Chromium ion detection method and application thereof

Abstract

The invention relates to a chromium ion detection method and application thereof. The chromium ion detection method comprises the following steps: triggering the activity of DNAzyme by using Cr < 3 + > to release Pp; a triplex complex is constructed from Tp, Bp and TAMRA-Sp, Bp in the triplex complex is released through induction of Pp, and TAMRA-Sp in the triplex complex is further released through combination with a fuel chain F; the method comprises the following steps: coating a layer of PSS on the surface of UCNPs, carrying out sulfonylation reaction on sulfonic acid groups on the surface of the PSS and amino-modified Cp, modifying the surface of the UCNPs coated with the PSS with an NH2-Cp chain, constructing UCNP-PSS-DNA, complementarily pairing the NH2-Cp chain of the UCNP-PSS-DNA with a TAMRA-Sp base released from a three-chain compound, thereby capturing TAMRA-Sp, and detecting the fluorescence intensity under the irradiation of a near-infrared exciter. The chromium ion detection is realized. The chromium ion detection method provided by the invention has the characteristics of low detection limit and high selectivity, and solves the problems that high selection, low detection limit and low material requirements cannot be simultaneously met in the prior art; and the UCNP (at) PSS (at) DNA as a biosensor has excellent selectivity and stability.

Description

Technical Field

[0001] The present invention relates to the technical field of detecting chromium ions, and specifically relates to a method for detecting chromium ions and its application. Background Art

[0002] Commonly used methods for detecting chromium ions, such as spectrophotometry, are easily interfered by other substances and have relatively poor selectivity; potentiometric analysis has relatively poor selectivity and is easily interfered by other ions; high performance liquid chromatography (HPLC) has high requirements for sample pretreatment and the sample needs to be converted into a form suitable for HPLC detection; X-ray fluorescence spectrometry has a relatively high detection limit and is suitable for rapid detection of samples with relatively high chromium ion content; SERS has advantages such as high sensitivity, high selectivity, and non-destructive detection, but the SERS technology has high requirements for the substrate and high-quality SERS substrates need to be prepared. Summary of the Invention

[0003] The purpose of the present invention is to provide a method for detecting chromium ions with low material requirements, low detection limit, and high selectivity.

[0004] To achieve the above purpose, the present invention provides the following technical solutions:

[0005] The present invention proposes a method for detecting chromium ions.

[0006] S1, Utilize Cr 3+ to trigger the activity of DNAzyme and release Pp.

[0007] S2, Combine with the SDR amplification reaction system. The SDR amplification reaction system consists of Tp, Bp, and TAMRA-Sp to form a triple-stranded complex. Through the induction of Pp, Bp in the triple-stranded complex is released, and further combines with the fuel strand F to release TAMRA-Sp in the triple-stranded complex; the sequence of the fuel strand F is: CAGATGAGGTTATAGGAAAGATGGCGAAA.

[0008] S3, Coat a layer of PSS on the surface of UCNPs. Use the sulfonic acid groups on the surface of PSS to react with amino-modified Cp to carry out sulfonylation reaction, and modify the NH2-Cp strand on the surface of UCNPs that has been coated with the PSS to construct UCNP@PSS@DNA. Use the NH2-Cp strand of the UCNP@PSS@DNA to base pair with TAMRA-Sp released from the triple-stranded complex, thereby capturing TAMRA-Sp, and detect the fluorescence intensity under the irradiation of a near-infrared exciter to achieve the detection of chromium ions.

[0009] Furthermore, when detecting Cr 6+ ions, first add Cr 6+Reduced to Cr 3+ , and then in turn according to the above S1, S2, S3, the detection of Cr 6+ ions is realized.

[0010] Furthermore, the detection of Cr 3+ ions: Add the solution to be detected and MES buffer solution to the DNAzyme-PMPs solution prepared according to the above DNAzyme, perform magnetic separation, take the supernatant after magnetic separation, add the above triplex complex and fuel strand F, mix, stand still, add the UCNP@PSS@DNA and 1×TAE+Mg 2+ buffer solution, mix, stand still, and after completion, place it under the irradiation of a 980 nm near-infrared exciter to detect the fluorescence intensity. Compare the detected fluorescence intensity with the standard curve to obtain the Cr 3+ ion concentration in the sample to be detected;

[0011] The detection of Cr 6+ ions: Add the solution to be detected, NaBH4 and MES buffer solution to the DNAzyme-PMPs solution prepared according to the above DNAzyme, perform magnetic separation, take the supernatant after magnetic separation, add the above triplex complex and fuel strand F, mix, stand still, add the UCNP@PSS@DNA and 1×TAE+Mg 2+ buffer solution, mix, stand still, and after completion, place it under the irradiation of a 980 nm near-infrared exciter to detect the fluorescence intensity. Compare the detected fluorescence intensity with the standard curve to obtain the Cr 6+ ion concentration in the sample to be detected;

[0012] The above triplex complex is: Add 30 μM Tp template probe, 30 μM Bp blocking probe and 30 μM TAMRA-Sp probe to 1×TAE+Mg 2+ buffer solution, place it at 95 °C for reaction for 5 min, then lower the temperature by 3 °C per minute until it reaches 25 °C to obtain the above triplex complex.

[0013] Furthermore, the sequence of the Bp probe is: GACAGGAAGATGGCGAAA;

[0014] The sequence of the Tp template probe is: ATTTAATTTCGCCCTGTCCTATAACCTCATCTG;

[0015] The sequence of the TAMRA-Sp probe is TAMRA-CAGAGGTTATAG.

[0016] Further, for the DNAzyme-PMPs solution: Take 105 μL of streptavidin-coated magnetic beads for magnetic separation to remove the magnetic bead protection solution in the original solution. Wash three times with 1×PBS and MES buffer respectively, and after washing, disperse in 90 μL of MES buffer. Add 10 μL of DNAzyme complex, place it in a shaker at 37 °C and incubate for 1 h. Then perform magnetic separation to remove the unbound DNAzyme complex in the reaction solution, and wash three times with MES buffer. The obtained product is dispersed in 50 μL of MES buffer to obtain the DNAzyme-PMPs solution;

[0017] For the DNAzyme complex: Take 5 μM of Enzyme and 5 μM of Biotin-substrate and mix them in 10 μL of MES buffer, and place them in a metal bath for annealing treatment. The annealing treatment is to maintain at 95 °C for 3 min, and then decrease by 3 °C per minute until it reaches 25 °C to obtain the DNAzyme complex; The sequence of the Enzyme is: TTTCGGTCAAAGGTGGGTGCGAGTTTTTACTCGTTATAGTGGTGAC; The sequence of the Biotin-substrat is: Biotin-TTTTTTGTCACGAGTCACTAT / rA / GGAAGACGA AATTAAAT.

[0018] Further, for the UCNP@PSS@DNA: Weigh 10 mg of TCT powder and disperse it in 500 μL of DMF solution, and stir at room temperature for 1 h to form a TCT-DMF adduct; Take 100 μL of the TCT-DMF adduct, add 250 μL of DMF solution containing 2 mg of UCNP@PSS and 2 mL of dichloromethane solution, and stir at room temperature for 30 min to form a sulfonylation reagent; Add 100 μL of 26 μM NH2-Cp solution to the sulfonylation reagent, introduce argon gas, and stir in an argon environment for 12 h. After the reaction is completed, centrifuge at 13000 rpm for 15 min. Wash the centrifuged product three times with ultrapure water, and collect the centrifuged product and disperse it in 1 mL of 1×TAE buffer to obtain UCNP@PSS@DNA;

[0019] For the NH2-Cp solution: Add the sequence of NH2-Cp to the HEPES buffer with a pH of 8 to obtain the NH2-Cp solution; The sequence of the NH2-Cp is CTATAACCTCATCTG-C6NH2.

[0020] The UCNP@PSS: Disperse 200 mg of UCNPs in 4 mL of DMF solution, add 3.4 mL of an aqueous solution containing 1020 mg of PSS, place it in a 60 °C water bath and stir for 24 h. After stirring, take it out, centrifuge at 13000 rpm for 15 min, discard the supernatant, disperse it with 5 mL of ultrapure water, centrifuge at 13000 rpm for 15 min, and repeat the centrifugation and washing three times to remove the excess PSS. The resulting product is the UCNP@PSS.

[0021] Furthermore, for the UCNPs: Disperse 100 mg of UCNPs@OA in 10 mL of ultrapure water adjusted to pH = 4 with HCl, sonicate for 10 min, add 2 mL of ether, and stir at room temperature for 2 h to remove the OA molecules attached to the surface of the nanomaterials. After stirring, remove the upper ether layer, add 5 mL of acetone, centrifuge at 13000 rpm for 15 min, and the precipitate obtained by centrifugation is the UCNPs.

[0022] Furthermore, for the UCNPs@OA: Take oleic acid, octadecene, NaF, and rare earth stearate (RE(C 17 H 35 COO)3) in a three-necked flask, introduce nitrogen, magnetically stir and heat to 135 - 145 °C under reflux condensation for 30 min, then raise the temperature to 312 - 314 °C and maintain for 45 min. After completion, naturally cool to room temperature, centrifuge at 11000 rpm for 5 min and then discard the supernatant. Wash with cyclohexane, ethanol, and ultrapure water two to three times respectively to remove oleic acid and NaF. The final product is the UCNP@OA;

[0023] Among them, the RE(C 17 H 35 COO)3 represents a mixture of erbium rare earth stearate, yttrium rare earth stearate, and ytterbium rare earth stearate at a molar ratio of rare earth ion doping of 2%, 78%, and 20%.

[0024] The present invention also includes the application of any of the above-mentioned chromium ion detection methods in a biosensor.

[0025] Furthermore, the UCNP@PSS@DNA is used as a biosensor for the detection of chromium ions.

[0026] Compared with the prior art, the present invention uses UCNP@PSS@DNA as an energy donor, combines DNAzyme and SDR containing a TAMRA-modified strand for the detection of chromium ions, and provides a chromium ion detection method with the characteristics of low detection limit and high selectivity, solving the problem that the prior art cannot simultaneously meet the requirements of high selectivity, low detection limit, and low material requirements; moreover, UCNP@PSS@DNA as a biosensor has excellent selectivity and stability.

[0027] Description of the drawings

[0028] Figure 1 It is a mechanism diagram for the detection of chromium ions in the present invention.

[0029] Figure 2 It is the characterization result of DNAzme activity by denaturing polyacrylamide gel electrophoresis.

[0030] Figure 3 Figure A is the mechanism diagram, and Figure B is the characterization result of the activity of DNAzyme loaded on the surface of magnetic beads.

[0031] Figure 4 It is a schematic diagram of the UNPACK fitting result.

[0032] Figure 5 It is a characterization diagram of SDR by polyacrylamide gel electrophoresis (Lane M: standard DNA).

[0033] Figure 6 It is a schematic diagram of the fluorescence intensity change result of UCNP@PSS@DNA for different concentrations of chromium ions. (A) Fluorescence spectra of UCNP@PSS@DNA for different concentrations of Cr 3+ ; (B) Standard curves of different concentrations of Cr 3+ and I 585 / I 545 ; (C) Fluorescence spectra of UCNP@PSS@DNA for different concentrations of Cr 6+ ; (D) Standard curves of different concentrations of Cr 6+ and I 585 / I 545 .

[0034] Figure 7 It is the determination result of the reproducibility of the UCNP@PSS@DNA biosensor.

[0035] Figure 8 It is the determination result of the stability of UCNP@PSS@DNA. Detailed implementation manners

[0036] The technical solution of the present invention will be further described below in conjunction with specific embodiments. It should be understood that the following embodiments are only for exemplarily illustrating and explaining the present invention, and should not be construed as limiting the protection scope of the present invention. All technologies implemented based on the above content of the present invention are covered within the scope of protection intended by the present invention.

[0037] Without special instructions, the DMF solution involved in the present invention is an N,N-dimethylformamide solution; the TCT powder is cyanuric chloride powder; streptavidin is Streptavidin, SA; the magnetic beads are Streptavidin Paramagnetic Particles, PMPs, 1mg / mL; PSS is poly(4-styrenesulfonic acid sodium).

[0038] All DNA sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the sequences are as follows:

[0039] Enzyme: TTTCGGTCAAAGGTGGGTGCGAGTTTTTACTCGTTATAGTGGTGAC;

[0040] Substrate: TTTCACGAGTCACTAT / rA / GGAAGATGGCGAAAT;

[0041] Biotin-substrate: Biotin-TTTTTTGTCACGAGTCACTAT / rA / GGAAGACGA AATTAAAT;

[0042] Biotin-substrate-FAM: Biotin-TTTTTTGTCACGAGTCACTAT / rA / GGAAGA CGAAATTAAAT-C6FAM;

[0043] NH2-Cp: CTATAACCTCATCTG-C6NH2;

[0044] Tp: ATTTAATTTCGCCCTGTCCTATAACCTCATCTG;

[0045] Bp: GACAGGAAGATGGCGAAA;

[0046] F: CAGATGAGGTTATAGGAAAGATGGCGAAA;

[0047] Sp: CAGATGAGGTTATAG;

[0048] TAMRA-Sp: TAMRA-CAGAGGTTATAG。

[0049] Example 1

[0050] Preparation of UCNP@OA

[0051] In a 50 mL three-necked flask, take 12 mL of oleic acid, 8 mL of octadecene, 1.176 g of NaF and 0.8 mM of rare earth stearate (RE(C 17 H 35 COO)3), where RE(C 17 H 35 COO)3 represents a mixture of erbium rare earth stearate, yttrium rare earth stearate and ytterbium rare earth stearate with a molar ratio of rare earth ion doping of 2%, 78% and 20%. Pass in nitrogen, magnetically stir and heat to 135 - 145 °C under reflux condensation for 30 min, then quickly raise the temperature to 312 - 314 °C and keep for 45 min. After completion, naturally cool to room temperature. Collect the product in a centrifuge tube and centrifuge at 11000 rpm for 5 min, then discard the supernatant. Wash the product with cyclohexane, ethanol and ultrapure water two to three times respectively to remove oleic acid and NaF. The product is dried using a freeze dryer and stored at 4 °C to obtain UCNP@OA.

[0052] Preparation of UCNPs

[0053] Take the prepared UCNPs@OA (100 mg) and disperse it in 10 mL of ultrapure water (adjust the pH = 4 using HCl), sonicate for 10 min to disperse, add 2 mL of ether, stir at room temperature for 2 h to remove the OA molecules attached to the surface of the nanomaterials. After stirring, remove the upper ether layer, add 5 mL of acetone, centrifuge at 13000 rpm for 15 min, and collect the centrifuged precipitate, which is UCNPs.

[0054] Preparation of UCNP@PSS

[0055] Take 200 mg of UCNPs and disperse them in 4 mL of N,N-dimethylformamide (DMF) solution; add 3.4 mL of an aqueous solution containing 1020 mg of PSS, place it at 60 °C and stir for 24 h. After stirring, take it out, centrifuge at 13000 rpm for 15 min, discard the supernatant, disperse it with 5 mL of ultrapure water, centrifuge at 13000 rpm for 15 min, and repeat the centrifugation and washing three times to remove the excess PSS. The obtained product (i.e., UCNP@PSS) is freeze-dried for standby.

[0056] Preparation of UCNP@PSS@DNA

[0057] Weigh 10 mg of TCT powder and disperse it in 500 μL of DMF solution, then stir at room temperature for 1 h to form a TCT-DMF adduct. Take 100 μL of the above TCT-DMF adduct, add 250 μL of UCNP@PSS (dissolved in DMF, containing 2 mg of UCNP@PSS) and 2 mL of dichloromethane solution, and stir at room temperature for 30 min to promote the formation of a sulfonylation reagent. Add 100 μL of 26 μM NH2-Cp (diluted with HEPES buffer, pH = 8), introduce argon gas, and stir for 12 h under an argon atmosphere. After the reaction is completed, centrifuge at 13000 rpm for 15 min. Wash the centrifuged product three times with ultrapure water, and collect the centrifuged product and disperse it in 1 mL of 1×TAE buffer to obtain UCNP@PSS@DNA, which is stored at 4 °C for later use.

[0058] Preparation of DNAzyme complex

[0059] Mix 5 μM Enzyme and 5 μM Biotin-substrate in 10 μL of MES buffer, and place it in a metal bath for annealing treatment. The annealing treatment is to maintain at 95 °C for 3 min, and then decrease the temperature by 3 °C per minute until it reaches 25 °C. Thus, the DNAzyme complex is prepared. After the annealing is completed, place it at 4 °C for later use.

[0060] Construction of DNAzyme-PMPs solution

[0061] First, take 105 μL of streptavidin (SA)-coated magnetic beads (Streptavidin Paramagnetic Particles, PMPs, 1 mg / mL) for magnetic separation to remove the magnetic bead protective solution in the original solution. Wash it three times with 1×PBS and MES buffer respectively, and after washing, disperse it in 90 μL of MES buffer. Secondly, add 10 μL of DNAzyme complex (50 μM), and place it in a shaker at 37 °C for incubation for 1 h to obtain PMPs modified with DNAzyme complex (DNAzyme-PMPs). Subsequently, magnetically separate the above solution to remove the unbound DNAzyme complex in the reaction solution, and wash it three times with MES buffer. Disperse the product obtained by magnetic separation in 50 μL of MES buffer to obtain the DNAzyme-PMPs solution, which is stored at 4 °C for later use.

[0062] Synthesis of triple-strand complex

[0063] In 1×TAE + Mg 2+30 μM of template probe (Tp), 30 μM of block probe (Bp), and 30 μM of TAMRA-Sp were added to the buffer respectively, added in equimolar ratio, placed at 95 °C for reaction for 5 min, and then the temperature was decreased by 3 °C per minute until it reached 25 °C. Thus, a triplex complex was prepared and stored at 4 °C after completion.

[0064] Example 2

[0065] Refer to Figure 1 , in an embodiment of the present invention, the chromium ion detection method is as follows:

[0066] S1, utilize Cr 3+ to trigger the activity of DNAzyme and release Pp;

[0067] S2, combine with the SDR amplification reaction system. The SDR amplification reaction system is composed of Tp, Bp, and TAMRA-Sp to construct a triplex complex. The Pp induces the release of Bp in the triplex complex, which further releases TAMRA-Sp in the triplex complex by binding to the fuel strand F; the sequence of the fuel strand F is: CAGATGAGGTTATAGGAAAGATGGCGAAA;

[0068] S3, coat a layer of PSS on the surface of UCNPs, utilize the sulfonic acid groups on the surface of PSS to undergo a sulfonylation reaction with amino-modified Cp, and modify the NH2-Cp strand on the surface of the UCNPs that have been coated with the PSS to construct UCNP@PSS@DNA. Utilize the NH2-Cp strand of the UCNP@PSS@DNA to base-pair with the TAMRA-Sp released from the triplex complex, thereby capturing TAMRA-Sp, and detect the fluorescence intensity under the irradiation of a near-infrared exciter to achieve the detection of chromium ions.

[0069] In an embodiment of the present invention, when detecting Cr 6+ ions, utilize NaBH4 to reduce Cr 6+ to Cr 3+ , and then successively according to the above S1, S2, and S3, achieve the detection of Cr 6+ ions.

[0070] Example 3

[0071] The following tests were carried out using the DNAzyme-PMPs prepared in Example 1 and the biosensor UCNP@PSS@DNA:

[0072] Plot Cr 3+Standard curve: Take 25 μL of the DNAzyme-PMPs solution in a 1.5 mL EP tube, add 5 μL of Cr 3+ ion solutions with different concentrations (final concentrations are 0, 0.5, 1, 2, 5, 10, 25, 75, 150, 300, 500, 1000 nM) and 10 μL of MES buffer solution, and react at 37 °C for 50 min. After completion, perform magnetic separation. Take the supernatant and add 5 μL of the triple-strand complex and 5 μL of 40 μM fuel strand F to a 600 μL EP tube, mix, and place in a 37 °C environment for 60 min. After completion, add 12.5 μL of UCNP@PSS@DNA solution to make its final concentration 0.25 mg / mL and 127.5 μL of 1×TAE+Mg 2+ buffer solution. After mixing, react at 37 °C for 50 min. After the reaction is completed, place it under irradiation of a 980 nm near-infrared exciter and detect the fluorescence emission spectrum of the sample in the wavelength range of 300 - 900 nm to plot the standard curve.

[0073] Plot the Cr 6+ Standard curve: Take 25 μL of the DNAzyme-PMPs solution in a 1.5 mL EP tube, add 5 μL of Cr 6+ ions with different concentrations (final concentrations are 0, 1, 2.5, 5, 10, 25, 50, 75, 100, 300, 500, 1000 nM), 3 μL of NaBH4 (5 mM), and 7 μL of MES buffer solution, and react at 37 °C for 50 min. After completion, perform magnetic separation. Take the supernatant and add 5 μL of the triple-strand complex and 5 μL of 40 μM fuel strand F to a 600 μL EP tube, mix, and place in a 37 °C environment for 60 min. After completion, add 12.5 μL of UCNP@PSS@DNA solution to make its final concentration 0.25 mg / mL and 127.5 μL of 1×TAE+Mg 2+ buffer solution. After mixing, react at 37 °C for 50 min. After the reaction is completed, place it under irradiation of a 980 nm near-infrared exciter and detect the fluorescence emission spectrum of the sample in the wavelength range of 300 - 700 nm to plot the standard curve.

[0074] Lake water and tap water were used for spiked experiments to detect the concentration of chromium ions: The solution to be detected (spiked with lake water / tap water) and MES buffer solution were added to the DNAzyme-PMPs solution, followed by magnetic separation. The supernatant after magnetic separation was taken and the triple-stranded complex and fuel strand F were added, mixed, allowed to stand, UCNP@PSS@DNA was added, mixed, allowed to stand, and after completion, the fluorescence intensity was detected under irradiation by a 980 nm near-infrared exciter. The detected fluorescence intensity was compared with the standard curve to obtain the concentration of chromium ions in the sample to be tested. The recovery rates of chromium ions in the obtained lake water and tap water samples (n = 3) are shown in Table 1 below:

[0075] Table 1

[0076]

[0077] Example 4

[0078] Verification of DNAzyme Activity

[0079] The activity of DNAzyme was verified using denaturing polyacrylamide gel. Referring to Figure 2, lanes 1-3 were DNAzme, substrate, and Pp respectively. Three separate electrophoretic bands could be observed from the electrophoresis pattern. Lanes 4 and 5 were DNAzme-substrate and DNAzme-substrate+Cr respectively 3+ , under denaturing polyacrylamide gel conditions, DNAzme-substrate was transformed into single strands, so two single strands could be observed, and their positions corresponded to the DNAzme and substrate bands in lanes 1 and 2. In lane 5, Cr 3+ was added, which activated the activity of DNAzyme, so a new band was generated, corresponding to the Pp band in lane 3. It can be seen that the DNAzyme complex can activate the activity of DNAzyme after binding to Cr 3+ .

[0080] Construct the DNAzyme-PMPs solution according to the method of Example 1. Referring to Figure 3 Figure A, by adding Cr 3+ ions to the reaction solution loaded with DNAzyme-substrate, the activity of DNAzyme was activated, and the substrate was cleaved to release the Pp strand modified with FAM at one end. The emission fluorescence intensity of FAM at 520 nm was detected by fluorescence. Referring to Figure 3 Figure B, when 1 μM of Cr 3+ ions were added, the fluorescence intensity detected at 520 nm was significantly stronger than that of the blank group. Therefore, the activity of DNAzyme loaded on the surface of the magnetic beads could be verified.

[0081] Example 5

[0082] Verification of the feasibility of the chain cycle

[0083] The theoretical feasibility of SDR was verified by the fitting method using UNPACK software. Refer to Figure 4 , the three states in the SDR reaction process are Tp-Bp-Sp, Tp-Sp-Pp, and Tp-F, and their free energies are -50.18 kcal / mol, -51.32 kcal / mol, and -51.77 kcal / mol respectively. Their free energies gradually decrease, indicating that they gradually tend to be stable, indicating that the SDR theory is feasible.

[0084] The practical feasibility of SDR was verified by polyacrylamide gel electrophoresis. Refer to Figure 5 , lanes 1-5 are the electrophoretic bands of Tp, Bp, Sp, Pp, and F respectively. Lane 6 is the trimer complex of Tp-Bp-Sp, and the height of its band is significantly higher than the first 5 bands. Lane 7 is Tp-Bp-Sp+Pp. After adding Pp, due to the formation of the tetramer intermediate of Tp-Bp-Sp-Pp, there is an extra band above the corresponding position of lane 6, and the band at the position corresponding to Pp in lane 7 and lane 4 becomes significantly lighter, indicating that Pp participated in the reaction. Lane 8 is Tp-Bp-Sp+F. In the absence of Pp, SDR is difficult to proceed. Therefore, the color of the F band corresponding to lane 5 in lane 8 has no obvious change. Lane 9 is Tp-Bp-Sp+Pp+F. After adding Pp and F simultaneously, the color at the corresponding position of F becomes significantly lighter, and the bands of Bp and Sp can be clearly observed. The above results prove the practical feasibility of SDR.

[0085] Example 6

[0086] The present invention uses the constructed UCNP@PSS@DNA biosensor for the detection of chromium ions. Refer to Figure 6 A, as the concentration of Cr 3+ gradually increases, the TAMRA-SP released by the SDR reaction system gradually increases. UCNP@PSS@DNA captures TAMRA-SP, and the LRET gradually enhances. The fluorescence intensity of UCNPs at 545 nm gradually decreases, and the fluorescence intensity at 585 nm gradually increases. Through I 585 / I 545 is linearly fitted with the concentration of Cr 3+ . Refer to Figure 6 B, the equation Y = 0.00083C + 0.00058 can be obtained, R 2 = 0.995, the detection range is 0.5 - 75 nM, and the LOD is 0.135 nM. Refer to Figure 6 C, when the target is Cr6+ At this time, Cr is reduced to Cr by NaBH4 6+ and as the concentration of Cr gradually increases, the LRET efficiency generated by UCNP@PSS@DNA capturing TAMRA-SP gradually increases. By fitting the concentration of I 3+ / I 6+ with that of Cr 585 / I 545 and Cr 6+ for linear fitting, as shown in Figure Figure 6 D, the equation Y = 0.00079C - 0.00003 can be obtained, with R 2 = 0.992. The detection range is 1 - 100 nM, and the detection limit is 0.793 nM.

[0087] Example 7

[0088] The present invention uses DNAzyme as an identification probe and has good selectivity compared with other methods.

[0089] The comparison results of different chromium ion detection methods are shown in Table 2. It can be seen that the detection limits of Cr 3+ and Cr 6+ obtained in this experiment are lower than those of current common methods. Among them, the detection limit of Cr 6+ is much lower than 0.05 mg / L (0.170 μM) specified in the national drinking water standard for domestic use, and is also lower than the detection limit of 0.004 mg / L (13.599 nM) in the national drinking water standard inspection method, showing good detection effects.

[0090] Table 2

[0091]

[0092] Example 8

[0093] Reproducibility investigation

[0094] To investigate the reproducibility of the UCNP@PSS@DNA biosensor, 5 nM, 25 nM, and 50 nM of Cr 3+ were selected for 5 parallel determinations. The results are shown in Figure 7 . The relative standard deviations (RSD) of the I 3+ / I 585 / I 545 detection results for 5 nM, 25 nM, and 50 nM Cr

[0095] Example 9

[0096] Time stability investigation

[0097] To investigate the time stability of the UCNP@PSS@DNA biosensor, 5 nM and 25 nM of Cr were selected 3+ to investigate the stability of the sensor within one week. Refer to Figure 8 , and the signal change amplitudes were 5.503% and 4.328% respectively. The signal change amplitude was very small, indicating that the UCNP@PSS@DNA had good stability within one week.

[0098] Although the specific embodiments of the present invention have been described above, those skilled in the art should understand that the specific embodiments we described are illustrative rather than used to limit the scope of the present invention. Effective modifications and changes made by those skilled in the art in accordance with the spirit of the present invention should be covered by the scope protected by the claims of the present invention.

Claims

1. A method for detecting chromium ions, characterized in that: S1, using Cr 3+ to trigger the activity of DNAzyme and release Pp; S2. Combine with an SDR extension reaction system. The SDR extension reaction system constructs a triple-stranded complex from Tp, Bp, and TAMRA-Sp. The Pp induces the release of Bp in the triple-stranded complex, which binds to the fuel strand F and further releases TAMRA-Sp in the triple-stranded complex. The sequence of the fuel strand F is: CAGATGAGGTTATAGGAAAGATGGCGAAA; S3. Coating a layer of PSS on the surface of UCNPs. Using the sulfonic acid groups on the surface of PSS to undergo a sulfonylation reaction with amino-modified Cp, the NH2-Cp strand is modified on the surface of UCNPs that have been coated with the PSS, constructing UCNP@PSS@DNA. Using the NH2-Cp strand of the UCNP@PSS@DNA to base-pair complementarily with TAMRA-Sp released from the triple-stranded complex, thereby capturing TAMRA-Sp, and detecting the fluorescence intensity under the irradiation of a near-infrared exciter to achieve the detection of chromium ions.

2. The chromium ion detection method according to claim 1, characterized in that: When detecting Cr 6+ ions, first reduce Cr 6+ to Cr 3+ , and then sequentially perform the detection of Cr 6+ ions according to the described S1, S2, and S3.

3. The method for detecting chromium ions according to claim 1, characterized in that: Cr 3+ Detection of ions: Add the solution to be detected and MES buffer solution to the DNAzyme-PMPs solution prepared according to the DNAzyme, perform magnetic separation, take the supernatant after magnetic separation, add the triple-strand complex and fuel strand F, mix, let stand, add the UCNP@PSS@DNA and 1×TAE+Mg 2+ buffer solution, mix, let stand, and after completion, place it under irradiation of a 980 nm near-infrared exciter to detect the fluorescence intensity. Compare the detected fluorescence intensity with the standard curve to obtain the concentration of Cr 3+ ions in the sample to be tested; Cr 6+ Detection of ions: Add the solution to be detected, NaBH4, and MES buffer solution to the DNAzyme-PMPs solution prepared according to the DNAzyme, perform magnetic separation, take the supernatant after magnetic separation, add the triple-stranded complex and fuel strand F, mix, let stand, add the UCNP@PSS@DNA and 1×TAE+Mg 2+ buffer solution, mix, let stand, and after completion, place it under irradiation of a 980 nm near-infrared exciter to detect the fluorescence intensity. Compare the detected fluorescence intensity with the standard curve to obtain the concentration of Cr 6+ ions in the sample to be tested; The triple-stranded complex is as follows: Add 30 μM of Tp template probe, 30 μM of Bp blocking probe, and 30 μM of TAMRA-Sp probe in 1×TAE+Mg 2+ buffer, place it at 95 °C for reaction for 5 min, then lower the temperature by 3 °C per minute until it reaches 25 °C to obtain the triple-stranded complex.

4. The method for detecting chromium ions according to claim 3, characterized in that: The sequence of the Bp probe is: GACAGGAAGATGGCGAAA; The sequence of the Tp template probe is: ATTTAATTTCGCCCTGTCCTATAACCTCATCTG; The sequence of the TAMRA-Sp probe is TAMRA-CAGAGGTTATAG.

5. The chromium ion detection method according to claim 3, characterized in that: The DNAzyme-PMPs solution: Take 105 μL of streptavidin-coated magnetic beads for magnetic separation to remove the magnetic bead protective solution in the original solution. Wash three times with 1×PBS and MES buffer respectively, and after washing, disperse in 90 μL of MES buffer. Add 10 μL of DNAzyme complex, place it in a shaker at 37 °C for 1 h of incubation, perform magnetic separation to remove the unbound DNAzyme complex in the reaction solution, and wash three times with MES buffer. The obtained product is dispersed in 50 μL of MES buffer to obtain the DNAzyme-PMPs solution; The DNAzyme complex: Take 5 μM of Enzyme and 5 μM of Biotin-substrate and mix them in 10 μL of MES buffer, and place them in a metal bath for annealing treatment. The annealing treatment is to maintain at 95 °C for 3 min, and then decrease by 3 °C per minute until it decreases to 25 °C to obtain the DNAzyme complex. The sequence of the Enzyme is: TTTCGGTCAAAGGTGGGTGCGAGTTTTTACTCGTTATAGTGGTGAC; The sequence of the Biotin-substrat is: Biotin-TTTTTTGTCACGAGTCACTAT / rA / GGAAGACGA AATTAAAT.

6. The chromium ion detection method according to claim 3, characterized in that: The UCNP@PSS@DNA is prepared as follows: Weigh 10 mg of TCT powder and disperse it in 500 μL of DMF solution, and stir for 1 h at room temperature to form a TCT-DMF adduct; Take 100 μL of the TCT-DMF adduct, add 250 μL of DMF solution containing 2 mg of UCNP@PSS and 2 mL of dichloromethane solution, and stir for 30 min at room temperature to form a sulfonylation reagent; Add 100 μL of 26 μM NH2-Cp solution to the sulfonylation reagent, introduce argon gas, and stir for 12 h under an argon atmosphere. After the reaction is completed, centrifuge at 13000 rpm for 15 min. Wash the centrifuged product three times with ultrapure water, and collect the centrifuged product and disperse it in 1 mL of 1×TAE buffer solution to obtain UCNP@PSS@DNA. The NH2-Cp solution: Add the sequence NH2-Cp to the HEPES buffer solution with a pH of 8 to prepare the NH2-Cp solution; The sequence of NH2-Cp is CTATAACCTCATCTG-C6NH2. The UCNP@PSS: Take 200 mg of UCNPs and disperse them in 4 mL of DMF solution, add 3.4 mL of aqueous solution containing 1020 mg of PSS, place it at 60 °C and stir for 24 h. After the stirring is completed, take it out, centrifuge at 13000 rpm for 15 min, discard the supernatant, disperse it with 5 mL of ultrapure water, centrifuge at 13000 rpm for 15 min, and repeat the centrifugation and washing three times to remove the excess PSS. The obtained product is the UCNP@PSS.

7. The chromium ion detection method according to claim 6, characterized in that: The UCNPs: Take 100 mg of UCNPs@OA and disperse them in 10 mL of ultrapure water adjusted to pH = 4 with HCl, sonicate for 10 min, add 2 mL of diethyl ether, and stir for 2 h at room temperature to remove the OA molecules attached to the surface of the nanomaterials. After the stirring is completed, remove the upper diethyl ether layer, add 5 mL of acetone, centrifuge at 13000 rpm for 15 min, and the centrifuged precipitate is the UCNPs.

8. The chromium ion detection method according to claim 7, wherein: The UCNPs@OA: Take oleic acid, octadecene, NaF, and rare earth stearate (RE(C 17 H 35 COO)3) in a three-necked flask, introduce nitrogen, magnetically stir and heat to 135 - 145 °C under reflux condensation for 30 min, then raise the temperature to 312 - 314 °C and keep it for 45 min. After that, naturally cool to room temperature, centrifuge at 11000 rpm for 5 min, and then discard the supernatant. Wash with cyclohexane, ethanol, and ultrapure water two to three times respectively to remove oleic acid and NaF. The final product is the UCNP@OA; wherein the RE(C 17 H 35 COO)3 represents a mixture of erbium rare earth stearate, yttrium rare earth stearate, and ytterbium rare earth stearate in a molar ratio of rare earth ion doping of 2%, 78%, and 20%.

9. The application of the chromium ion detection method according to any one of claims 1-8 in a biosensor.

10. The application according to claim 9, characterized in that: The UCNP@PSS@DNA is used as a biosensor for the detection of chromium ions.

Images