Rapid detection method and application of pseudomonas putida

Abstract

The invention relates to a rapid detection method of pseudomonas putida and application thereof, and the detection method comprises the following steps: (1) taking a sample to be detected, carrying out enrichment culture in an enrichment liquid, centrifugally collecting thalli subjected to enrichment culture, and carrying out DNA extraction on the thalli; (2) carrying out PCR (Polymerase Chain Reaction) amplification on the extracted DNA, and determining whether the sample to be detected contains pseudomonas putida or not according to an amplification result; a target gene subjected to PCR amplification is an rpoD gene. Specific detection is achieved through the targeted rpoD gene, and the detection period is shortened to be within 24 h in combination with optimized DNA extraction and a qPCR system. In addition, the whole-process quality control design can effectively avoid false positive / false negative results, 96 samples can be processed in a single batch, and an efficient and reliable quality control scheme is provided for the cosmetic industry.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and particularly to a rapid detection method and application of Pseudomonas putida. Background Art

[0002] In recent years, the problem of microbial contamination in cosmetics has become a core challenge for product quality and safety. Pseudomonas putida is a Gram-negative bacterium belonging to the genus Pseudomonas. It is widely distributed in environments such as soil and water, and is a common environmental microorganism that can invade the cosmetics system through raw materials, production equipment, and packaging. Although its pathogenicity to healthy people is relatively weak, in individuals with low immunity or damaged skin barriers, it may cause local infections or inflammatory reactions. In addition, Pseudomonas putida has strong metabolic activity, can degrade cosmetic ingredients and produce odors, accelerating product deterioration, seriously threatening consumer health and brand reputation.

[0003] Currently, the detection of Pseudomonas putida in cosmetics mainly uses the microbial culture method and the PCR identification method, but both of these methods have certain limitations. The microbial culture method has a long detection period, cannot detect dormant microorganisms, and is easily affected by contamination of miscellaneous bacteria and human judgment errors. In the PCR identification method, there are problems such as poor primer specificity and susceptibility to interference by impurities in the sample, often resulting in false positive / false negative results. In contrast, the Taqman real-time fluorescence quantitative PCR (qPCR) method has significant advantages, with higher sensitivity, better specificity, and better repeatability and stability.

[0004] Therefore, how to adopt a rapid, highly sensitive, and highly specific detection method for low-abundance Pseudomonas putida contamination in cosmetic samples by real-time fluorescence quantitative PCR has become an urgent problem to be solved. Summary of the Invention

[0005] To solve the above technical problems, the present invention provides a rapid detection method and application of Pseudomonas putida. The present invention uses the rpoD gene as the target gene for qPCR amplification, greatly shortening the detection time and improving the detection accuracy.

[0006] To achieve this purpose, the present invention adopts the following technical solutions:

[0007] In the first aspect, the present invention provides a rapid detection method of Pseudomonas putida, and the detection method includes:

[0008] (1) Taking a sample to be tested for enrichment culture in an enrichment broth, centrifuging to collect the enriched bacteria, and extracting DNA from the bacteria.

[0009] (2) Perform PCR amplification on the extracted DNA, and determine whether Pseudomonas putida is contained in the sample to be tested according to the amplification result;

[0010] The target gene for the PCR amplification is the rpoD gene.

[0011] In the present invention, the rpoD gene (GeneBank accession number: AB03958) is used as the target gene. After BLAST alignment, this gene has high specificity in Pseudomonas putida. By comparing with the gyrB gene (GeneBank accession number: AB039451), it is found that using the rpoD gene as the target gene has high detection accuracy and high sensitivity.

[0012] Meanwhile, in the present invention, before DNA extraction from the bacterial cells, the sample to be tested is subjected to enrichment culture in an enrichment broth, which can significantly improve the enrichment efficiency of low-concentration bacteria and reduce the detection limit.

[0013] Preferably, the mass-volume ratio of the sample to be tested to the enrichment broth in step (1) is 1:(50 - 150) g / mL. The (50 - 150) can be, for example, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140 or 150, etc.

[0014] In the present invention, controlling the mass-volume ratio of the sample to be tested to the enrichment broth at 1:(50 - 150) g / mL can significantly improve the enrichment efficiency. When it is greater than this range, interfering substances in the sample system will have an adverse effect on the enrichment process, while when it is less than this range, the enrichment efficiency will decrease, which is not conducive to subsequent detection.

[0015] Preferably, the sample to be tested includes cosmetics.

[0016] Preferably, the cosmetics include any one of toner, lotion, facial mask, cream, shampoo or body wash.

[0017] Preferably, the enrichment broth in step (1) contains 10 - 20 g / L peptone, 3 - 8 g / L soy peptone, 1 - 5 g / L sodium chloride, 1 - 5 g / L glucose, 1 - 5 g / L potassium dihydrogen phosphate, 3 - 6 g / L histidine, 1 - 2 g / L lecithin, and 5 - 10 g / L Tween. The 10 - 20 g / L can be, for example, 10 g / L, 11 g / L, 12 g / L, 13 g / L, 14 g / L, 15 g / L, 16 g / L, 17 g / L, 18 g / L, 19 g / L, or 20 g / L, etc. The 3 - 8 g / L can be, for example, 3 g / L, 4 g / L, 5 g / L, 6 g / L, 7 g / L, or 8 g / L, etc. The 1 - 5 g / L can be, for example, 1 g / L, 2 g / L, 3 g / L, 4 g / L, or 5 g / L, etc. The 3 - 6 g / L can be, for example, 3 g / L, 4 g / L, 5 g / L, or 6 g / L, etc. The 1 - 2 g / L can be, for example, 1 g / L, 1.2 g / L, 1.4 g / L, 1.6 g / L, 1.8 g / L, or 2.0 g / L, etc. The 5 - 10 g / L can be, for example, 5 g / L, 6 g / L, 7 g / L, 8 g / L, 9 g / L, or 10 g / L, etc.

[0018] In the present invention, histidine is added to the enrichment broth, which can reduce the adverse effects of interfering substances such as preservatives in the sample to be tested on the enrichment effect of Pseudomonas putida, thereby increasing the concentration of Pseudomonas putida in the enriched broth.

[0019] Preferably, the temperature of the enrichment culture in step (1) is 32 - 37 °C, the time is 18 - 22 h, and the speed is 200 - 250 rpm. The 32 - 37 °C can be, for example, 32 °C, 33 °C, 34 °C, 35 °C, 36 °C, or 37 °C, etc. The 18 - 22 h can be, for example, 18 h, 19 h, 20 h, 21 h, or 22 h, etc. The 200 - 250 rpm can be, for example, 200 rpm, 210 rpm, 220 rpm, 230 rpm, 240 rpm, or 250 rpm, etc.

[0020] Preferably, the DNA extraction in step (1) includes the following steps:

[0021] (a) Mix the bacterial cells with the lysis solution, mechanically break them, and carry out a lysis reaction;

[0022] (b) Perform magnetic bead adsorption, washing, and elution on the product of the bacterial cell lysis to obtain DNA.

[0023] Preferably, the temperature of the cracking reaction is 60-75°C and the time is 15-30 min. The 60-75°C can be, for example, 60°C, 61°C, 62°C, 63°C, 64°C or 65°C, etc. The 15-30 min can be, for example, 15 min, 16 min, 18 min, 20 min, 22 min, 24 min, 26 min, 28 min or 30 min, etc.

[0024] Preferably, the mechanical crushing includes oscillating crushing.

[0025] Preferably, the speed of the oscillating crushing is 2000-4000 rpm and the time is 10-30 min. The 2000-400 rpm can be, for example, 2000 rpm, 2500 rpm, 3000 rpm, 3500 rpm or 4000 rpm, etc. The 10-30 min can be, for example, 10 min, 15 min, 20 min, 25 min or 30 min, etc.

[0026] In the present invention, by combining the lysis solution with mechanical crushing and controlling the water bath temperature simultaneously, Pseudomonas putida can be lysed and crushed more thoroughly, and at the same time, DNA molecules with higher quality can be obtained, further improving the accuracy of detection.

[0027] Preferably, the PCR amplification in step (2) includes any one of ordinary PCR, qPCR, digital PCR or ddPCR.

[0028] Preferably, the nucleic acid sequence of the forward primer for the PCR amplification in step (2) includes the sequence shown in SEQ ID NO:1.

[0029] SEQ ID NO:1:

[0030] CACGAACACGCTCTACCAGGAC.

[0031] Preferably, the nucleic acid sequence of the reverse primer for the PCR amplification in step (2) includes the sequence shown in SEQ ID NO:2.

[0032] SEQ ID NO:2:

[0033] TGCCCACAAGGAAAGCATCGC.

[0034] Preferably, the nucleic acid sequence of the probe for the PCR amplification in step (2) includes the sequence shown in SEQ ID NO:3.

[0035] SEQ ID NO:3:

[0036] CTGCAAGCCCTCGCCGACCTGTTCATGC。

[0037] In the present invention, through multiple experimental detections, it is verified that the above primers and internal references can accurately detect Pseudomonas putida compared with other primers and have high sensitivity.

[0038] Preferably, the probe comprises a fluorescent labeling group and a fluorescent quenching group;

[0039] Preferably, the fluorescent labeling group comprises any one of FAM, Cy5 or HEX.

[0040] Preferably, the fluorescent quenching group comprises any one of BHQ1, BHQ2 or TAMRA.

[0041] Preferably, in the PCR amplification system described in step (2), the final concentrations of the forward primer, reverse primer and probe are each independently 0.1 - 0.5 μM. The 0.1 - 0.5 μM can be, for example, 0.1 μM, 0.2 μM, 0.3 μM, 0.4 μM or 0.5 μM, etc.

[0042] Preferably, the PCR amplification procedure described in step (2) comprises:

[0043] Step 1: 94 - 96 °C, 20 - 50 s; Step 2: 94 - 96 °C, 3 - 7 s; Step 3: 59 - 63 °C, 30 - 60 s; Steps 2 and 3 are repeated 35 - 45 cycles. The 94 - 96 °C can be, for example, 94 °C, 94.5 °C, 95 °C, 95.5 °C or 96 °C. The 20 - 50 s can be, for example, 20 s, 25 s, 30 s, 35 s, 40 s, 45 s or 50 s, etc. The 3 - 7 s can be, for example, 3 s, 4 s, 5 s, 6 s or 7 s, etc. The 59 - 63 °C can be, for example, 59 °C, 60 °C, 61 °C, 62 °C or 63 °C, etc. The 35 - 45 cycles can be, for example, 35 cycles, 36 cycles, 37 cycles, 38 cycles, 39 cycles, 40 cycles, 41 cycles, 42 cycles, 43 cycles, 44 cycles or 45 cycles, etc.

[0044] Preferably, the criterion for determining whether the test sample contains Pseudomonas putida in step (2) is:

[0045] The DNA purity of three repeated tests of the sample to be tested is 1.8 - 2.0, the Ct difference value ≤ 0.3 - 0.6, and the Ct value of the qPCR amplification curve ≤ the Ct threshold value, then it is judged as positive; if the Ct value of the qPCR amplification curve > the Ct threshold value, then it is judged as negative; the DNA purity is the value of A260 / A280, and the Ct threshold value is 32 - 36.

[0046] Among them, the specific point values in 1.8 - 2.0 can be selected as 1.8, 1.85, 1.9, 1.95, 2.0, etc.; the specific point values in 0.3 - 0.6 can be selected as 0.3, 0.4, 0.5, 0.6, etc.; the specific point values in 32 - 36 can be selected as 32, 33, 34, 35, 36, etc.

[0047] In the second aspect, the present invention provides a real-time fluorescence detection kit for detecting Pseudomonas putida, and the real-time fluorescence detection kit contains the forward primer, reverse primer and probe described in the first aspect.

[0048] In the third aspect, the present invention provides an application of a rapid detection method of Pseudomonas putida as described in the first aspect and / or the real-time fluorescence detection kit for detecting Pseudomonas putida as described in the second aspect in the detection of cosmetics.

[0049] The numerical ranges described in the present invention not only include the above-listed point values, but also include any point values between the above numerical ranges that are not listed. Due to space limitations and for the sake of simplicity, the present invention does not exhaustively list the specific point values included in the described ranges.

[0050] Compared with the prior art, the present invention has at least the following beneficial effects:

[0051] 1. Before DNA extraction, the present invention performs enrichment culture, which can significantly improve the enrichment efficiency of low-concentration bacteria, reduce the detection limit, and add histidine to the enrichment broth to reduce the influence of interfering substances in the sample to be tested on the enrichment process of Pseudomonas putida.

[0052] 2. The present invention combines the lysis solution and mechanical lysis, and controls the water bath temperature at the same time, which helps to completely lyse Pseudomonas putida, extract DNA molecules with higher concentration and quality, and improve the detection accuracy. And specific primers and probes with higher specificity are constructed for the rpoD gene in Pseudomonas putida, significantly improving the detection accuracy and sensitivity.

[0053] 3. The detection method involved in the present invention can effectively avoid false positive / false negative results through a full-process quality control design, and can process 96 samples in a single batch, providing an efficient and reliable quality control solution for the cosmetics industry. Description of the Drawings

[0054] Figure 1 Amplification curve of rpoD gene using primer set 1.

[0055] Figure 2 Amplification curve of rpoD gene using primer set 2.

[0056] Figure 3 Amplification curve of gyrB gene using primer set.

[0057] Figure 4 Amplification curve of target gene detection for body wash samples contaminated with different concentrations of Pseudomonas putida.

[0058] Figure 5 Amplification curve of target gene detection for cream samples contaminated with different concentrations of Pseudomonas putida. Detailed implementation manners

[0059] The technical solutions of the present invention will be further described below with reference to the accompanying drawings and through specific implementation manners. However, the following examples are only simple examples of the present invention and do not represent or limit the scope of the protection of the rights of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0060] The sources of the reagents and materials used in the following examples are as follows:

[0061] Pseudomonas putida ATCC 12633 strain: Biological Wind.

[0062] Example 1

[0063] In this example, enrichment culture is carried out

[0064] (1) Sampling

[0065] Weigh 0.10 g or 1.0 g of samples from cosmetics known to be contaminated with Pseudomonas putida, and take 3 portions for each group.

[0066] (2) Preparation of enrichment broth

[0067] S1 enrichment broth containing histidine: 15.0 g of casein peptone, 5.0 g of soy peptone, 3.0 g of sodium chloride, 2.5 g of glucose, 3.0 g of dipotassium hydrogen phosphate, 4.0 g of histidine, 1.5 g of lecithin, 8.0 g of Tween 80, add distilled water to 1 L. After dissolving the above components by heating, adjust the pH value to 7.3 and autoclave at 121 °C for 20 min.

[0068] S2 enrichment broth without histidine: The difference from the formula in step (2.1) is only that it does not contain histidine, and the remaining components are the same as those of the S1 enrichment broth containing histidine, and an enrichment broth without histidine is prepared.

[0069] (3) Enrichment culture:

[0070] The experiment was divided into four groups, and the ratios of the samples and enrichment broths in each group were as follows:

[0071] A1: 0.1 g of sample + 9.9 mL of S1 enrichment broth (i.e., mass - to - volume ratio of 1:99 g / mL);

[0072] A2: 0.1 g of sample + 9.9 mL of S2 enrichment broth (i.e., mass - to - volume ratio of 1:99 g / mL);

[0073] A3: 1 g of sample + 9 mL of S1 enrichment broth (i.e., mass - to - volume ratio of 1:9 g / mL);

[0074] A4: 0.1 g of sample + 19.9 mL of S1 enrichment broth (i.e., mass - to - volume ratio of 1:199 g / mL); The above - mentioned raw materials of each group were mixed and cultured at 37 °C and 250 rpm for 20 h.

[0075] Each group was tested with no less than 3 samples, and the average enrichment bacterial concentration of each group was calculated. The enrichment effects of each experimental group are shown in Table 1. It can be seen that after the cosmetics contaminated with Pseudomonas putida were enriched in the SCDLP enrichment broth containing histidine, although the sample addition ratio in group A3 was relatively large and the initial contamination amount was relatively high, other interfering components in the system had a greater impact on the enrichment process, resulting in a lower bacterial concentration after enrichment. However, the enrichment speed of the sample in group A4 with a mixing ratio of 1:199 was significantly lower than that of the sample in group A1 with a mixing ratio of 1:99, resulting in an extended enrichment time, and the bacterial concentration after 20 h of enrichment was lower than that of the sample in group A1. And the enrichment broth of the sample in group A2 lacked histidine, resulting in an impact of interfering substances such as preservatives in the sample on the enrichment process of Pseudomonas putida, and the enrichment effect was significantly reduced.

[0076] Table 1

[0077]

[0078] The above results show that: when the sample to be tested in the present invention is mixed with the enrichment broth containing histidine at a mass - to - volume ratio of 1:(50 - 150), a higher - concentration bacterial solution can be obtained by enriching with less sample to be tested, thereby shortening the detection time and improving the detection ability for Pseudomonas putida at the same time.

[0079] Example 2

[0080] In this example, the DNA extraction operation was optimized.

[0081] (1) Sampling

[0082] 1 mL of the enrichment broth after culturing in group A1 in Example 1 was centrifuged at a speed of 10000 g for 1.5 min to collect the bacterial cells, and then washed 3 times with sterile PBS.

[0083] (2) Lysis

[0084] This invention explores the effects of water bath temperature and lysis methods on extraction. Add 300 μL of lysis buffer from the kit (18565ES48, Magnetic Bacterial / Fungal DNA Kit) to the collected bacterial cells, and then perform lysis and culture according to the following groups, with 3 samples in each group: Mechanical disruption is oscillatory disruption at a speed of 3000 rpm for 20 min.

[0085] B1: Mechanical disruption + 65°C water bath for 20 min;

[0086] B2: 65°C water bath for 20 min;

[0087] B3: Mechanical disruption + 55°C water bath for 20 min;

[0088] B4: Mechanical disruption + 75°C water bath for 20 min.

[0089] (3) DNA extraction

[0090] Use the magnetic bead method DNA extraction kit ( Magnetic Bacterial / Fungal DNA Kit) for DNA extraction. After lysis, add the magnetic bead suspension according to the kit instructions, and vortex at high speed for 10 min to allow the magnetic beads to adsorb DNA. Then add Wash Buffer A in the kit, vortex to disperse the magnetic beads, transfer to a magnetic stand for magnetic separation until the solution is clear, discard the solution, and add Wash Buffer B and C (the same operation, vortex to disperse the magnetic beads and transfer to a magnetic stand for magnetic separation until the solution is clear) to remove impurities. After discarding Wash Buffer C, open the lid and dry until the ethanol in the wash buffer completely evaporates. Add 70 μL of elution buffer, vortex at high speed and incubate at 60°C to elute DNA, transfer to a magnetic stand for magnetic separation until the solution is clear, aspirate the solution and store it to obtain high-purity DNA.

[0091] (4) DNA content detection

[0092] Use a Thermo Scientific NanoDrop spectrophotometer to detect the DNA concentration and purity. The specific detection results are shown in Table 2.

[0093] Table 2

[0094]

[0095] From the results, it can be seen that in Group B1, mechanical crushing and controlling the lysis temperature can completely lyse and break Pseudomonas putida, and with a water bath temperature of 65°C, the integrity of DNA can be maximally ensured. In Group B2, mechanical crushing was not carried out, resulting in incomplete lysis and breakage of bacteria, a low DNA concentration, and an A260 / 280 of 1.72, with the DNA quality not meeting the standard, and this purity cannot be used as a template for subsequent detection. In Group B3, the water bath temperature was lowered to 55°C, and the extracted DNA concentration was only 95.6 ng / μL, and the DNA quality was poor, with an A260 / 280 of only 1.54, and it cannot be used as a template for subsequent detection. In Group B4, the water bath temperature was too high, which affected the stability of DNA, thereby reducing the DNA extraction concentration.

[0096] It can be known from the experiment that using mechanical crushing and controlling the lysis temperature can completely lyse and break Pseudomonas putida while ensuring the quality of DNA molecules, so as to extract DNA with a high concentration and good quality for subsequent specific amplification detection.

[0097] Example 3

[0098] In this example, specific amplification detection is carried out

[0099] In this example, the detection specificities of different primer sets and different genes are explored.

[0100] (1) Samples

[0101] Positive sample: DNA of Pseudomonas putida extracted from Group B1 in Example 2.

[0102] Negative sample: DNA of Pseudomonas aeruginosa, Pseudomonas fluorescens, Pseudomonas alcaligenes, and Pseudomonas oleovorans were extracted respectively according to the methods of Examples 1-2, and the four kinds of DNA were mixed at equal nucleic acid concentrations to obtain a negative control DNA mixture with a concentration of 286.5 ng / μL.

[0103] (2) qPCR amplification system

[0104] Genes to be detected: rpoD gene and gyrB gene.

[0105] Primer probe sets: 2 primer sets were designed for the rpoD gene, and 1 primer set was designed for the gyrB gene. The specific primer information is shown in Table 3.

[0106] Table 3

[0107]

[0108] The probe sequences of the above three primer sets are labeled with the fluorescent group FAM at the 5' end and the quenching group BHQ1 at the 3' end.

[0109] Adopt The IIProbe qPCR SuperMix UDG reagent was used to amplify the DNA extracted in step (1), and the 20 μL amplification system is shown in Table 4.

[0110] Table 4

[0111] Component Volume Final concentration Template 1 μL / Forward primer (10 μM) 0.4 μL 0.2 μM Reverse primer (10 μM) 0.4 μL 0.2 μM Probe (10 μM) 0.4 μL 0.2 μM qPCR reaction buffer (2×) 10 μL 1× Inert reference dye (2×) 0.4 μL 1× Nuclease-free water To 20 μL - Total volume 20 μL -

[0112] (3) Primer amplification and result interpretation

[0113] The primer amplification program was as follows:

[0114] Pre-denaturation: 95 °C, 30 s;

[0115] Cyclic amplification: 95 °C, 5 s (denaturation) → 59 °C - 63 °C, 40 s (annealing / extension).

[0116] The result interpretation criteria were as follows:

[0117] If the Ct value of the sample ≤ 35 and the amplification curve is S-shaped, it was determined as positive; there was no amplification in the negative control;

[0118] Repeatability verification: The same sample was set with 3 replicates, and the difference in Ct values ≤ 0.50.

[0119] Table 5

[0120]

[0121] The specific detection results are shown in Table 5. The rpoD gene in Pseudomonas putida was used as the target gene for detection. The detection result graph using primer set 1 was as Figure 1 shown. It can be seen that this primer and probe could detect Pseudomonas putida, that is, the amplification of Pseudomonas putida was positive, while the amplification of the mixed DNA of other Enterobacteriaceae strains: Pseudomonas aeruginosa, Pseudomonas fluorescens, Pseudomonas alcaligenes, and Pseudomonas oleovorans was negative. And the Ct value was only 22.813, with good amplification specificity and high sensitivity. While using primer set 2 through Figure 2 it can be seen that the number of amplification cycles was too high, and the Ct value was as high as 32.754, proving that its amplification specificity was poor and the detection sensitivity was low. Through Figure 3 it can be seen that when the gyrB gene in Pseudomonas putida was used as the target gene for detection, the Ct value was 28.006, the amplification specificity was lower than that of the rpoD gene, and there was a false positive situation in the negative control group.

[0122] Example 4

[0123] This example detected Pseudomonas putida in body wash

[0124] Take out the Pseudomonas putida ATCC 12633 strain preserved at -80°C and culture it overnight. Take 0.09 g of the non-polluted body wash sample and mix it with 10 μL of the enriched bacterial solution after gradient dilution (10 2 CFU / mL, 10 3 CFU / mL, and 10 4 CFU / mL), mix it with 9.9 mL of sterilized S1 enrichment broth, and perform enrichment culture according to the method of group A1 in Example 1. Extract DNA according to the method of B1 in Example 2, and then perform detection according to primer set 1 of the rpoD gene in Example 3 for specific amplification identification. The specific detection results are shown in Table 6.

[0125] Table 6

[0126]

[0127] The specific detection result diagram is as shown in Figure 4 . It can be seen from the results that when the contamination amount of the body wash sample contaminated with Pseudomonas putida is 10 2 CFU / mL and 10 3 CFU / mL, after enrichment culture, DNA extraction, and qPCR amplification, the Ct values are all < 35, which are positive results. The method of the present invention can effectively detect Pseudomonas putida contaminated in body wash, and the detection sensitivity reaches 10 2 CFU / mL.

[0128] Example 5

[0129] In this example, Pseudomonas putida in cream is detected.

[0130] Take out the Pseudomonas putida ATCC 12633 strain preserved at -80°C and culture it overnight. Take 0.09 g of the non-polluted cream sample and mix it with 10 μL of the enriched bacterial solution after gradient dilution (10 2 CFU / mL, 10 3 CFU / mL, and 10 4 CFU / mL), mix it with 9.9 mL of sterilized S1 enrichment broth, and perform enrichment culture according to the method of group A1 in Example 1. Extract DNA according to the method of B1 in Example 2, and then perform detection according to primer set 1 of the rpoD gene in Example 3 for specific amplification identification. The specific detection results are shown in Table 7.

[0131] Table 7

[0132]

[0133] The specific detection result diagram is as shown in Figure 5As shown, the results indicate that when the contamination levels of Pseudomonas putida in the cream samples are 10 2 CFU / mL and 10 3 CFU / mL, after enrichment culture, DNA extraction, and qPCR amplification, the Ct values are all < 35, showing positive results. The method of the present invention can effectively detect the contaminated Pseudomonas putida in the cream, and the detection sensitivity is also 10 2 CFU / mL.

[0134] In summary, the present invention achieves specific detection by targeting the rpoD gene, combines an optimized DNA extraction and qPCR system, and shortens the detection cycle to within 24 hours. In addition, the full-process quality control design can effectively avoid false positive / false negative results, and 96 samples can be processed in a single batch, providing an efficient and reliable quality control solution for the cosmetics industry.

[0135] The applicant declares that the above description is only a specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of within the technical scope disclosed by the present invention fall within the protection scope and the disclosure scope of the present invention.

Claims

1. A rapid detection method for Pseudomonas putida, characterized in that, The detection method includes: (1) Take the sample to be tested and perform enrichment culture in an enrichment broth. Centrifuge to collect the bacteria in the enrichment culture, and extract DNA from the bacteria. (2) Perform PCR amplification on the extracted DNA, and determine whether Pseudomonas putida is contained in the sample to be tested according to the amplification result. The target gene for the PCR amplification is the rpoD gene.

2. The rapid detection method of Pseudomonas putida according to claim 1, characterized in that, In step (1), the mass-volume ratio of the sample to be tested to the enrichment broth is 1:(50 - 150) g / mL. Preferably, the sample to be tested includes cosmetics. Preferably, the cosmetics include any one of toner, lotion, facial mask, cream, shampoo or body wash.

3. The rapid detection method of Pseudomonas putida according to claim 1 or 2, characterized in that, The enrichment broth in step (1) contains 10 - 20 g / L peptone, 3 - 8 g / L soy peptone, 1 - 5 g / L sodium chloride, 1 - 5 g / L glucose, 1 - 5 g / L potassium dihydrogen phosphate, 3 - 6 g / L histidine, 1 - 2 g / L lecithin and 5 - 10 g / L Tween. Preferably, in step (1), the temperature of the enrichment culture is 32 - 37 °C, the time is 18 - 22 h, and the oscillation speed is 200 - 250 rpm.

4. The rapid detection method of Pseudomonas putida according to any one of claims 1-3, characterized in that, The DNA extraction in step (1) includes the following steps: (a) Mix the bacteria with a lysis solution, mechanically break them, and perform a lysis reaction. (b) Perform magnetic bead adsorption, washing and elution on the product of the bacterial lysis to obtain DNA.

5. The rapid detection method of Pseudomonas putida according to claim 4, characterized in that, The temperature of the lysis reaction is 60 - 75 °C, and the time is 15 - 30 min. Preferably, the mechanical breaking includes oscillation breaking. Preferably, the speed of the oscillation breaking is 2000 - 4000 rpm, and the time is 10 - 30 min.

6. The rapid detection method of Pseudomonas putida according to any one of claims 1-5, characterized in that, The PCR amplification in step (2) includes any one of ordinary PCR, qPCR, digital PCR or ddPCR. Preferably, the nucleic acid sequence of the forward primer for the PCR amplification in step (2) includes the sequence shown in SEQ ID NO:

1. Preferably, the nucleic acid sequence of the reverse primer for the PCR amplification in step (2) includes the sequence shown in SEQ ID NO:

2. Preferably, the nucleic acid sequence of the probe for the PCR amplification in step (2) includes the sequence shown in SEQ ID NO:

3. Preferably, the probe includes a fluorescent labeling group and a fluorescent quenching group. Preferably, the fluorescent labeling group includes any one of FAM, Cy5 or HEX. Preferably, the fluorescent quenching group includes any one of BHQ1, BHQ2 or TAMRA.

7. The rapid detection method of Pseudomonas putida according to any one of claims 1-6, characterized in that, In the PCR amplification system in step (2), the final concentrations of the forward primer, reverse primer and probe are each independently 0.1 - 0.5 μM.

8. The rapid detection method of Pseudomonas putida according to any one of claims 1-7, characterized in that, The procedure of the PCR amplification in step (2) includes: Step 1: 94 - 96 °C, 20 - 50 s; Step 2: 94 - 96 °C, 3 - 7 s; Step 3: 59 - 63 °C, 30 - 60 s; Steps 2 and 3 are repeated 35 - 45 cycles.

9. A real-time fluorescence detection kit for detecting Pseudomonas putida, characterized in that, The real-time fluorescence detection kit contains the forward primer, reverse primer and probe described in claim 6.

10. Use of a rapid detection method for Pseudomonas putida according to any one of claims 1-8 and / or a real-time fluorescence detection kit for detecting Pseudomonas putida according to claim 9 in the detection of cosmetics.

Images