A CAPS molecular marker for the salt-tolerant ST4 promoter region of rice and its application

Abstract

The present invention relates to the field of agricultural technology, and specifically provides a CAPS molecular marker for the salt-tolerant ST4 promoter region of rice and its application. Rice leaves are selected to extract the genomic DNA of the above-mentioned tissue, and then the DNA of the above-mentioned tissue is used as a template, and the corresponding sequences of ST4-PRO-F1 and ST4-PRO-R1 are used as specific primers to perform PCR amplification respectively to obtain amplified fragments; the amplified fragments are digested with Eco81I restriction endonuclease, and electrophoresis is performed after digestion; after electrophoresis of the ST4 promoter fragment, only one 2162bp main band is present for salt-tolerant individual plants, while two bands of 1366bp and 784bp appear in the electrophoresis for salt-sensitive individual plants. The present invention can quickly breed rice varieties improved by using the wild rice ST4 gene, which helps to improve the current situation of much field work and heavy workload caused by using group materials for a large amount of salt-tolerant identification, and has important theoretical and practical significance for breeding new rice varieties with salt-tolerant traits.

Description

Technical Field

[0001] The present invention relates to the technical field of rice variety screening, in particular to a CAPS molecular marker for screening salt-tolerant genes in a rice ST4 promoter region and an application thereof. Background Art

[0002] Soil salinization is a major constraint to global agricultural development. Globally, saline-alkali soils cover over 800 million hectares, accounting for 8.7% of the Earth's surface area. Due to soil degradation, food production for over 1.5 billion people worldwide faces significant challenges, posing a serious threat to sustainable agricultural development. Rice (Oryza sativa L.), a key food crop in my country, is also moderately salt-sensitive. With the continued expansion of saline-alkali land in my country, the development of salt-tolerant rice varieties is crucial for utilizing these soils and safeguarding food security.

[0003] Wild rice, the ancestral species of cultivated rice, harbors numerous stress- and disease-resistance genes that were lost or weakened during rice domestication due to its long-term exposure to natural environments. However, the widespread adoption of cultivated varieties in recent decades has narrowed the genetic base of cultivated rice. Developing and utilizing salt-tolerance genes within wild rice germplasm is a key approach to broadening the genetic base of cultivated rice and cultivating salt-tolerant rice varieties. Molecular marker-assisted breeding can significantly shorten breeding cycles and rapidly develop new salt-tolerant rice varieties. Therefore, developing molecular markers associated with salt-tolerance genes in wild rice is particularly important. Summary of the Invention

[0004] The present invention technicians discovered a new salt-tolerant gene LOC_Os04g52660 in wild rice in the early stage. The gene is located on chromosome 4 and encodes an expressed protein. Through near-isogenic lines and transgenic experiments, it was verified that the allele in wild rice has extremely strong salt tolerance.

[0005] The purpose of the present invention is to design new molecular markers based on the sequence polymorphism of the gene in wild rice and cultivated rice, which will be used for molecular assisted selection of new varieties cultivated using the gene in the future, so as to accelerate the process of salt-tolerant rice breeding.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] The first aspect of the present invention provides an application of a CAPS molecular marker in a rice ST4 promoter region in screening salt-tolerant rice varieties. The CAPS molecular marker is located on chromosome 4 of the rice genome, and the polymorphic site is G / A. The upstream primer sequence of the specific primer pair for amplifying the CAPS molecular marker is shown as ST4-PRO-F1, and the downstream primer sequence is shown as ST4-PRO-R1. The upstream primer ST4-PRO-F1 is: ATTTGCTGATGTGGTTTGGGTTCG; the downstream primer ST4-PRO-R1 is: AAGATTGGTGGTGCTCGGGCTTAC. The amplified products of the specific primer pair for amplifying the CAPS molecular marker in Nipponbare and NIL are 2150 bp and 2162 bp, respectively. Figure 1 ); After the rice amplification product containing the salt-tolerant gene fragment in the ST4 promoter region was digested with the restriction endonuclease Eco81I, there was only one 2162bp main band, and after the rice amplification product not containing the salt-tolerant gene fragment in the ST4 promoter region was digested with the restriction endonuclease Eco81I, there were two main bands of 1366bp and 784bp.

[0008] The second aspect of the present invention provides the use of the specific primer pair of the CAPS molecular marker in molecular screening of salt-tolerant rice varieties.

[0009] A third aspect of the present invention provides a method for screening the presence of a salt-tolerance gene in the rice ST4 promoter region, comprising the following steps:

[0010] S1. Extracting genomic DNA from rice leaves, and then using the DNA from the tissue as a template and the corresponding sequences of ST4-PRO-F1 and ST4-PRO-R1 described in claim 1 as specific primers, respectively, to perform PCR amplification to obtain amplified fragments;

[0011] S2. The PCR amplification product was digested with restriction endonuclease Eco81I, and the digestion product was typed by agarose gel electrophoresis. The electrophoresis bands were used to determine whether the salt-tolerance gene fragment was present.

[0012] S3. Identification results: If the enzyme digestion product contains only one 2162 bp main band, the rice ST4 promoter region to be tested contains the salt-tolerance gene fragment; if the enzyme digestion product contains two main bands of 1366 bp and 784 bp, the rice ST4 promoter region to be tested does not contain the salt-tolerance gene fragment.

[0013] Furthermore, the PCR amplification system is as follows: a volume of 50 μl, including 25 μl of 2×PCR Buffer for KOD FXNeo, 10 μl of 2 mM dNTPs, 1.5 μl of 10 pmol / μl primer pair, 1 μl of KOD-FX-Neo enzyme, 100 ng of template DNA, and sterilized water to 50 μl.

[0014] Furthermore, the PCR amplification procedure is as follows: pre-denaturation at 95°C for 5 minutes; pre-denaturation at 98°C for 10 seconds, annealing at 60°C for 30 seconds, extension at 68°C for 1 minute, 34 cycles; and finally extension at 68°C for 10 minutes.

[0015] Beneficial effects of the present invention:

[0016] Using this CAPS marker to detect the genotypes of the ST4 promoter in different individual plants allows for the rapid selection of rice varieties modified using this salt-tolerance locus in wild rice. The development of this molecular marker has successfully enabled the precise laboratory identification of salt-tolerant genotypes. Compared to traditional field phenotypic screening methods, this approach can effectively improve field trials, which are subject to significant environmental interference, long screening cycles, and high labor and material resource consumption. This provides a highly efficient molecular marker-assisted selection technology system for salt-tolerant rice breeding, which has important theoretical and practical significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The electrophoresis diagram of the rice ST4 promoter fragment before and after enzyme digestion: Figure 1 A in the figure is the enzyme digestion electrophoresis diagram of the promoter fragments of Nipponbare and NILST4 in Example 1: M is Marker III, and lanes 1 and 2 are Nipponbare and NIL, respectively; Figure 1 Figure B shows the electrophoresis diagram of Nipponbare and NILST4 promoter fragments before and after enzyme digestion.

[0018] Figure 2 This is the enzyme digestion electrophoresis diagram of the rice ST4 promoter fragment in Example 2: M is Marker III, and lanes 1-20 are: Nipponbare (cultivated rice), NIL, salt-tolerant plants in the F2 population, NIL, and Nipponbare, respectively. Figure 3 This is the salt tolerance phenotype diagram of Nipponbare and NIL: Figure 3 On the left are the seedlings of Nipponbare and NIL that have grown normally for 15 days. Figure 3 On the right are seedlings of Nipponbare and NIL treated with 150 mM NaCI for 7 days and then recovered in clean water for 7 days. DETAILED DESCRIPTION

[0019] The specific embodiments of the present invention are described below to facilitate understanding of the present invention by those skilled in the art. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the appended claims, these changes are obvious, and all inventions and creations utilizing the concepts of the present invention are protected.

[0020] Experimental materials: Wild rice chromosome segment replacement line population CSSL118 constructed with common wild rice as donor parent and Nipponbare as recipient parent, F2 generation generated by hybridization of CSSL118 and Nipponbare, and near-isogenic line population NIL.

[0021] Example 1

[0022] A method for screening the presence of the salt-tolerance gene ST4 in a rice promoter region comprises the following steps:

[0023] S1. Extract genomic DNA from rice leaves. Then, using the DNA from the above tissues as templates and the corresponding sequences of ST4-PRO-F1 and ST4-PRO-R1 as specific primers, perform PCR amplification to obtain amplified fragments. The PCR amplification volume is 50 μL, including 25 μL of 2× PCR Buffer for KOD FX Neo, 10 μL of 2 mM dNTPs, 1.5 μL of 10 pmol / μL primer pair, 1 μL of KOD-FX-Neo enzyme, 100 ng of template DNA, and sterile water to 50 μL. The PCR amplification procedure is as follows: pre-denaturation of DNA at 95°C for 5 min; 34 cycles of pre-denaturation at 98°C for 10 s, annealing at 60°C for 30 s, and extension at 68°C for 1 min; and finally, extension at 68°C for 10 min.

[0024] S2. PCR amplification products were digested with the restriction endonuclease Eco81I. The digestion system was as follows: 1 μg of PCR product, 2 μL of FastDigest Eco81I, 2 μL of 10× FastDigest Green Buffer, and ddH2O to 32 μL. The digestion was incubated at 37°C for 1.5 hours. The digestion products were analyzed by agarose gel electrophoresis to determine whether they contained the salt-tolerance gene fragment.

[0025] S3, identification results: ST4 promoter fragment electrophoresis showed only a 2162bp main band was NIL, a salt-tolerant plant; electrophoresis showed two bands of 1366bp and 784bp was Nipponbare, a salt-sensitive plant. The molecular identification results of salt tolerance of the two rice varieties were consistent with the phenotypic results, indicating that the identification procedure of the present invention is simple and has a wide range of applications ( Figure 1 and Figure 3 ).

[0026] Example 2

[0027] A method for screening the presence of the salt-tolerance gene ST4 in a rice promoter region comprises the following steps:

[0028] S1. Extract genomic DNA from rice leaves. Then, using the DNA from the above tissues as templates and the corresponding sequences of ST4-PRO-F1 and ST4-PRO-R1 as specific primers, perform PCR amplification to obtain amplified fragments. The PCR amplification volume is 50 μL, including 25 μL of 2× PCR Buffer for KOD FX Neo, 10 μL of 2 mM dNTPs, 1.5 μL of 10 pmol / μL primer pair, 1 μL of KOD-FX-Neo enzyme, 100 ng of template DNA, and sterile water to 50 μL. The PCR amplification procedure is as follows: pre-denaturation of DNA at 95°C for 5 min; 34 cycles of pre-denaturation at 98°C for 10 s, annealing at 60°C for 30 s, and extension at 68°C for 1 min; and finally, extension at 68°C for 10 min.

[0029] S2. PCR amplification products were digested with the restriction endonuclease Eco81I. The digestion system was as follows: 1 μg of PCR product, 2 μL of FastDigest Eco81I, 2 μL of 10× FastDigest Green Buffer, and ddH2O to 32 μL. Digestion was incubated at 37°C for 1.5 hours. The digestion products were analyzed by agarose gel electrophoresis to determine whether they contained the salt-tolerance gene fragment.

[0030] Identification results: The ST4 promoter fragment had only one 2162bp main band after electrophoresis, which was a salt-tolerant individual in the F2 population; the one with two bands of 1366bp and 784bp was Nipponbare, which was a salt-sensitive individual ( Figure 2 ).

[0031] In summary, this molecular marker can be used to quickly select salt-tolerant rice varieties improved using the wild rice ST4 gene, helping breeders overcome the shortcomings of having to use a large amount of population materials for field salt tolerance identification, which is labor-intensive and time-consuming.

[0032] Specific embodiments are used in the present invention to illustrate the principles and implementation methods of the present invention. The description of the above embodiments is only used to help understand the method of the present invention and its core ideas. At the same time, for those skilled in the art, according to the ideas of the present invention, there will be changes in the scope of the specific implementation methods. In summary, the content of this specification should not be understood as limiting the present invention.

Claims

1. Application of the CAPS molecular marker in the rice ST4 promoter region in screening salt-tolerant rice varieties, characterized in that: The CAPS molecular marker is located on chromosome 4 of the rice genome, and the polymorphic site is G / A. The upstream primer sequence of the specific primer pair for amplifying the CAPS molecular marker is shown as ST4-PRO-F1, and the downstream primer sequence is shown as ST4-PRO-R1. The upstream primer ST4-PRO-F1 is ATTTGCTGATGTGGTTTGGGTTCG; the downstream primer ST4-PRO-R1 is AAGATTGGTGGTGCTCGGGCTTAC. After the rice amplification product containing the salt-tolerance gene fragment in the ST4 promoter region is digested with the restriction endonuclease Eco81I, there is only one 2162bp main band. After the rice amplification product not containing the salt-tolerance gene fragment in the ST4 promoter region is digested with the restriction endonuclease Eco81I, it contains two main bands of 1366bp and 784bp.

2. Use of the specific primer pair of the CAPS molecular marker according to claim 1 in molecular screening of salt-tolerant rice varieties, characterized in that: The rice amplification product containing the salt-tolerant gene fragment in the ST4 promoter region has only one 2162 bp main band after being digested with restriction endonuclease Eco81I, while the rice amplification product not containing the salt-tolerant gene fragment in the ST4 promoter region has two main bands of 1366 bp and 784 bp after being digested with restriction endonuclease Eco81I.

3. A method for screening the presence of a salt-tolerance gene in the rice ST4 promoter region, characterized in that: The following steps are included: S1. Extracting genomic DNA from rice leaves, and then using the genomic DNA as a template and the corresponding sequences of ST4-PRO-F1 and ST4-PRO-R1 described in claim 1 as specific primers, respectively, to perform PCR amplification to obtain amplified fragments; S2. The PCR amplification product was digested with restriction endonuclease Eco81I, and the digestion product was typed by agarose gel electrophoresis. The electrophoresis bands were used to determine whether the salt-tolerance gene fragment was present. S3. Identification results: If the enzyme digestion product contains only one 2162 bp main band, the rice ST4 promoter region to be tested contains the salt-tolerance gene fragment; if the enzyme digestion product contains two main bands of 1366 bp and 784 bp, the rice ST4 promoter region to be tested does not contain the salt-tolerance gene fragment.

4. The method according to claim 3, characterized in that The PCR amplification system is as follows: a volume of 50 μl, including 25 μl of 2× PCR Buffer for KOD FX Neo, 10 μl of 2 mM dNTPs, 1.5 μl of 10 pmol / μl primer pair, 1 μl of KOD-FX-Neo enzyme, 100 ng of template DNA, and sterile water to 50 μl.

5. The method according to claim 3, characterized in that The PCR amplification procedure was as follows: pre-denaturation at 95° C. for 5 min; pre-denaturation at 98° C. for 10 s, annealing at 60° C. for 30 s, extension at 68° C. for 1 min, 34 cycles; and finally extension at 68° C. for 10 min.

Images