixture II in step S3 is diluted with DEPC water, and its working concentration is 10-500 nM. In step S4, the dosages of the DNA polymerase, thermostable flap endonuclease-1, and RNA polymerase are 10-50 U / 30 μL; the concentration of the auxiliary DNA strand is 25-1000 nM; the working concentration of LwaCas13a is 50-150 nM; and the working concentrations of dNTP and NTP are 0.5-5 mM.
[0020] Preferably, the reaction buffer described in step S4 comprises components with the following concentrations: 200-700 mM Tris-HCl, 100-1000 mM NaCl, 10-100 mM MgCl2, 50-500 mM NH4Cl, 10-100 mM spermidine, 0.5-5% Triton X-100, and 10-100 mM DTT.
[0021] Principle and concept of the present invention: The present invention efficiently recognizes the target miRNA through the base complementary pairing rule, and at the same time uses the sequence-specific cleavage activity of the LwaCas13a system to accurately recognize and cleave the transcribed auxiliary RNA strand. At the same time, combined with the fluorescence labeling technology, the cleavage event is converted into an observable fluorescence signal to realize the visualization imaging detection of the miRNA expression level. Specifically: Traditional isothermal amplification techniques used to detect microRNA (miRNA), such as rolling circle amplification (RCA), loop-mediated isothermal amplification (LAMP), recombinase polymerase isothermal amplification (RPA), etc., usually rely on specific nucleic acid probes to detect the amplification products, so as to reduce the generation of false positive products and improve the accuracy of detection. Thermostable FEN 1 is a nuclease with structural specificity. It can recognize and excise the free 5'-terminal single strand in the three-stranded nucleic acid fork structure and plays a key role in DNA replication and repair. Utilizing this property of Thermostable FEN 1, a nucleic acid probe combining Thermostable FEN 1 with isothermal amplification technology can be designed. When the probe binds to the target DNA sequence, a three-stranded nucleic acid fork structure will be formed. Thermostable FEN 1 can recognize and excise the free 5'-terminal single strand therein. The signal amplification effect generated during this process makes the detection result more sensitive and accurate.
[0022] Based on this, the present invention provides a miRNA detection system introducing isothermal amplification technology and CRISPR-Cas13a system and its application. The flow schematic diagram of the present invention for detecting miRNA samples is as Figure 1As shown, first, the present invention designs a template strand that can bind to both the target miRNA and the substrate strand simultaneously. During isothermal amplification, the target miRNA recognizes and binds to the specific template strand designed according to the sequence of the target miRNA, and serves as the first primer to initiate the polymerization reaction by DNA polymerase. When the DNA polymerase extends the target miRNA to the 5'-end of the substrate strand, a branched double-stranded structure is formed. Thermostable FEN 1 can recognize the formed branched double-stranded structure and cleave the Flap structure at the 5'-end of the substrate strand, releasing a short strand. This short strand then recognizes and binds to the 3'-end of the auxiliary DNA strand, and serves as the second primer to synthesize the complementary strand of the auxiliary DNA strand. Subsequently, RNA polymerase recognizes the promoter sequence in the double-stranded product and initiates the transcription process to generate an auxiliary RNA strand. The sequence of this auxiliary RNA strand can recognize and bind to the 5'-end of the crRNA spacer, and then bind to the F-Q probe (RNA reporter probe), jointly activating the cis-cleavage activity of LwaCas13a. This cleavage causes the F-Q probe to break, separating the FAM fluorophore from the BHQ1 quencher group, thereby generating a fluorescence signal. This fluorescence signal can be detected and recorded by a fluorescence quantitative PCR instrument for subsequent quantitative analysis.
[0023] Thus, by adding the target miRNA, auxiliary DNA strand, crRNA, and RNA reporter probe designed for specific miRNA to the detection system, and combining with an appropriate signal amplification strategy (the subsequent signal amplification process triggered by the cleavage of the Flap structure by Thermostable FEN 1 in the present invention), the present invention can achieve accurate detection of extremely low concentrations of miRNA. In addition, by combining the isothermal amplification technology and the CRISPR-Cas13a system, the present invention can omit the thermal cycling process in the traditional PCR amplification step, which can not only significantly improve the detection efficiency, but also greatly enhance the flexibility and accuracy of the detection.
[0024] Therefore, the present invention efficiently amplifies the target miRNA through isothermal amplification technology, simultaneously uses the sequence-specific cleavage activity of the LwaCas13a system to accurately recognize and cleave the amplified RNA, and combines with the fluorescence labeling technology to convert the cleavage event into an observable fluorescence signal, realizing the visualization imaging detection of the miRNA expression level. Thus, it can be seen that the present invention integrates the high efficiency of isothermal amplification, the accurate recognition ability of LwaCas13a, and the intuitiveness of fluorescence labeling, and can achieve accurate detection of extremely low concentrations of miRNA.
[0025] Compared with the prior art, the present invention has the following beneficial effects: The isothermal nucleic acid detection system based on the CRISPR-Cas system provided by the present invention, its method and application have significant advantages in detecting miRNA. The detection process is simple, and the entire reaction system is in a closed environment, without the problem of secondary pollution. Secondly, compared with the existing detection kits on the market, the detection limit of the present invention reaches 1 aM, exceeding the performance of most existing products. In addition, the present invention can detect multiple miRNAs simultaneously in a single reaction system, which greatly improves the detection efficiency and flexibility, providing a more convenient and efficient detection means for scientific research and clinical applications. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 It is a schematic flow chart of the present invention for detecting miRNA samples; Figure 2 It is a test result graph for establishing the miRNA detection system; Figure 3 It is a test result graph for optimizing the adaptation buffer of the detection system; Figure 4 It is a test result graph for screening the optimal sequence combination of the detection system; Figure 5 It is a test result graph for determining the detection limit of the detection system; Figure 6 It is a test result graph for re-determining the detection limit of the detection system; Figure 7 It is a test result graph for comparison with the commercially available detection kit. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0027] In the following embodiments of the present invention, the experimental methods without specific conditions indicated are usually carried out according to conventional conditions or according to the conditions recommended by the manufacturer. All kinds of common chemical reagents used in the embodiments are commercially available products.
[0028] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the technical field to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.
[0029] To make the purpose, technical solutions and advantages of the present invention clearer, the present invention will be further described in detail below in conjunction with specific embodiments. It should be understood that these descriptions are exemplary and not intended to limit the scope of the present invention. In addition, in the following description, the descriptions of well-known structures and technologies are omitted to avoid unnecessarily confusing the concepts of the present invention.
[0030] The following embodiments further describe the present invention, but the embodiments are not intended to limit the protection scope of the present invention.
[0031] 1. Raw materials and reagents The NaCl was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd., No. C111549; The NH4Cl was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd., No. A116369; The spermidine was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd., No. S107071; The DTT was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd., No. D104860; The Tris-HCl was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd., No. T301510; The MgCl2 was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd., No. M743053; The LawCas13a was purchased from Shanghai Beyotime Biotechnology Co., Ltd., NO. D0517M; The T7 RNA polymerase was purchased from Shanghai Beyotime Biotechnology Co., Ltd., D7069; The Thermostable FEN 1 was purchased from New England Biolabs, M0645S; The Phi 29 DNA polymerase was purchased from New England Biolabs, M0269S; The dNTP was purchased from New England Biolabs, N0447V.
[0032] 2. Equipment and instruments The fluorescence quantitative PCR instrument was the SLAN series full-automatic medical PCR analysis system, model 96S / 96P, purchased from Shanghai Hongshi Medical Technology Co., Ltd.
[0033] 3. Preparation of experimental materials (1) Preparation of stock solutions: Prepare stock solutions of NaCl, NH4Cl, spermidine (spermine), and DTT (dithiothreitol) with a concentration of 1 M using purified water, and store them at 4°C for later use.
[0034] (2) Preparation of reaction buffers: Prepare 10×reaction buffer1, 10×reactionbuffer2, and 10×reaction buffer3 using purified water. The specific components and concentrations are as follows: 10×reaction buffer1: 300 mM Tris-HCl, 250 mM Nacl, 30 mM MgCl2, 65 mM NH4Cl, 30 mM spermidine, 0.7% Triton X-100, 30 mM DTT, pH 7.5 (37 °C).
[0035] 10×reaction buffer2: 450 mM Tris-HCl, 500 mM Nacl, 50 mM MgCl2, 150 mM NH4Cl, 50 mM spermidine, 1.5% Triton X-100, 50 mM DTT, pH 7.5 (37 °C).
[0036] 10×reaction buffer3: 650 mM Tris-HCl, 800 mM Nacl, 80 mM MgCl2, 350 mM NH4Cl, 80 mM spermidine, 3% Triton X-100, 80 mM DTT, pH 7.5 (37 °C).
[0037] After preparation, store these buffers in a 4 °C refrigerator for later use.
[0038] (3)Preparation of enzymes and reagents: Dilute the LawCas13a protein purchased from Shanghai Beyotime Biotechnology Co., Ltd., NO.D0517M, from the original concentration of 35 µM to 1 µM using the buffer provided with it, and store it at -20 °C for later use. Its working concentration is 50 - 150 nM.
[0039] Meanwhile, prepare T7 RNA polymerase (purchased from Shanghai Beyotime Biotechnology Co., Ltd., D7069), with a working concentration of 10 - 50 U / 30 µl; Thermostable FEN 1 (purchased from New England Biolabs, M0645S), with a working concentration of 10 - 50 U / 30 µl; Phi 29 DNA polymerase (purchased from New England Biolabs), with a working concentration of 10 - 50 U / 30 µl.
[0040] (4)Synthesis and processing of sequences The sequences involved in the present invention are as follows: The sequence information of the template strand: 5’-TTTTTTTT CACTCGATTGCTACTCTAC AACCCCTATCTATCTCAACATCAGTCTGATAAGCTA-3’ (SEQ ID NO.1); 5’-TTTTTTTTCACTCGATTGCTACTCTAC AACCCCTATCTATCTTTTTTTT CACTCGATTGCTACTC TAC AACCCCTATCTATCTCAACATCAGTCTGATAAGCTA-3’ (SEQ ID NO.2); 5’-TTTTTTTT CACTCGATTGCTACTCTAC AACCCCTATCTATCTTTTTTTT CACTCGATTGCTACTC TAC AACCCCTATCTATCTTTTTTTT CACTCGATTGCTACTCTAC AACCCCTATCTATCTCAACATCAGTCTGATAAGCTA-3’ (SEQ ID NO.3).
[0041] The sequence information of the substrate strand: 5’- GCAGTGCAGATCGATGATTG GTAGAGTAGCAATCGAGTG -3’ (SEQ ID NO.4); 5’- GTACTACACATCGATGATTG GTAGAGTAGCAATCGAGTG -3’ (SEQ ID NO.5); 5’- GTGACTGTGATCTACGAGTG GTAGAGTAGCAATCGAGTG -3’ (SEQ ID NO.6).
[0042] The sequence information of the RNA reporter probe: 5’-FAM- UAGCAGGUCGUC -BHQ1-3’ (SEQ ID NO.7); 5’-FAM- GCAGGUCGUC -BHQ1-3’ (SEQ ID NO.8); 5’-FAM- GCAGGUCG -BHQ1-3’ (SEQ ID NO.9).
[0043] The sequence information of the crRNA: 5’- GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGUUCUACUGACGACCUGCUA -3’ (SEQ IDNO.10); 5’- GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACACGUUCUACUGACGACCUGC -3’ (SEQ IDNO.11); 5’- GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUCACGUUCUACUCGACCUGC -3’ (SEQ IDNO.12).
[0044] The sequence information of the auxiliary DNA strand: 5’-TGTACGTGATCACGTTCTGUUCUACU CTATAGTGAGTCGTATTA CCAATCATCGATCTGCACTGC-3' (SEQ ID NO.13); 5'-TGTACGTGATCACGTTACGUUCUACU CTATAGTGAGTCGTATTA CCAATCATCGATGTGTAGTAC -3' (SEQ ID NO.14); 5'-TGTACGTGATCACGUCACGUUCUACU CTATAGTGAGTCGTATTA CCACTCGTAGATCACAGTCAC -3' (SEQ ID NO.15).
[0045] The above sequences: The bold part at the 3' end of the template strand is the miRNA complementary region, which can specifically recognize and bind to the target miRNA; the underlined part at the 5' end is the substrate strand complementary region, which can be complementary paired with the underlined part at the 3' end of the substrate strand.
[0046] The underlined part at the 3' end of the substrate strand is complementary paired with the 5' end of the template strand; the slanted part at the 5' end is the flap region, which is complementary to the 3' end of the auxiliary DNA strand; when DNA polymerase extends the target miRNA to the 5' end of the substrate strand, FEN1 can recognize and cleave the 5' end flap region of the substrate strand, and the generated fragment can recognize and bind to the 3' end of the auxiliary DNA strand, serving as a primer to initiate DNA amplification.
[0047] The slanted part at the 3' end of the auxiliary DNA strand is the region complementary paired with the 5' end flap region of the substrate strand; the double-underlined part is the RNA polymerase promoter complementary sequence; when FEN1 recognizes and cleaves the 5' end flap region of the substrate strand, the cleaved flap region specifically recognizes and binds to the 3' end of the auxiliary DNA strand, and extends under the action of DNA polymerase. There is a segment of RNA polymerase promoter sequence in the middle of the amplification product, and RNA polymerase can recognize the promoter sequence and transcribe to obtain the auxiliary RNA strand using the 5' end sequence of the DNA auxiliary strand as the template.
[0048] The RNA reporter probe recognizes and pairs with the 3' end of the crRNA. The 3' end is modified with BHQ1 and the 5' end is modified with FAM; when Cas13a is activated and cleaves the crRNA-RNA reporter probe complex, the RNA reporter probe breaks, resulting in the separation of the fluorophore and the quencher group, thereby generating a fluorescence signal.
[0049] The wavy-underlined part at the 3' end of the crRNA is the RNA reporter probe recognition region, which can recognize and bind to the RNA reporter probe; the dotted-underlined part in the middle is the transcription product RNA recognition and binding region, which recognizes and binds to the 5' end of the auxiliary RNA strand; the double-wavy-underlined part at the 5' end is the Handle region.
[0050] All the sequences required for this invention were entrusted to Beijing Tsingke Biotechnology Co., Ltd. for sequence synthesis and purification. Among them, the sequence information of the template strand is shown in SEQ ID NO.1 to SEQ ID NO.3; the sequence information of the substrate strand is shown in SEQ ID NO.4 to SEQ ID NO.6; the sequence information of the RNA reporter probe is shown in SEQ ID NO.7 to SEQ ID NO.9; the sequence information of the crRNA is shown in SEQ ID NO.10 to SEQ ID NO.12; the sequence information of the auxiliary DNA strand is shown in SEQ ID NO.13 to SEQ ID NO.15. The purified product was dissolved in double-distilled water to dissolve the dry powder, shaken and mixed evenly to a concentration of 100 µM, then diluted to 1 µM, and stored in a 4 °C refrigerator for later use.
[0051] This invention uses the miRNA 21 reference product as the test sample for experiments. The sequence information of the test sample miRNA 21 reference product (i.e., the target miRNA) is shown in SEQ ID NO.16 below, and it was also entrusted to Beijing Tsingke Biotechnology Co., Ltd. for sequence synthesis and purification. The purified product was first dissolved in DEPC water to a concentration of 100 µM, and then sequentially diluted to 10 µM, 1 µM, 100 nM, 10 nM, 1 nM, 100 pM, 10 pM, 1 pM, 100 fM, 10 fM, 1 fM, 100 aM, 10 aM, 1 aM, 0.5 aM to establish a complete reference product system, and placed in a 4 °C refrigerator for storage for later use.
[0052] The sequence information of the target miRNA (miRNA 21): 5’-UAGCUUAUCAGACUGAUGUUGA-3’ (SEQ ID NO.16).
[0053] Example 1 Establishment of the isothermal nucleic acid detection system and method based on the CRISPR-Cas system of this invention In this example, the template strand, substrate strand, auxiliary DNA strand, RNA reporter probe and crRNA with the sequence information of the following Sequence Combination 1 were used for experiments: The sequence information of the template strand is shown in SEQ ID NO.1; the sequence information of the substrate strand is shown in SEQ ID NO.4; the sequence information of the RNA reporter probe is shown in SEQ ID NO.7; the sequence information of the crRNA is shown in SEQ ID NO.10; the sequence information of the auxiliary DNA strand is shown in SEQ ID NO.13.
[0054] The isothermal nucleic acid detection system and method based on the CRISPR-Cas system of this invention include the following steps: S1. Sample preparation: Use a 10 µM miRNA 21 reference as the test sample for the experiment; S2. Preparation of reaction mixture I: Incubate and hybridize equi - concentration template strand and substrate strand at 37 °C for 12 hours to prepare reaction mixture I. After incubation, dilute it to 1 μM with 1×TE solution and store it in a 4 °C refrigerator for later use; S3. Preparation of reaction mixture II: Incubate and hybridize equi - concentration RNA reporter probe and crRNA at 37 °C for 12 hours to prepare reaction mixture II. After incubation, dilute it to 1 μM with DEPC water and store it in a 4 °C refrigerator for later use; S4. Preparation of reaction mixture III: Mix 3 µl of reaction mixture I prepared in step S2, 2 µl of Phi29 DNA polymerase, 1.5 µl of thermostable flap endonuclease - 1, 3 µl of auxiliary DNA strand, 1.5 µl of T7 RNA polymerase, 3 µl of reaction mixture II prepared in step S3, 1.5 µl of LawCas13a, 3 µl of 10×reaction buffer1, 3 µl of dNTP, 3 µl of NTP and the remaining ddH2O evenly to prepare a 27 - µl reaction mixture III; The working concentration of the reaction mixture I is 100 nM; the working concentration of the reaction mixture II is 100 nM; the concentration of T7 RNA polymerase is 20 U / 30 µl; the concentration of thermostable flap endonuclease - 1 is 32 U / 30 µl; the concentration of Phi29 DNA polymerase is 10 U / 30 µl; the concentration of LawCas13a is 100 nM; the concentration of dNTP is 2.5 mM; the concentration of NTP is 2.5 mM.
[0055] S5. Fluorescence detection: Reaction system I (Reaction system I) setup: Take 27 µl of reaction mixture III, add 3 µl of 10 µM miRNA 21 reference, mix well by oscillation, and name it reaction system I.
[0056] Reaction system II (Reaction system II) setup: Take 27 µl of reaction mixture III, add 3 µl of double - distilled water as a control, and name it reaction system II.
[0057] Fluorescence quantitative PCR detection: Immediately put reaction system I and reaction system II into a fluorescence quantitative PCR instrument and record the fluorescence changes in the reaction systems. The reaction duration is set to 30 to 60 minutes.
[0058] Result analysis: After the experiment, the fluorescence values of different reaction systems were compared. The experimental results are as Figure 2 shown. It can be seen from Figure 2 that the miRNA 21 reference product can recognize and bind to the template strand, initiate the synthesis process of Phi29 DNA polymerase as a primer. When the target strand extends to the 5'-paired end of the substrate strand, the thermostable flap endonuclease-1 can recognize the branched double-stranded structure and cleave the 5'-Flap. The short strand produced can recognize and bind to the downstream auxiliary DNA strand. Using this strand as a primer, the complementary strand of the auxiliary DNA strand is synthesized. T7 RNA polymerase can recognize the promoter sequence in the double-stranded product and initiate the transcription process. The sequence of the product assistant RNA strand can recognize and bind to the 5'-end of the crRNA spacer, and together with the FP sequence, the F-Q probe jointly activates the cis-cleavage activity of LawCas13a, causing the F-Q probe to break. Further, after FAM is separated from BHQ1, fluorescence can be generated and recorded by a fluorescence quantitative PCR instrument. When double-distilled water is added, the above process cannot be triggered, so no fluorescence can be generated.
[0059] Example 2 Optimization of the isothermal nucleic acid detection system and method based on the CRISPR-Cas system of the present invention (1) Optimization of the reaction buffer system: Evaluate the influence of the component concentrations of different reaction buffers 10×reaction buffer on the fluorescence value of the detection system according to the method described in Example 1.
[0060] Compared with Example 1, the difference is that in the process of preparing reaction mixture III in step S4, reaction buffer 10×reaction buffer 2 and 10×reaction buffer 3 are respectively used to replace 10×reaction buffer 1 for the experiment.
[0061] Among them, reaction system I (Reaction system I) uses the reaction mixture III prepared with 10×reaction buffer 1 for the experiment; reaction system II (Reaction system II) uses the reaction mixture III prepared with 10×reaction buffer 2 and adds double-distilled water as a control; reaction system III (Reaction system III) uses the reaction mixture III prepared with 10×reaction buffer 2 for the experiment; reaction system IV (Reaction system IV) uses the reaction mixture III prepared with 10×reaction buffer 3 for the experiment.
[0062] Fluorescence detection: Take 3 μl of miRNA 21 reference product with a concentration of 10 μM as the detection sample and 27 μl of reaction systems I-IV prepared in the above steps, mix them evenly, and use a fluorescence detection device to record the change in fluorescence intensity within 60 min. Use double-distilled water as a control.
[0063] The test results are as Figure 3 shown. From Figure 3 the experimental results, it can be seen that the component concentration of the reaction buffer will have a significant impact on the detection system. Among them, the fluorescence value of 10×reaction buffer2 is the highest, the fluorescence value of 10×reaction buffer1 is the second, and the fluorescence value of 10×reaction buffer 3 is the lowest.
[0064] (2) Screening of template strand, substrate strand, auxiliary DNA strand, RNA reporter probe and crRNA sequence: Select 10 μM miRNA 21 reference product as the detection sample, use 10×reaction buffer 2 as the reaction buffer, and conduct experiments using the template strand, substrate strand, auxiliary DNA strand, RNA reporter probe and crRNA sequence shown in Sequence Combination 2 and Sequence Combination 3 below. Among them: Sequence Combination 2: The sequence information of the template strand is as shown in SEQ ID NO.2; the sequence information of the substrate strand is as shown in SEQ ID NO.5; the sequence information of the RNA reporter probe is as shown in SEQ ID NO.8; the sequence information of the crRNA is as shown in SEQ ID NO.11; the sequence information of the auxiliary DNA strand is as shown in SEQ ID NO.14.
[0065] Sequence Combination 3: The sequence information of the template strand is as shown in SEQ ID NO.3; the sequence information of the substrate strand is as shown in SEQ ID NO.6; the sequence information of the RNA reporter probe is as shown in SEQ ID NO.9; the sequence information of the crRNA is as shown in SEQ ID NO.12; the sequence information of the auxiliary DNA strand is as shown in SEQ ID NO.15.
[0066] Evaluate the influence of different sequence combinations on the fluorescence value of the detection system according to the method described in Example 1. Compared with Example 1, the difference is that experiments are conducted using the products obtained with optimized Sequence Combination 2 and Sequence Combination 3.
[0067] Among them, double-distilled water was used as a control in Reaction system II; the product obtained from Sequence combination 1 was used for experiments in Reaction system III; the product obtained from Sequence combination 2 was used for experiments in Reaction system V; the product obtained from Sequence combination 3 was used for experiments in Reaction system VI.
[0068] Fluorescence detection: 3 μl of miRNA 21 reference product with a concentration of 10 μM was taken as the detection sample, double-distilled water was used as a control, and the experiment was carried out according to the method described in Example 1. A fluorescence detection device was used to record the change in fluorescence intensity within 60 min.
[0069] The test results are as Figure 4 shown. Different fluorescences appeared when detecting the reference product with a concentration of 10 μM using three different sequence combinations. Among them, the fluorescence value of Sequence combination 2 was the best; the fluorescence values of Sequence combination 1 and Sequence combination 3 were the second best.
[0070] Thus, it can be seen that the three different sequence combinations provided (Sequence combination 1, Sequence combination 2, and Sequence combination 3) can all effectively detect the reference product with a concentration of 10 nM; when selecting the template strand, substrate strand, RNA reporter probe, crRNA, and auxiliary DNA strand of Sequence combination 2, the detection result is the best.
[0071] Example 3 Detection limit test of the isothermal nucleic acid detection system and method based on the CRISPR-Cas system of the present invention miRNA 21 reference products with concentrations of 1 nM, 10 pM, 100 fM, 1 fM, 100 aM, 10 aM, 1 aM, and 0.5 aM were respectively used as detection samples, 10×reaction buffer 2 was used as the reaction buffer, and the template strand, substrate strand, RNA reporter probe, crRNA, and auxiliary DNA strand of Sequence combination 2 were used to carry out the experiment according to the method described in Example 1 to evaluate the detection limit of the isothermal nucleic acid detection system and method based on the CRISPR-Cas system of the present invention.
[0072] Among them, double-distilled water was used as a control in Reaction system II; Reaction system VII used the miRNA 21 reference product with a concentration of 1 nM as the detection sample for the experiment; Reaction system VIII used the miRNA 21 reference product with a concentration of 10 pM as the detection sample for the experiment; The Reaction system Ⅸ uses the miRNA 21 reference product with a concentration of 100 fM as the test sample for the experiment; The Reaction system Ⅹ uses the miRNA 21 reference product with a concentration of 1 fM as the test sample for the experiment; The Reaction system Ⅺ uses the miRNA 21 reference product with a concentration of 100 aM as the test sample for the experiment; The Reaction system Ⅻ uses the miRNA 21 reference product with a concentration of 10 aM as the test sample for the experiment; The Reaction system ⅩⅢ uses the miRNA 21 reference product with a concentration of 1 aM as the test sample for the experiment; The Reaction system Ⅳ uses the miRNA 21 reference product with a concentration of 0.5 aM as the test sample for the experiment.
[0073] The test results are as Figure 5 and Figure 6 shown. The detection limit that the detection method disclosed in the present invention can reach is 1 aM. At the standard product concentration of 1 aM, the method disclosed in the present invention can produce a weak fluorescence value. At the standard product concentration of 0.5 aM, the method disclosed in the present invention cannot produce fluorescence.
[0074] Comparative Example 1 Detection limit test for measuring miRNA21 with a commercially available one-step miRNA reverse transcription kit 1. Experimental materials: The one-step miRNA reverse transcription kit is purchased from Xinhai Gene Detection Co., Ltd., model D1801, and its components include: 4× one-step miRNA reverse transcription solution, 10× miRNA reverse transcription primer, and RNase-free H2O system.
[0075] The sequence information of the 10× miRNA reverse transcription primer: 3’-NVTTTTTTTTTTTTTTTGACCTGGAC-5’ (SEQ ID NO.17).
[0076] The HG TaqMan miRNA fluorescence quantitative PCR kit is purchased from Xinhai Gene Detection Co., Ltd., model TAP01108, and its components include 5× Golden HS TaqMan qPCR mixture and 20× miRNA TaqMan detection reagent.
[0077] 2. Detection principle: Since miRNAs have relatively short molecular sequences, only about 20 nt, and do not have the Poly(A) tail structure unique to eukaryotes, it is difficult to obtain reverse transcription products from miRNA to cDNA using traditional Oligo dT primers and random primers. The one-step miRNA reverse transcription kit (D1801) uses the poly(A) tailing method RT-PCR. First, a poly(U) tail is added to the 3' end of the target miRNA using poly(U) polymerase. Then, the tailed RNA is reverse transcribed into cDNA using oligo(A) with an anchored primer as the primer. Finally, specific primers and universal primers are used for real-time quantitative PCR to detect miRNAs.
[0078] 3. The experimental steps are as follows (1)Prepare samples and reverse transcription reagents: Select miRNA21 samples with concentrations of 1 fM, 100 aM, 10 aM, and 1 aM, and prepare 3 µl for each concentration.
[0079] Prepare 4×One step miRNA RT solution, 10×miRNA RT Primer, and RNase Free H2O.
[0080] (2)Prepare the reverse transcription reaction solution: For each concentration of miRNA 21 sample, prepare the reverse transcription reaction solution separately. The specific formula is: 3 µl miRNA21 sample, 5 µl 4× one-step miRNA reverse transcription solution, 2 µl 10×miRNA reverse transcription primer, and then supplement with RNase-free H2O to a total volume of 20 µl.
[0081] In this way, four reverse transcription reaction solutions will be obtained, labeled as I, II, III, and IV, corresponding to different concentrations of miRNA21 samples.
[0082] (3)Perform the reverse transcription reaction: Place the prepared reverse transcription reaction solutions I, II, III, and IV in a fluorescence quantitative PCR instrument for reaction. The reaction program is designed as: step 1: 37°C (60 min); step 2: 95°C (5 min).
[0083] After the reaction, four cDNA solutions will be obtained, labeled as I’, II’, III’, and IV’.
[0084] (4)Prepare the real-time fluorescence quantitative PCR reaction solution: For each cDNA solution, prepare the real-time fluorescence quantitative PCR reaction solution separately. The specific formula is as follows: 2 μl of cDNA solution, 4 μl of 5×Golden HS TaqMan qPCR mixture, 1 μl of 20×miRNA TaqMan detection reagent, and then supplement with ddH2O to a total volume of 20 μl.
[0085] In this way, four real-time fluorescence quantitative PCR reaction solutions will be obtained, labeled as I'', II'', III'', and IV'' respectively, and perform real-time fluorescence quantitative PCR reactions: Place the prepared real-time fluorescence quantitative PCR reaction solutions I'', II'', III'', and IV'' in a fluorescence quantitative PCR instrument for reaction. The reaction program is designed as follows: step 1: 95°C (15 min); step 2: 95°C (10 s), 60°C (30 s), 40 cycles.
[0086] Result analysis: After the reaction, use the software of the fluorescence quantitative PCR instrument to confirm the amplification curve of the cDNA sample of Real-Time PCR. Analyze the PCR amplification effect of miRNA21 samples at different concentrations according to the amplification curve.
[0087] The test results are as Figure 7 shown. The detection limit that the one-step miRNA reverse transcription kit (D1801) of Comparative Example 1 can reach is 10 aM. When the concentration is 1 aM, no fluorescence is generated.
[0088] Compared with Example 3 of the present invention, the miRNA detection method disclosed in the present invention has a detection limit of 1 aM. When the miRNA21 reference product has a concentration of 0.5 aM, no fluorescence is generated; while the detection limit that Comparative Example 1 can reach is 10 aM. When the standard product has a concentration of 1 aM, no fluorescence is generated. Therefore, the detection limit of the detection method disclosed in the present invention is better than the detection limit of the existing method for detecting miRNA21 using a one-step miRNA reverse transcription kit, and its effect is 10 times that of the existing method. The present invention effectively improves the specificity and sensitivity of the miRNA detection system, and thus can more accurately and timely complete the pre-screening of different samples to be detected.
[0089] The above embodiments are only illustrative of the principles and effects of the present invention, and are not used to limit the present invention. Any person familiar with this technology can modify or change the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or changes completed by those with ordinary knowledge in the technical field without departing from the spirit and technical ideas disclosed by the present invention should still be covered by the claims of the present invention.
Claims
1. An isothermal miRNA detection system based on the CRISPR-Cas system, characterized in that, Comprising: Reaction mixture I, DNA polymerase, thermostable flap endonuclease-1, auxiliary DNA strand, RNA polymerase, reaction mixture II and LwaCas13a; The preparation method of the reaction mixture I includes incubating and hybridizing a template strand and a substrate strand with equal concentrations at 35-40 °C for 12-24 h to prepare the reaction mixture I; The preparation method of the reaction mixture II includes incubating and hybridizing an RNA reporter probe and crRNA with equal concentrations at 35-40 °C for 12-24 h to prepare the reaction mixture II.
2. The isothermal miRNA detection system based on the CRISPR-Cas system according to claim 1, wherein The sequence information of the template strand includes nucleic acid sequences as shown in SEQ ID NO.1 to SEQ ID NO.3; the sequence information of the substrate strand includes nucleic acid sequences as shown in SEQ ID NO.4 to SEQ ID NO.6; the sequence information of the RNA reporter probe includes nucleic acid sequences as shown in SEQ ID NO.7 to SEQ ID NO.9; the sequence information of the crRNA sequence includes nucleic acid sequences as shown in SEQ ID NO.10 to SEQ ID NO.12; the sequence information of the auxiliary DNA strand includes nucleic acid sequences as shown in SEQ ID NO.13 to SEQ ID NO.
15.
3. The isothermal miRNA detection system based on the CRISPR-Cas system according to claim 1, wherein The RNA polymerase is selected from one of T7 RNA polymerase, T3 RNA polymerase or SP6 RNA polymerase; the DNA polymerase is selected from one of phi29 DNA polymerase, Bst 2.0 WarmStart DNA polymerase or large fragment of DNA polymerase I.
4. The isothermal miRNA detection system based on the CRISPR-Cas system according to claim 1, wherein The isothermal miRNA detection system based on the CRISPR-Cas system further includes dNTP and NTP.
5. A miRNA detection kit, characterized in that, Comprising the isothermal miRNA detection system based on the CRISPR-Cas system according to any one of claims 1-4.
6. Use of an isothermal miRNA detection system based on the CRISPR-Cas system according to any one of claims 1-4 in multiplex miRNA detection.
7. A method for multiplex miRNA detection based on the system according to any one of claims 1-4 for non-diagnostic purposes, characterized in that, Comprising the following steps: S1. Sample preparation: Extracting target miRNA from a sample to be detected; S2. Preparing reaction mixture I: Incubating and hybridizing a template strand and a substrate strand with equal concentrations at 35-40 °C for 12-24 h to prepare the reaction mixture I; S3. Preparing reaction mixture II: Incubating and hybridizing an RNA reporter probe and crRNA with equal concentrations at 35-40 °C for 12-24 h to prepare the reaction mixture II; S4. Preparation of reaction mixture III: Mix 1 - 5 μl of the reaction mixture I prepared in step S2, 1 - 4 μl of DNA polymerase, 0.5 - 2.5 μl of thermostable flap endonuclease-1, 1 - 5 μl of auxiliary DNA strand, 0.5 - 3 μl of RNA polymerase, 1 - 5 μl of the reaction mixture II prepared in step S3, 0.5 - 3 μl of LwaCas13a, 1 - 5 μl of reaction buffer, 1 - 5 μl of dNTP, 1 - 5 μl of NTP and the balance of ddH2O uniformly to prepare a reaction mixture III with a volume of 25 - 30 μl; S5. Fluorescence detection: Take 2 - 8 μl of the target miRNA extracted in step S1 and 20 - 30 μl of the reaction mixture III prepared in step S4, mix them uniformly, and use a fluorescence detection device to record the change in fluorescence intensity within 30 - 60 min.
8. The detection method according to claim 7, characterized in that, The product formed by the preparation of the reaction mixture I described in step S2 is diluted with 1×TE solution, and its working concentration is 10 - 500 nM; The product formed by the preparation of the reaction mixture II described in step S3 is diluted with DEPC water, and its working concentration is 10 - 500 nM; In step S4, the dosages of the DNA polymerase, thermostable flap endonuclease-1, and RNA polymerase are 10 - 50 U / 30 μL; the concentration of the auxiliary DNA strand is 25 - 1000 nM; the working concentration of LwaCas13a is 50 - 150 nM; the working concentrations of dNTP and NTP are 0.5 - 5 mM.
9. The detection method according to claim 7, wherein The reaction buffer described in step S4 includes components with the following concentrations: 200 - 700 mM Tris-HCl, 100 - 1000 mM NaCl, 10 - 100 mM MgCl2, 50 - 500 mM NH4Cl, 10 - 100 mM spermidine, 0.5 - 5% Triton X-100 and 10 - 100 mM DTT.