Methods for detection and treatment of non-small cell lung cancer

Abstract

Provided are methods of treating cancer in a patient in need thereof, the cancer co-expressing one or more placental alkaline phosphatase (ALPP) proteins, and a cancer target antigen, comprising administering to the patient a treatment regimen, wherein the therapeutic regimen comprises administering one or more standard care inhibitors or anti-proliferative agents that increase cell surface expression of the one or more ALPP proteins, and one or more ALPP protein targeting agents. Also provided are methods of selecting a patient suffering from a cancer co-expressing one or more placental alkaline phosphatase (ALPP) proteins, and a cancer target antigen, comprising: determining a baseline cell surface expression level of the one or more ALPP proteins in a biological sample obtained from the patient; and determining co-expression of one or more cancer cell surface oncogenic drivers.

Description

Cross - Reference to Related Applications

[0001] This application claims the benefit and priority of U.S. Provisional Patent Application No. 63 / 382,234, filed on November 3, 2022, the entire content of which is incorporated herein by reference. Incorporation of Sequence Listing

[0002] The sequence listing contained in the file named "MDA0076 - 401 - PC", which is 10 kilobytes in size (as measured in the Microsoft Windows operating system) and was created on October 30, 2022, is submitted herewith electronically and incorporated herein by reference.

[0003] Placental alkaline phosphatase (ALPP) and ALPPL2 are closely related and regulated GPI - anchored proteins that are expressed on the cell surface in some cancers, while normal tissue expression of ALPP and ALPP2 is largely limited to the placenta. ALPP and ALPPL2 are currently being explored as cancer therapy targets, including in China, where immunotherapy trials of CAR - T cells targeting ALPP for ovarian cancer (phase I) and endometrial cancer (phase II) are underway. In addition, the pre - clinical efficacy of antibody - drug conjugates targeting ALPP / ALPPL2 has been demonstrated in non - human primates and will form the basis for a first - in - human phase I clinical study.

[0004] Although antibody - drug conjugates represent potentially effective treatment options for certain types of cancer, this technology may be limited for cancer types lacking high expression of ALPP / ALPP2. There is a need in the art for more effective methods of treating cancers that express ALPP / ALPP2. Summary of the Invention

[0005] This disclosure provides evidence of enhanced surface expression of ALPP / ALPPL2 in cancer cells expressing ALPP after treatment with a therapeutic agent targeting an oncogenic driver or inhibiting cell proliferation. The enhanced expression increases the susceptibility of cancer cells to therapies targeting ALPP / ALPPL2, resulting in improved anti - cancer efficacy.

[0006] Accordingly, provided is a method of treating cancer in a patient in need thereof, the cancer co - expressing one or more placental alkaline phosphatase (ALPP) proteins (such as ALPP and / or ALPP2) and a cancer target antigen, the method comprising administering to the patient a treatment regimen, wherein the treatment regimen comprises administering one or more standard - of - care inhibitors or anti - proliferative agents that increase the cell - surface expression of the one or more ALPP proteins, and one or more ALPP - protein targeting agents.

[0007] There is also provided a method of treating cancer in a patient in need thereof, the cancer co-expressing alkaline phosphatase (ALPP) and / or ALPP2 protein and carrying an EGFR activating mutation, the method comprising administering, in combination with an EGFR inhibitor, an antibody-drug conjugate that targets ALPP and / or ALPP2 in the cells of the patient.

[0008] There is also provided a method of treating cancer in a patient in need thereof, the cancer co-expressing alkaline phosphatase (ALPP) and / or ALPP2 protein and carrying an EGFR activating mutation, the method comprising: identifying the EGFR activating mutation in cells from a biological sample obtained from the patient; detecting and / or quantifying the cell surface expression of placental alkaline phosphatase (ALPP) and / or ALPP2 in the cells; and administering, in combination with an EGFR inhibitor, an antibody-drug conjugate therapy that targets ALPP and / or ALPP2 in the cancer cells.

[0009] There is also provided a method of treating drug-tolerant or drug-resistant cancer cells that co-express alkaline phosphatase (ALPP) and / or ALPP2 protein in a patient in need thereof, the method comprising: identifying the EGFR activating mutation in cells from a biological sample obtained from the patient; detecting and / or quantifying the cell surface expression of ALPP and / or ALPP2 in the cells; and administering, in combination with an EGFR inhibitor, an antibody-drug conjugate therapy that targets ALPP and / or ALPP2 in the cancer cells.

[0010] There is also provided a method of preventing the emergence of resistance of cancer cells that co-express alkaline phosphatase (ALPP) and / or ALPP2 protein to an EGFR inhibitor, the method comprising administering, in combination with the EGFR inhibitor, an antibody-drug conjugate therapy that targets ALPP and / or ALPP2 in the cancer cells.

[0011] In some embodiments, prior to administering the treatment regimen, the method further comprises determining the baseline cell surface expression level of the one or more ALPP proteins and the co-expression of one or more cancer cell surface oncogenic drivers in a biological sample obtained from the patient.

[0012] There is also provided a method of selecting a patient having cancer that co-expresses one or more placental alkaline phosphatase (ALPP) proteins and a cancer target antigen, the method comprising: determining the baseline cell surface expression level of the one or more ALPP proteins in a biological sample obtained from the patient; and determining the co-expression of one or more cancer cell surface oncogenic drivers.

[0013] These and other aspects of the invention will become apparent from the following detailed description. To this end, various references are set forth herein which more particularly describe certain background information, procedures, compounds, and / or compositions, and each of which is hereby incorporated by reference in its entirety. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figures 1A - 1C – (A) shows a tissue microarray of normal tissue and lung tumor, anti-ALPP IHC staining, where the positivity of ALPP staining is limited to normal testis and lung tumor. (B) shows large tissue sections of placenta, breast, and TNBC, anti-ALPP IHC staining, where normal placenta and TNBC show strong positivity for ALPP staining. (C) shows cell surface co-expression of EGFR and ALPP / ALPPL2.

[0015] Figures 2A - 2E – (A) shows cell surface co-expression of target protein and ALPP / ALPPL2 on lung adenocarcinoma cell H1650 (EGFR mut). (B) shows the change in cell surface ALPP level associated with the treatment of H1650 cells with tyrosine kinase inhibitor (TKI). (C) shows cell surface co-expression of target protein and ALPP / ALPPL2 on breast cancer cells, SKBR3 cells and MCF7 cells. (D) shows the treatment of SKBR3 cells expressing ALPP and MCF7 cells lacking ALPP expression with Gefitinib. (E) shows the treatment of SKBR3 cells expressing ALPP with anti-HER-2 antibody.

[0016] Figures 3A - 3D – (A) shows the treatment of proteomic analysis of biotinylated surface proteins in EGFR mut H1650 and PC9 lung adenocarcinoma cells. (B) shows the surface ALPP expression (spectral abundance) in EGFR mut H1650 and PC9 cells after 24 hours and 48 hours of gefitinib treatment. (C) shows the immunofluorescence of ALPP expression in EGFR mut H1650 cells after gefitinib treatment. (D) shows the immunoblot of ALPP after treating EGFR mut H1650, KRAS mut H2291, and H1838 cells with gefitinib or epidermal growth factor (EGF) for 24 hours and 48 hours.

[0017] Figures 4A - 4D–(A) shows anti-ALPP antibody internalization in H1650 cells. (B) indicates that the combined treatment of gefitinib and ALPP-ADC shows the best efficacy in H1650 cells. (C) shows the synergistic effect of gefitinib and ALPP-ADC in H1650, H1651, H2291 and H1944 cells. (D) shows the protocol of in vivo study of orthotopic lung xenografts. (E) indicates that the best efficacy was obtained from the combined treatment of gefitinib (50 mg / kg) and ALPP-ADC (5 mg / kg) in the in vivo study.

[0018] Figures 5A - 5D –(A) shows the surface expression (spectral abundance) of ALPP and EGFR in breast cancer cell lines. (B) shows the immunoblots of ALPP, EGFR and phosphorylated EGFR in BT20 and HCC1937 TNBC cells after treatment with gefitinib (1 μM). (C) shows the representative light field images of BT20 and HCC1937 TNBC cells after treatment with gefitinib and ALPP-MMAF-ADC alone or in combination. (D) shows the tumor volume curves of TNBC tumor-bearing mice after treatment with gefitinib (50 mg / kg) and ALPP-MAFF-ADC (5 mg / kg) alone or in combination. *p value < 0.05; ****p value < 0.0001.

[0019] Figures 6A - 6E –ALPP and ALPG expression in lung cancer. (A) Spectral abundances (MS / MS events) of ALPP and ALPPL2 in LUAD and SCLC cell lines. (B) Gene expressions of ALPP and ALPG (ALPPL2) in lung adenocarcinoma (LUAD), lung squamous cell carcinoma (LUSC) and small cell lung cancer (SCLC) cell lines from the Cancer Cell Line Encyclopedia (CCLE). (C) Gene expression levels of ALPP and ALPG in LUAD and LUSC in The Cancer Genome Atlas (TCGA) dataset. (D) IHC staining of ALPP in NSCLC tumor tissues. (E) Immunofluorescence staining of ALPP in HCC827 and PC9 cell lines.

[0020] Figures 7A - 7J-EGFR TKIs upregulate ALPP expression in LUAD cells. (A) ALPP levels in the TCGA LUAD dataset with WT or driver mutations in EGFR, KRAS, NF1, and BRAF. (B–C) Immunoblots of ALPP, pAKT-S473, total AKT, pERK-T202 / Y204, total ERK, pSTAT1-Y701, pSTAT1-S727, total STAT1, and β-actin in LUAD cancer cells H2291 and H1650 after treatment with or without EGF (10 or 20 ng / mL) or gefitinib (0.5 or 1 μM) for 24 and 48 h. (D) Immunoblots of ALPP, EGFR, phosphorylated EGFR (pEGFR Tyr1068), and β-actin. (E) Flow cytometry analysis of ALPP expression. (F) Immunofluorescence staining of ALPP (green) and nuclei (red). (G–H) ALPP expression in LUAD cell lines treated with gefitinib or osimertinib. Gene expression data were obtained from the Gene Expression Omnibus (GSE75602, GSE193258). (I) Immunoblots of ALPP and β-actin in LUAD cell lines HCC827 and H1650 treated with vehicle control or EGFR inhibitors. (J) Immunoblots of ALPP and β-actin in LUAD cell lines H1395, H1944, HCC2279, H2291, H1650, H1838, and H1651 treated with vehicle control or gefitinib (1 μM) for 48 h. Figures 8A - 8L-EGFR TKIs dephosphorylate FoxO3a to induce ALPP expression. (A) GESA analysis of the cell cycle using the TCGA LUAD dataset. (B) KEGG pathway analysis using the TCGA LUAD dataset. (C) Flow cytometry analysis of the cell cycle of HCC827 and PC9 cells treated with vehicle control, gefitinib (30 nM), or osimertinib (30 nM). (D) Immunoblotting of ALPP and β-actin in HCC827 and PC9 cells treated with the PI3K inhibitor NVP-BKM120 (100 nM), MEK inhibitor AZD8330 (100 nM), and ERK inhibitor SCH772984 (100 nM) for 48 hours. (E) Ingenuity pathway analysis of upstream regulators of cells treated with vehicle control or osimertinib. RNAseq data were obtained from the Gene Expression Omnibus (GSE193258). (F-G) Immunoblotting of ALPP and β-actin in HCC827 and PC9 cells treated with the FOXO inhibitor AS1842856 and vehicle or gefitinib for 48 hours. (H) Immunoblotting of ALPP and FoxO3a in HCC827 and H1650 LUAD cells overexpressing FoxO3a treated with vehicle or gefitinib (30 nM) for 48 hours. (I) Immunoblotting of ALPP, FoxO3a, and phosphorylated FoxO3a (Ser294, Ser425) in HCC827 and H1650 cells treated with 30 nM gefitinib for 6 hours. (J) Immunoblotting of FoxO3a in the cytosolic and nuclear compartments of the HC827 and H1650 cell lines treated with gefitinib. (K) Immunoblotting of ALPP, EGFR, pEGFR (Tyr1068), FoxO3a, pFoxO3a (Ser294), and β-actin in HCC827 and PC9 cells treated with gefitinib (30 nM) or osimertinib (30 nM). (L) ChIP-qPCR assay of the promoter region of the ALPP gene in HCC827 and H1650 LUAD cells treated with vehicle or gefitinib (1 μM) for 6 hours. Figures 9A - 9N-EGFR TKI is required to maintain transient and reversible upregulation of ALPP. (A) Immunoblotting of ALPP, EGFR, pEGFR (Tyr1068), and β-actin in HCC827 and PC9 cell lines treated with or without (D0) gefitinib or osimertinib for 1 day (D1), 2 days (D2), and 4 days (D4). (B) Immunofluorescence staining of ALPP in HCC827 and PC9 cell lines treated with gefitinib or osimertinib for 0 days (D0), 1 day (D1), 2 days (D2), and 4 days (D4). (C) Flow cytometry analysis of surface ALPP expression in HCC827 and PC9 cells treated with gefitinib (30 nM) and osimertinib (30 nM) for 1 day, 2 days, and 4 days. (D) Single-cell analysis of NSCLC PC9 cells treated with osimertinib for 0 days, 3 days, 7 days, and 14 days. Data were obtained from the Gene Expression Omnibus (GSE150949). (E-F) ALPP expression level (E) and percentage of ALPP + cells (F). (G) mRNA levels of ALPP in HCC827 and PC9 osimertinib-tolerant cells. Data were obtained from the Gene Expression Omnibus (GSE193258). (H) Immunoblotting of ALPP, EGFR, pEGFR (Tyr1068), and β-actin in HCC827 and PC9 parental and DTPC. (I) Immunofluorescence staining of ALPP in HCC827 and PC9 parental and DTPC. (J) Flow cytometry analysis of surface ALPP expression in HCC827 and PC9 parental and DTPC. (K) Immunoblotting of ALPP, EGFR, pEGFR (Tyr1068), and β-actin in HCC827 and PC9 treated with gefitinib or osimertinib for 48 hours, then the drug was washed out and the cells were incubated in TKI-free medium for an additional 48 hours. (L) Immunoblotting of ALPP, EGFR, pEGFR (Tyr1068), and β-actin. HCC827 and PC9 cells were treated and incubated as in (K), then treated with gefitinib or osimertinib for another 48 hours. (M) Immunoblotting of ALPP, EGFR, pEGFR (Tyr1068), and β-actin in HCC827 and PC9 DPTC treated with gefitinib for 48 hours, then the drug was withdrawn for an additional 48 hours. (N) Immunoblotting of ALPP, EGFR, pEGFR (Tyr1068), and β-actin in HCC827 and PC9 DPTC incubated in TKI-free medium for 48 hours after gefitinib treatment and then treated with gefitinib for another 48 hours.

[0021] Figures 10A - 10H-EGFR TKIs induce ALPP expression in resistant cancer cells. (A) Immunoblotting of ALPP, EGFR, pEGFR (Tyr1068), and β-actin in HCC827 and PC9 parental (P) and gefitinib-resistant cells (GR) treated with vehicle control or gefitinib (100 nM) for 48 h. (B) Immunofluorescence staining of ALPP in HCC827 and PC9 parental (P) and gefitinib-resistant cells (GR) treated with vehicle control or gefitinib (100 nM) for 48 h. (C) Flow cytometry analysis of surface ALPP expression in HCC827 and PC9 parental and gefitinib-resistant cells treated with vehicle control or gefitinib (100 nM). (D) ALPP mRNA expression levels in parental and erlotinib-resistant LUAD cell lines HCC827 and HCC4006. Gene expression data were obtained from the Gene Expression Omnibus (GSE121634). (E) ALPP mRNA expression levels in parental and gefitinib-resistant LUAD cell line PC9. Gene expression data were obtained from the Gene Expression Omnibus (GSE75602). (F) ALPP mRNA expression levels in PC9 xenograft tumors. Gene expression data were obtained from the Gene Expression Omnibus (GSE161584). (G) ALPP expression in EGFR TKI-naive and resistant patients. Data were obtained from OncoSG. (H) ALPP expression in NSCLC patients before and after osimertinib resistance. Figures 11A - 11E- The combination of EGFR TKI and ALPP-ADC treatment enhances in vitro cancer cell killing. (A) Cell viability of HCC827 and PC9 treated with gefitinib (50 nM) or osimertinib (50 nM) and αALPP-MMAF (1 μg / ml) or IgG-MMAF (1 μg / ml). (B) Cell viability of HCC827 and PC9 treated with or without gefitinib (50 nM) and osimertinib (50 nM), IgG-MMAF or α-ALPP-MMAF (1 μg / ml). (C) Cell viability of HCC827 and PC9 pretreated with vehicle or gefitinib (50 nM) and osimertinib (50 nM) for 4 days and then added IgG-MMAF or α-ALPP-MMAF (1 μg / ml). (D) Cell viability (right panel) and crystal violet staining (left panel) of gefitinib-resistant cells treated with IgG-MMAF or α-ALPP-MMAF (5 μg / ml). (E) Cell viability of HCC827 and PC9 cells pretreated with EGFR TKI (100 nM) for 2 days, then treated with EGFR TKI (100 nM) in combination with IgG-MMAF or α-ALPP-MMAF (5 μg / ml) for 2 days, and then cultured for an additional 20 days in the presence of EGFR TKI (100 nM). Figures 12A - 12H - Gefitinib treatment enhances tumor ALPP expression in vivo and potentiates the anti-cancer efficacy of ALPP-MMAF-ADC. (A) Confocal imaging of H1650 cells treated with or without Phrodo Red-labeled anti-ALPP antibody. (B) Cell viability of H1650 cells treated with consecutive gefitinib and / or ALPP-MMAF-ADC. (C) Morphology of LUAD cell line H1650 treated with gefitinib and / or ALPP-MMAF-ADC. (D) H&E staining of tumor tissues and IHC staining of ALPP in tumor tissues from subcutaneous xenograft LUAD mouse models of H1650 cell line treated with or without gefitinib (50 mg / kg). (E) Schematic diagram of an orthotopic xenograft LUAD mouse model of H1650 cell line treated with gefitinib (50 mg / kg) and / or ALPP-MMAF-ADC (5 mg / kg). (F) IVIS imaging of tumors on day 17 before drug treatment and day 29 after treatment. (G) Statistical analysis of tumor burden from (F). *P<0.05, **P<0.01. (H) Hematoxylin and eosin staining representative of tumor sections. Figure 13 - Proposed schematic of ALPP surface upregulation in cancer cells through EGFR inhibition.

[0022] Figures 14A - 14C- ALPP expression in normal tissues. (A) Representative immunohistochemistry (IHC) images of ALPP staining in placental tissues. (B) Immunoblotting of ALPP in protein lysates from placental, lung, breast, and heart tissues. (C) Representative IHC sections of ALPP in various normal tissues.

[0023] Figures 15A - 15C - EGFR inhibitors upregulate ALPP expression. A) ALPP levels in an East Asian LUAD cohort with WT or driver mutations in EGFR. B) qPCR of ALPP mRNA levels in HCC827 and PC9 cells treated with vehicle control or gefitinib (30 nM) for 48 hours. C) ALPP expression in LUAD cell lines treated with gefitinib or osimertinib. Gene expression data were obtained from the Gene Expression Omnibus (GSE80802, GSE75602, GSE193258). Figures 16A - 16C - FoxO3a is a transcriptional regulator of ALPP. (A) mRNA levels of FOXO1 and FOXO3A in HCC827 and H650 cell lines. Data were obtained from CCLE. (B) mRNA levels of FOXO3A in LUAD cells treated with or without gefitinib. (C) IPA upstream analysis of LUAD cell lines treated with osimertinib. RNAseq data were obtained from the Gene Expression Omnibus (GSE193258).

[0024] Figures 17A - 17B - FoxO3a is a transcriptional regulator of ALPP. (A) Potential FoxO3a binding sites (yellow) in the ALPP promoter region (2 kb upstream of the ALPP gene). (B) ChIP-qPCR assay of the promoter region of the ALPP gene in HCC827 and H1650 LUAD cells treated with vehicle or gefitinib (1 μM) for 6 hours.

[0025] Figures 18A - 18C - EGFR TKIs are required for maintaining transient and reversible upregulation of ALPP. (A) mRNA levels of ALPP in HCC2935 and H1975 osimertinib-tolerant cells. Data were obtained from the Gene Expression Omnibus (GSE193258). (B) IC50 of gefitinib and osimertinib in HCC827 and PC9 cells. (C) IC 50 of gefitinib in gefitinib-resistant HCC827 and PC9 cells. 50 Figure 19A – Figure B - EGFR TKI plus ALPP-ADC modality enhances in vitro cancer cell killing efficacy. (A) From Figure 11A ​Bright-field images and crystal violet staining of cells. (B) Bright-field and crystal violet staining images of HCC827 and PC9 cells treated with an EGFR inhibitor (100 nM) in combination with IgG-MMAF or α-ALPP-MMAF (5 μg / ml) for 2 days and then cultured for an additional 18 days in the presence of an EGFR TKI (100 nM). Figure 20 - IHC analysis of ALPP in normal tissues of tumor-bearing mice after gefitinib treatment. Detailed implementation methods

[0026] Methods for treating cancer in a patient in need thereof, the cancer co-expressing one or more placental alkaline phosphatase (ALPP) proteins and a cancer target antigen, the methods comprising administering to the patient a treatment regimen, wherein the treatment regimen comprises administering one or more standard care inhibitors or anti-proliferative agents that increase the cell surface expression of the one or more ALPP proteins and one or more ALPP protein targeting agents. Also provided are methods for selecting a patient having cancer that co-expresses one or more placental alkaline phosphatase (ALPP) proteins and a cancer target antigen, the methods comprising: determining the baseline cell surface expression level of the one or more ALPP proteins in a biological sample obtained from the patient; and determining the co-expression of one or more cancer cell surface oncogenic drivers.

[0027] Also provided is a method of treating cancer in a patient in need thereof, the cancer carrying an EGFR activating mutation, the method comprising administering to the patient, in combination with an EGFR inhibitor, an antibody-drug conjugate that targets ALPP and / or ALPP2 in cells. Also provided is a method for treating cancer in a patient in need thereof, the cancer carrying an EGFR activating mutation, the method comprising: identifying the EGFR activating mutation in cells from a biological sample obtained from the patient; detecting and / or quantifying cell surface expression of placental alkaline phosphatase (ALPP) and / or ALPP2 in the cells; administering, in combination with an EGFR inhibitor, an antibody-drug conjugate therapy that targets ALPP and / or ALPP2 in cancer cells. Also provided is a method for treating drug-tolerant or drug-resistant cancer cells in a patient in need thereof, the method comprising: identifying the EGFR activating mutation in cells from a biological sample obtained from the patient; detecting and / or quantifying cell surface expression of ALPP and / or ALPP2 in the cells; administering, in combination with an EGFR inhibitor, an antibody-drug conjugate therapy that targets ALPP and / or ALPP2 in the cancer cells. Also provided is a method for preventing the emergence of resistance of cancer cells to an EGFR inhibitor, the method comprising administering, in combination with the EGFR inhibitor, an antibody-drug conjugate therapy that targets ALPP and / or ALPP2 in the cancer cells. Also provided is a method for treating cancer in a patient in need thereof, the cancer carrying an EGFR activating mutation, the method comprising: administering an antibody-drug conjugate that targets ALPP and / or ALPP2 on the surface of cancer cells; wherein the cancer cells exhibit increased expression of ALPP and / or ALPP2 relative to healthy lung cells; wherein the antibody-drug conjugate that targets ALPP and / or ALPP2 comprises an antibody that targets ALPP and / or ALPP2 conjugated to MMAF; wherein the cancer cells comprise an activating mutation in the EGFR gene, resulting in resistance to an EGFR tyrosine kinase inhibitor.

[0028] In some embodiments, the cells comprise increased cell surface expression of ALPP and / or ALPP2 relative to healthy cells.

[0029] In some embodiments, the EGFR mutation comprises an exon 19 deletion, a T790M point mutation, and / or an L858R point mutation.

[0030] In some embodiments, cancer having an EGFR mutation is resistant to an inhibitor that targets EGFR.

[0031] In some embodiments, the cancer cells are drug-tolerant persister cells (DTPCs) or drug-resistant cells (DRCs).

[0032] In some embodiments, administering antibody-drug conjugate therapy targeting ALPP and / or ALPP2 in cancer cells and an EGFR inhibitor prevents drug-tolerant persister cells (DTPC) from developing into drug-resistant cells (DRC).

[0033] In some embodiments, the method treats drug-tolerant persister cells (DTPC) and drug-resistant cells (DRC) to prevent resistance to an EGFR inhibitor from occurring.

[0034] In some embodiments, cancers that co-express alkaline phosphatase (ALPP) and / or ALPP2 protein are ovarian cancer, breast cancer, cervical cancer, endometrial cancer, pancreatic cancer, gastric cancer, colorectal cancer, lung cancer, urothelial cancer, brain cancer, testicular cancer, seminoma, and mesothelioma.

[0035] In some embodiments, cancers that co-express alkaline phosphatase (ALPP) and / or ALPP2 protein are testicular germ cell tumors, endometrial carcinoma of the uterine corpus, pancreatic adenocarcinoma, pancreatic ductal adenocarcinoma, urothelial carcinoma of the bladder, triple-negative breast cancer, gastric adenocarcinoma, esophageal cancer, carcinosarcoma of the uterus, rectal adenocarcinoma, head and neck squamous cell carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, colon adenocarcinoma, mesothelioma, and acute myeloid leukemia.

[0036] In some embodiments, the lung cancer is non-small cell lung cancer.

[0037] In some embodiments, detecting and / or quantifying the cell surface expression of placental alkaline phosphatase (ALPP) and / or ALPP2 in cancer cells includes histological analysis, immunohistochemical (IHC) staining of ALPP protein, blood-based tests, tissue-based tests, or imaging techniques.

[0038] In some embodiments, tissue-based tests include tissue biopsy, flow cytometry, immunohistochemistry (IHC), western blotting (WB), polymerase chain reaction (PCR), or immunofluorescence (IF).

[0039] In some embodiments, tissue-based tests include testing or Oncotype testing.

[0040] In some embodiments, blood-based tests include circulating tumor cell (CTC) testing, complete blood count (CBC), or tests or assays for measuring circulating proteins, autoantibodies, cell-free circulating DNA, or extracellular vesicle-derived proteins.

[0041] In some embodiments, tissue biopsies are analyzed by hematoxylin and eosin (H&E) staining and / or microscopy.

[0042] In some embodiments, the antibody-drug conjugate comprises an antibody targeting ALPP conjugated to a chemotherapeutic agent.

[0043] In some embodiments, the EGFR inhibitor comprises a tyrosine kinase inhibitor (TKI).

[0044] In some embodiments, the antibody-drug conjugate therapy targeting ALPP and / or ALPP2 is administered in combination with an EGFR inhibitor.

[0045] In some embodiments, the EGFR inhibitor is selected from gefitinib, osimertinib, mobocertinib, amivantamab, CLN081, and / or DZD9008.

[0046] In some embodiments, the antibody-drug conjugate comprises SGN-ALPV, Zynlonta TM , and

[0047] In some embodiments, the antibody-drug conjugate therapy targeting ALPP and / or ALPP2 in cancer cells and the EGFR inhibitor are administered simultaneously.

[0048] In some embodiments, the antibody-drug conjugate therapy targeting ALPP and / or ALPP2 in cancer cells and the EGFR inhibitor are administered sequentially.

[0049] Placental alkaline phosphatase (ALPP) is a membrane-bound glycosylated dimeric enzyme that was first detected in serum during pregnancy and has been shown to originate from the placenta. There are four different isoforms of alkaline phosphatase, placental (ALPP), placental type 2 (ALPP2), intestinal ALPP (ALPI), and tissue-nonspecific ALPP (ALPL). Among these four isoforms, ALPP and ALPP2 have been found to be associated with a large number of human cancers, such as testicular seminoma, ovarian cancer, and endometrial cancer. Except for placental trophoblast cells, the expression of ALPP / ALPP2 on normal tissues is virtually absent, which provides an excellent opportunity for the development of therapies that require a high degree of tumor specificity. Antibodies against ALPP and / or ALPP2 can be conjugated to other classes of drugs, such as DNA cross-linking agents or radionuclides (e.g., alpha particles).

[0050] Many features of ALPP and / or ALPP2 make it an attractive candidate for antigen-targeted immunotherapy: (1) ALPP is a membrane-bound protein and thus an accessible cell surface target for specific binding molecules such as antibodies. (2) ALPP is expressed at low levels in healthy tissues but is increased in malignant tumors, suggesting that it may serve as a tumor-specific antigen with low expression outside the tumor. (3) Alkaline phosphatase activity has been reported to induce tumor progression in different cancers such as prostate cancer, head and neck squamous cell carcinoma, and ovarian cancer. Thus, targeting ALPP as a cancer therapy target can also enhance tumor control by reducing tumor-derived alkaline phosphatase activity.

[0051] As described herein, increased or elevated cell surface expression of ALPP and / or ALPP2 in many cancer types provides new opportunities for treating these cancers. For those cancers in which the expression of ALPP and / or ALPP2 is elevated, these proteins can not only serve as cancer therapy targets themselves, but additionally, the expression of ALPP and / or ALPP2 can occur in combination with the expression of activating mutations (e.g., EGFR activating mutations) or oncogenic driver mutations (i.e., genes involved in initiating or maintaining cancer). Such genes can be EGFR or another gene disclosed herein. Increased or enhanced expression of ALPP and / or ALPP2 can also occur in combination with genes involved in initiating or maintaining cancer (e.g., oncogenic driver mutations). The expression of ALPP and / or ALPP2 can be evaluated by detecting and / or quantifying the cell surface expression levels of ALPP and / or ALPP2. The baseline expression of ALPP and / or ALPP2 can provide useful information related to disease severity and the prognosis of individual cancer treatments. Evaluating the baseline cell surface expression levels of ALPP and / or ALPP2 will determine whether there is an elevation of ALPP / ALPP2 in the cancer, which can serve as a useful first step in determining treatment for a specific cancer. In some embodiments, increased cell surface expression of ALPP and / or ALPP2 increases the susceptibility of cancer cells to therapies directed against ALPP and / or ALPP2. As described herein, the methods of the present disclosure are capable of preventing the emergence of resistance of cancer cells (such as NSCLC cells) to drug therapies.

[0052] Thus, in some embodiments, the methods described herein for treating cancers that express elevated levels of ALPP / ALPP2 can initially utilize the step of determining the baseline levels of ALPP and / or ALPP2 prior to initiating treatment of the cancer. For cancers that are found to express elevated levels of ALPP and / or ALPP2, standard-of-care inhibitors or anti-proliferative agents that target ALPP and / or ALPP2 can be administered to treat the cancer.

[0053] In some embodiments, a standard of care inhibitor or an anti-proliferative agent can be administered to an individual with cancer in order to enhance the expression of ALPP and / or ALPP2 on the surface of cancer cells. In such cases, the purpose of administering the standard of care inhibitor or anti-proliferative agent is to increase the expression of ALPP and / or ALPP2 on the cell surface prior to administering an ALPP / ALPP2 protein targeting agent to treat cancer. This “two-hit” approach increases the expression of the target itself in order to increase the susceptibility of cancer cells to therapies directed against ALPP and / or ALPP2.

[0054] Accordingly, in some embodiments, measuring the baseline levels of ALPP and / or ALPP2 proteins on the cell surface of cancer cells can enable the determination of an appropriate treatment plan for the cancer. Methods for determining baseline cell surface expression levels are well known in the art and can include, but are not limited to, histological analysis, immunohistochemical (IHC) staining of the ALPP protein, electron microscopy, mass spectrometry, immunofluorescence, blood-based tests, tissue-based tests, or imaging techniques. In some embodiments, detecting and / or quantifying placental alkaline phosphatase (ALPP) and / or ALPP2 cell surface expression (i.e., the baseline value) in cancer cells includes histological analysis, immunohistochemical (IHC) staining of the ALPP protein, blood-based tests, tissue-based tests, or imaging techniques. Any method capable of determining the levels of ALPP and / or ALPP2 in a biological sample from an individual can be employed, and these methods are intended to be encompassed within the scope of the present disclosure.

[0055] Blood-based tests can be any blood-based test known or available in the art, such as tests, circulating tumor cell (CTC) tests, complete blood count (CBC), or tests or assays for measuring circulating proteins, autoantibodies, cell-free circulating DNA, or extracellular vesicle-derived proteins. In some embodiments, blood-based assays or tests for detecting the expression or levels of ALPP and / or ALPP2 can include the use of labeled ligands or antibodies.

[0056] The tissue-based tests described herein can be any tissue-based test known or available in the art, such as tissue biopsy, flow cytometry, immunohistochemistry (IHC), western blotting (WB), polymerase chain reaction (PCR), or immunofluorescence (IF). Such tests can utilize specific protein markers or reagents (e.g., stains), and can detect and quantify the amount of ALPP and / or ALPP2 proteins present in a biological sample using, for example, antibodies or any other specific method for determining the cell surface expression of ALPP and / or ALPP2. For example, specific tissue-based tests known in the art include, but are not limited to Testing, Signatara TM testing, the Altera Tumor Genome Atlas test, or Oncotype testing. In some embodiments, the tissue-based testing includes testing or Oncotype testing.

[0057] A biological sample suitable for the methods described herein can be any biological sample, e.g., a blood sample or a tissue biopsy or a cell culture sample. Depending on the cancer type, certain biological samples may be more advantageous, e.g., a tissue biopsy for solid cancers or a blood-based sample for blood cancers, however any biological sample can be used for the methods described herein.

[0058] In some embodiments, the tissue biopsy is analyzed by hematoxylin and eosin (H&E) staining and / or microscopy.

[0059] Oncogenic drivers and activating mutations (e.g., EGFR activating mutations) are well known in the art and can include any gene responsible for initiating or maintaining cancer. As described herein, cell surface oncogenic drivers are useful cancer target antigens. Targeting of oncogenic drivers as cancer target antigens can be combined with targeting of ALPP and / or ALPP2, or can be separate. In some embodiments, ALPP and / or ALPP2 can be targeted sequentially with an activating mutation or an oncogenic driver mutation (e.g., an EGFR activating mutation) for treatment, or can be targeted simultaneously in the treatments disclosed herein, meaning that the antibody-drug conjugate therapies targeting ALPP and / or ALPP2 described herein are administered together with or simultaneously with the EGFR activating mutations described herein. In some embodiments, the activating mutation or oncogenic driver mutation (e.g., an EGFR activating mutation and / or a cell surface oncogenic driver) is directly targeted by an inhibitor molecule or directly targeted by the chemotherapy treatments described herein. In some embodiments, any cancer therapy described herein (alone or in combination with ALPP and / or ALPP2) can be used to target an activating mutation, e.g., an EGFR activating mutation or an oncogenic driver mutation. In some embodiments, ALPP and / or ALPP2 are targeted using the antibody-drug conjugates described herein, and the EGFR activating mutation is targeted using an EGFR inhibitor therapeutic agent. These therapeutic agents can be administered simultaneously, or can be administered sequentially. Oncogenic drivers that can be used to treat cancer can be genes and / or their encoded proteins involved in a particular type of cancer, e.g., BRCA1 / 2 in breast cancer. Some oncogenic driver genes have been found to be mutated in many different cancers, while other oncogenic driver genes are specific to one or a few cancer types.

[0060] Some common oncogenic drivers that may be useful as described herein (i.e., oncogenic drivers that may have mutations that cause or contribute to the initiation or maintenance of cancer as described herein) include, but are not limited to, ALK, ARID1A, BRAF, BRCA1 / 2, CD22, CD40, CD46, CD74, CDKN2A, DDR1, EFNB2, EGFR, EML4, ENG, EPHA2, EPHB2, EPHB4, ERBB1, ERBB2, ERBB3, FAS, FGFR1, FGFR2, HER2, HRAS, ICAM1, IGF1R, INSR, ITGA4, ITGAV, ITGB1, ITGB3, JAK, KRAS, MAPK, MAP2K1, MEK, MET, MICB, MST1R, MYC, NF1, NGFR, NRAS, NRP1, NTRK1, PIK3CA, PTEN, PTK7, RAF, RAS, RET, ROR1, ROS1, SEMA4D, STAT, TNFRSF10A, TNFRSF10B, TSC1 / 2, TP53, UMD, TYRO3, YAP1, and / or YAP2. TP53 is associated with more than 25 different cancer types, while many other oncogenic driver genes (e.g., PIK3CA, KRAS, PTEN, ARID1A) are associated with 15 or more different cancer types. In some embodiments, one or more of the above oncogenic driver genes may have mutations that cause or contribute to the initiation or maintenance of cancer as described herein.

[0061] In some embodiments, the cancer target antigen is a cell surface oncogenic driver.

[0062] In some embodiments, the cancer target antigen includes one or more of CD22, CD40, CD46, CD74, DDR1, EFNB2, ENG, EPHA2, EPHB2, EPHB4, ERBB3, FAS, FGFR2, ICAM1, IGF1R, INSR, ITGA4, ITGAV, ITGB1, ITGB3, MET, MICB, MST1R, NGFR, NRP1, PTK7, RET, ROR1, SEMA4D, TNFRSF10A, TNFRSF10B, TYRO3, YAP1, and / or YAP2.

[0063] In some embodiments, the cell surface oncogenic driver is directly targeted by an inhibitor molecule.

[0064] The specific oncogenic driver to be targeted can be selected by a practicing physician or clinician for personalized treatment of a specific cancer type. This disclosure is not intended to be limited to the list of oncogenic driver genes / proteins described herein, but rather to illustrate methods of treatment for cancers expressing ALPP and / or ALPP2 as described herein.

[0065] The most common way to classify cancers is to divide them into 4 categories based on whether the cancer is surgically removable and the location where the cancer has spread: resectable cancer, marginally resectable cancer, locally advanced cancer, or metastatic cancer. Resectable cancer can be removed by surgery. The cancerous tumor may be located only in a specific area or organ, or extend beyond that area or organ, but has not grown into the major arteries or veins in that area. There is no evidence that the tumor has spread to areas outside of that region. Marginally resectable describes a tumor that may be difficult or impossible to remove surgically at the time of initial diagnosis, but may be possible to remove with negative margins later if chemotherapy and / or radiation therapy can first shrink the tumor. Negative margins mean that no visible cancer cells remain. Locally advanced cancer is still only located in the adjacent area around the tumor, but it cannot be removed surgically because it has grown into adjacent arteries or veins or adjacent organs. However, there is no indication that it has spread to any distant part of the body. Metastatic means that the cancer has spread beyond the tumor area and spread to other organs, such as distant areas of the liver or abdomen.

[0066] Options for treating cancer have been established in the literature and can include surgery for partial or complete surgical removal of cancerous tissue, or can involve the administration of one or more of the cancer therapies described herein (e.g., chemotherapy drugs, immunotherapy drugs, antibody-drug conjugates, therapeutic radiation, etc.).

[0067] Chemotherapy drugs approved for the treatment of cancer are numerous and well known in the art. Many of these drugs are described herein, however it should be noted that this disclosure is not limited to the cancer types or drugs described herein. Those skilled in the art will understand that this disclosure can extend to any suitable cancer type and any chemotherapy drug or treatment. For example, any cancer type expressing ALPP and / or ALPP2, or having an increased cell surface level of ALPP and / or ALPP2, is within the scope of this method.

[0068] For example, techniques that can be used to determine the cell surface expression of ALPP and / or ALPP2, such as detecting and / or quantifying ALPP and / or ALPP2 cell surface expression, can include staining techniques, immunohistochemistry, cell viability assays, microscopy, phosphatase assays, flow cytometry, cell surface biotinylation, proton or chymotrypsin sensitivity assays, antibody labeling assays, ELISA, radioligand binding, cAMP enzyme immunoassay, bioluminescence resonance energy transfer (BRET), CREB phosphorylation assay, live cell staining, imaging, or any other technique known or available in the art. Staining techniques are known in the art and can involve any stain suitable for measuring proteins, such as fluorophore dyes, such as fluorescein-5-isothiocyanate (5-FITC) or fluorescein-5-isothiocyanate (6-FITC), Alexa Fluor 488, Alexa Fluor 647, carboxyfluorescein diacetate (CFSE), R-phycoerythrin (PE), PE-Texas Red, propidium iodide (PI), PE-Cy5, PerCP, PerCP-Cy5.5, PE-Cy7, allophycocyanin (APC), green fluorescent protein (GFP), hematoxylin and eosin (H&E), or any other cell staining technique or dye known or available in the art.

[0069] In some embodiments, any cancer type that exhibits the expression of ALPP and / or ALPP2 or exhibits an increase in the expression of ALPP and / or ALPP2 can be treated according to the methods described herein. In some embodiments, depending on the cancer type, the expression of ALPP and / or ALPP2 can be increased to a statistically significant degree or level, or can be increased by different magnitudes. Non-limiting examples of cancer types suitable for treatment as described herein include ovarian cancer, breast cancer, endometrial cancer, pancreatic cancer, gastric cancer, colorectal cancer, lung cancer, urothelial cancer, brain cancer, testicular cancer, seminoma, and mesothelioma. Some specific types of cancer can include, but are not limited to, testicular germ cell tumors, uterine corpus endometrial cancer, pancreatic adenocarcinoma, pancreatic ductal adenocarcinoma, bladder urothelial cancer, triple negative breast cancer, gastric adenocarcinoma, esophageal cancer, uterine carcinosarcoma, rectal adenocarcinoma, head and neck squamous cell carcinoma, non-small cell lung cancer, colon adenocarcinoma, mesothelioma, and acute myeloid leukemia.

[0070] In some embodiments, cancers that co-express one or more placental alkaline phosphatase (ALPP) proteins and a cancer target antigen include testicular cancer, ovarian cancer, breast cancer, endometrial cancer, pancreatic cancer, gastric cancer, colorectal cancer, lung cancer, urothelial cancer, brain cancer, testicular cancer, seminoma, or mesothelioma.

[0071] In some embodiments, the lung cancer is non-small cell lung cancer.

[0072] The present disclosure provides methods of treating cancers that are expressed at elevated levels of ALPP and / or ALPP2. The present disclosure also provides a method of treating cancer in a patient in need thereof, the cancer co-expressing one or more placental alkaline phosphatase (ALPP) proteins and a cancer target antigen, the method comprising administering to the patient a treatment regimen, wherein the treatment regimen comprises administering one or more standard-of-care inhibitors or anti-proliferative agents that increase the cell surface expression of the one or more ALPP proteins, and one or more ALPP protein targeting agents. In some embodiments, prior to administering the treatment regimen, the method further comprises determining the baseline cell surface expression level of the one or more ALPP proteins and the co-expression of one or more cancer cell surface oncogenic drivers in a biological sample obtained from the patient. In some embodiments, the method comprises administering a treatment regimen, e.g., one or more standard-of-care inhibitors or anti-proliferative agents, to increase the cell surface expression of ALPP and / or ALPP2 in cancer cells, thereby making the cancer cells more susceptible to one or more ALPP protein targeting agents.

[0073] In some embodiments, the present disclosure also provides a method of selecting a patient having cancer that co-expresses one or more placental alkaline phosphatase (ALPP) proteins and a cancer target antigen, the method comprising: determining the baseline cell surface expression level of the one or more ALPP proteins in a biological sample obtained from the patient; and determining the co-expression of one or more cancer cell surface oncogenic drivers.

[0074] Chemotherapy is widely used as a standard-of-care treatment for cancer and acts to destroy cancer cells and prevent them from growing, dividing, and producing more cancer cells. Some chemotherapy drugs work by damaging DNA and preventing cell replication, which causes cancer cells to die. Since cancer cells typically grow and divide faster than normal non-cancer cells, these chemotherapy drugs have a greater effect on those actively dividing cancer cells.

[0075] As described herein, the treatment regimen that can be used to increase the cell surface expression of ALPP and / or ALPP2 can be any standard-of-care inhibitor or anti-proliferative agent and includes any chemotherapy drug known in the art for treating cancer, such as, including but not limited to Evista (raloxifene hydrochloride), bleomycin, ifosfamide Raloxifene Hydrochloride, Soltamox (Tamoxifen Citrate), Tamoxifen Citrate, Abemaciclib, Albumin bound Paclitaxel (Abraxane) (Paclitaxel Albumin-stabilized Nanoparticle Formulation), Ado-Trastuzumab Emtansine, Afinitor (Everolimus), Afinitor Disperz (Everolimus), Alkeran (Melphan), Alpelisib, Altretamine Anastrozole, Aredia (Pamidronate Disodium), Arimidex (Anastrozole), Aromasin (Exemestane), Atezolizumab, Avastin (Bevacizumab), Bevacizumab (Avastin), Capecitabine Carboplatin, Cisplatin, Cyclophosphamide Docetaxel Doxorubicin Hydrochloride, Doxil (Doxorubicin Hydrochloride Liposome), Ellence (Epirubicin Hydrochloride) (Fam-Trastuzumab Deruxtecan-nxki), Epirubicin Hydrochloride, Eribulin Mesylate, Etoposide (VP-16, Vepesid), Everolimus, Exemestane, 5-FU (Fluorouracil Injection), Fam-Trastuzumab Deruxtecan-nxki, Fareston (Toremifene), Faslodex (Fulvestrant), Femara (Letrozole), Fluorouracil Injection, Fulvestrant, Gemcitabine Hydrochloride (Gemcitabine Hydrochloride), Goserelin Acetate, Halaven (Eribulin Mesylate), Herceptin Hylecta (Herceptin Hylecta) (Trastuzumab and Hyaluronidase-oysk), Herceptin (Trastuzumab), Hycamtin (Topotecan Hydrochloride), Ibrance (Palbociclib), Infugem (Gemcitabine Hydrochloride), Irinotecan (CPT-11 ), Ixabepilone, Ixempra (Ixabepilone) Trastuzumab emtansine, Keytruda (pembrolizumab), Kisqali (ribociclib), lapatinib ditosylate, letrozole, liposomal doxorubicin Lynparza (olaparib), Margenza (margetuximab-cmkb), margetuximab, megestrol acetate, melphalan, methotrexate sodium, mitomycin, neratinib maleate, Nerlynx (neratinib maleate), niraparib tosylate monohydrate, olaparib, doxorubicin Oxaliplatin, paclitaxel Paclitaxel albumin-stabilized nanoparticle formulation, palbociclib, pamidronate disodium, pembrolizumab, pemetrexed Perjeta (pertuzumab), pertuzumab, pertuzumab, Rubraca (rucaparib camphorsulfonate), trastuzumab and hyaluronidase, Phesgo (pertuzumab, trastuzumab and hyaluronidase), Piqray (alpelisib), ribociclib, sacituzumab govitecan-hziy, tamoxifen citrate, talazoparib tosylate, Talzenna (talazoparib tosylate), tamoxifen citrate, Taxol, Taxotere (docetaxel), Tecentriq (atezolizumab), Tepadina (thiotepa), thiotepa, topotecan hydrochloride, toremifene, trastuzumab Trastuzumab and hyaluronidase, Trexall (methotrexate sodium) (Sacituzumab govitecan), tucatinib, Tukysa (tucatinib), Tykerb (lapatinib ditosylate), Venclexta (venetoclax), Verzenio (abemaciclib), vinblastine sulfate, Xeloda (capecitabine), vinorelbine Zejula (niraparib tosylate monohydrate), Zoladex (goserelin acetate). As those skilled in the art will appreciate, certain cancers benefit from certain chemotherapy drugs or combinations thereof, and thus the individual treatment plan for a particular cancer may be altered as appropriate by a clinician or practicing physician.

[0076] In some embodiments, one or more standard-of-care inhibitors or anti-proliferative agents that increase the cell surface expression of ALPP and / or ALPP2 are combined together in a combination therapy. The combination therapy can include any combination of cancer treatments that a clinician or medical practitioner deems appropriate. For example, cancer treatment options that can be used in the methods of the present invention include one or more of chemotherapy drugs, radiation therapy, immunotherapy drugs, DNA cross-linking agents, antibody-drug conjugates, hormone therapy, targeted drug therapy, radionuclides, cryoablation therapy, surgery, and the like.

[0077] In some embodiments, one or more standard-of-care inhibitors or anti-proliferative agents are selected from trastuzumab cisplatin, etoposide (VP-16), bleomycin, ifosfamide paclitaxel carboplatin, vinblastine, doxorubicin liposomal doxorubicin docetaxel albumin-bound paclitaxel (nab-paclitaxel, )、altretamine capecitabine cyclophosphamide gemcitabine irinotecan (CPT-11, )、melphalan, pemetrexed topotecan, vinorelbine 5-fluorouracil (5-FU), irinotecan (Camptosar), bevacizumab (Avastin), mitomycin, epirubicin, and oxaliplatin, and combinations thereof.

[0078] Combination therapies known in the art include, but are not limited to, one or more standard-of-care inhibitors or anti-proliferative agents, which include the combination of bleomycin, etoposide, and cisplatin; or the combination of etoposide and cisplatin; the combination of VP-16 (etoposide) or vinblastine plus ifosfamide and cisplatin; the combination of carboplatin and paclitaxel; the combination of cisplatin and doxorubicin; the combination of carboplatin and docetaxel; the combination of cisplatin with paclitaxel and doxorubicin; ifosfamide in combination with cisplatin; ifosfamide in combination with paclitaxel; the combination of trifluridine and tipiracil (Lonsurf); the combination of oxaliplatin and 5-FU / leucovorin (FOLFOX); the combination of oxaliplatin and capecitabine (CAPOX); the combination of 5-FU / leucovorin, oxaliplatin, and docetaxel; the combination of docetaxel or paclitaxel with 5-FU or capecitabine; the combination of cisplatin with 5-FU or capecitabine; or the combination of paclitaxel and carboplatin.

[0079] In some embodiments, the antibody-drug conjugates can be used to treat cancers that overexpress ALPP and / or ALPP2 as described herein. In some embodiments, the antibody-drug conjugates specifically target ALPP and / or ALPP2. The antibody-drug conjugates consist of three main components: an antibody drug specific for a specific cancer protein, a cytotoxic chemotherapy drug, and a linker protein connecting the two. In some embodiments, the antibody-drug conjugates useful according to the present disclosure comprise an antibody targeting ALPP and / or ALPP2 conjugated to a chemotherapy drug. Any chemotherapy drug disclosed herein can be used in an antibody-drug conjugate. Usually administered intravenously, the antibody portion targets a specific cancer protein and is taken up by cancer cells, where the cytotoxic cancer drug is released and kills the cancer cells. Many antibody-drug conjugates are known in the art. One example is SGN-ALPV, a novel investigational vedotin antibody-drug conjugate consisting of a humanized anti-ALPP / ALPPL2 monoclonal antibody, a protease-cleavable linker, and a microtubule-destroying agent monomethyl auristatin E (MMAE). SGN-ALPV is in Phase I clinical trials in patients with solid tumors such as ovarian tumors, endometrial tumors, non-small cell lung cancer, cervical tumors, and testicular tumors. Other useful antibody-drug conjugates include: It is used to treat cervical cancer; Brentuximab vedotin It is used to treat relapsed Hodgkin lymphoma and systemic anaplastic large cell lymphoma, both of which show high expression of CD30; Gemtuzumab ozogamicin It targets the CD33 receptor found on certain types of myeloid cells and is approved for relapsed acute myeloid leukemia; Inotuzumab ozogamicin It targets the CD22 receptor and is approved for relapsed B-cell precursor acute lymphoblastic leukemia; Polotuzumab vedotin-piiq It targets the CD79b receptor and is approved for use in combination with certain chemotherapy regimens for relapsed diffuse large B-cell lymphoma; and trastuzumab emtansine It targets the ERBB2 protein on the surface of certain breast cancer cells and is approved for the treatment of advanced breast cancer that express this protein. Other antibody-drug conjugates include, but are not limited to Zynlonta TM , and

[0080] In some embodiments, the antibody-drug conjugate includes SGN-ALPV, Zynlonta TM , and Those skilled in the art will understand that, in accordance with this disclosure, any suitable antibody-drug conjugate will be useful, and thus, other antibody-drug conjugates known or available in the art may be useful as described herein.

[0081] As described herein, the methods of the present disclosure can be used to treat non-small cell lung cancer (NSCLC) in a patient, wherein the cancer cells exhibit an EGFR activating mutation. The treatment of NSCLC is known in the art and many drug regimens are available. In the present disclosure, the administration of an antibody-drug conjugate targeting ALPP and / or ALPP2 can be used in combination with an EGFR inhibitor to treat NSCLC. As described in the examples herein, such combination therapy can result in an increased or enhanced (i.e., favorable) response of the cancer cells to the treatment when compared to the administration of the antibody-drug conjugate or the EGFR inhibitor alone.

[0082] The identification of an EGFR activating mutation can be accomplished by any technique known and available in the art and can include, but is not limited to, DNA sequencing, proteomic analysis, staining techniques, immunohistochemistry, etc.

[0083] Epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) therapy is considered the standard treatment for lung cancer carrying an EGFR activating mutation, but has limited performance. EGFR inhibitors are known and available in the art and can include, but are not limited to, gefitinib, osimertinib, mobocertinib, amivantamab, CLN081, and / or DZD9008. Other EGFR inhibitors can be used when a clinician or practitioner deems appropriate. In some embodiments, the EGFR inhibitor can be a tyrosine kinase inhibitor (TKI).

[0084] In some embodiments, certain drugs described herein and known in the art, or combinations of drugs or compounds, can be used to treat specific types of cancer that overexpress ALPP and / or ALPP2 (alone or in combination with a cancer target antigen). For example, in some embodiments, testicular cancer can be treated with cisplatin, etoposide (VP-16), bleomycin, ifosfamide paclitaxel and / or vinblastine. In some embodiments, a combination of bleomycin, etoposide, and cisplatin, as well as a combination of etoposide and cisplatin, or a combination of VP-16 (etoposide) or vinblastine with ifosfamide and cisplatin, can also be used to treat testicular cancer.

[0085] In some embodiments, endometrial cancer can be treated with paclitaxel carboplatin, doxorubicin or liposomal doxorubicin cisplatin or docetaxel Common combination therapies for endometrial cancer include, but are not limited to, carboplatin and paclitaxel, cisplatin and doxorubicin, carboplatin and docetaxel, and cisplatin, paclitaxel, and doxorubicin may be useful.

[0086] For cancer, ifosfamide is usually used alone or in combination with cisplatin or paclitaxel. For HER2-positive cancers, trastuzumab can be added

[0087] For ovarian cancer, a combination of platinum drugs (usually cisplatin or carboplatin) and taxanes (e.g., paclitaxel or docetaxel ). Other drugs that can be used to treat ovarian cancer include, but are not limited to, albumin-bound paclitaxel (nab-Paclitaxel, ), altretamine capecitabine cyclophosphamide etoposide (VP-16), gemcitabine ifosfamide irinotecan (CPT-11, ), liposomal doxorubicin melphalan, pemetrexed topotecan and vinorelbine

[0088] Cervical cancer can be treated with a combination of chemotherapy drugs and radiation (referred to herein as concurrent chemoradiation). In some embodiments, cisplatin or carboplatin can be administered once a week during radiation therapy, or cisplatin can be combined with 5-fluorouracil (5-FU) and administered once every 3 weeks during radiation. For recurrent cervical cancer, a combination of cisplatin, carboplatin, paclitaxel topotecan, docetaxel (Taxotere), ifosfamide (Ifex), 5-fluorouracil (5-FU), irinotecan (Camptosar), gemcitabine (Gemzar), and mitomycin can be used. In some embodiments, in addition to chemotherapy treatment, targeted drug therapy, such as bevacizumab (Avastin), can be added.

[0089] For gastric cancer that can be treated with many chemotherapy drugs such as 5-FU (fluorouracil), these chemotherapy drugs are usually administered together with leucovorin (folinic acid), capecitabine, carboplatin, cisplatin, docetaxel, epirubicin, irinotecan, oxaliplatin, paclitaxel or trifluridine and tipiracil (Lonsurf), which is a combination drug in pill form. For early-stage cancer, some common drug combinations that can be used before and / or after surgery include, but are not limited to, oxaliplatin and 5-FU / leucovorin (FOLFOX), oxaliplatin plus capecitabine (CAPOX), 5-FU / leucovorin, oxaliplatin and docetaxel, docetaxel or paclitaxel combined with 5-FU or capecitabine, cisplatin combined with 5-FU or capecitabine, or paclitaxel and carboplatin. For cases where chemotherapy and radiotherapy are administered simultaneously after surgery, single drugs such as 5-FU or capecitabine can be used. In some embodiments, for advanced gastric cancer, many of the same drug combinations can be used, but usually a combination of two drugs, rather than three drugs, is used to minimize side effects. Some of the most commonly used combinations include, but are not limited to, oxaliplatin and 5-FU / leucovorin (FOLFOX), oxaliplatin plus capecitabine (CAPOX), cisplatin combined with 5-FU or capecitabine, irinotecan combined with 5-FU / leucovorin (FOLFIRI), paclitaxel combined with cisplatin or carboplatin, docetaxel combined with cisplatin, epirubicin, cisplatin or oxaliplatin and 5-FU or capecitabine, and combinations of docetaxel, 5-FU with cisplatin, carboplatin or oxaliplatin.

[0090] Radionuclide therapy uses radioactive substances called radiopharmaceuticals to treat cancer. The radionuclides are introduced into the body in various ways and localize to specific locations, organs or tissues depending on their properties and route of administration. Radionuclides can be provided in a variety of particle types, including α, β, γ or combinations of these.

[0091] In some embodiments, the radionuclide is an α particle, such as polonium-210, bismuth-213 or uranium-238. In some embodiments, the radionuclide comprises an α particle selected from polonium-210 and uranium-238.

[0092] In some embodiments, the radionuclide is a beta particle, such as strontium-90, thallium-201, carbon-14, and tritium. In some embodiments, the radionuclide is a gamma particle, such as barium-133, cadmium-109, cobalt-57, cobalt-60, europium-152, manganese-54, sodium-22, zinc-65, and technetium-99m. In some embodiments, the radionuclide can be a combination of these particles, such as cesium-137 and americium-241. Any radionuclide known or available in the art can be used according to the methods described herein.

[0093] In some embodiments, a combination of radionuclides can be used, wherein each radionuclide in the combined radionuclides emits radiation of a different wavelength such that each individual radionuclide is separately distinguishable.

[0094] In some embodiments, the pharmaceutical treatments described herein can be administered in a clinical setting or in an alternative setting deemed appropriate by a clinician or practitioner. In some embodiments, one or more standard-of-care inhibitors or anti-proliferative agents that increase the cell surface expression of one or more ALPP proteins, and one or more ALPP protein targeting agents are administered simultaneously or sequentially.

[0095] In some embodiments, one or more ALPP protein targeting agents include antibody-drug conjugates, immunotherapies, DNA cross-linking agents, or radionuclides or combinations thereof.

[0096] Any treatment described herein for treating cancer that expresses ALPP and / or ALPP2 (alone or in combination with a cancer target antigen (e.g., an oncogenic driver as described herein)) can be administered alone or in combination (i.e., by co-administration or sequential administration) with a second drug regimen or other therapeutic treatment or drug for treating cancer (e.g., a chemotherapy or immunotherapy drug or treatment) to a patient in need (e.g., a patient with cancer). In one embodiment, the additional therapeutic treatment or drug is included in a pharmaceutical composition as described herein. In other embodiments, the additional therapeutic treatment or drug is co-administered, administered simultaneously, or administered sequentially in a separate or different composition.

[0097] As will be understood by those skilled in the art, the treatments described herein are administered to a subject in any necessary or useful form for treating cancer, e.g., liquid (e.g., injectable and infusible solutions), semi-solid, solid, aqueous solution, suspension, emulsion, gel, magma, mixture, tincture, powder, capsule, dispersion, tablet, pellet, pill, powder, liposome, lozenge, troche, liniment, ointment, lotion, paste, suppository, spray, inhalant, etc. In some embodiments, the drugs for treating cancer as described herein can be administered in liquid or aqueous form (for injection into a patient), or in the form of pills or tablets (for oral administration). The dosage form of the drugs described herein can depend on the intended mode of administration and therapeutic application. Generally, the dosage form for the drug treatments described herein is in the form of an injectable or infusible solution, or in the form of pills for oral administration.

[0098] In some embodiments, the drugs for treating cancer in a patient as described herein can be administered by any route or mode of administration, such as intraperitoneal, intravenous, oral, sublingual, rectal, vaginal, ocular, otic, nasal, dermal, enteral, epidural, intra-arterial, intravascular, nasal, respiratory, subcutaneous, topical, transdermal, intramuscular, etc. In other embodiments, a second drug regimen, such as a chemotherapy drug regimen, can be in the form of an aqueous solution for intravenous administration.

[0099] Unless otherwise indicated herein, the methods described herein can be carried out according to the procedures illustrated herein or according to conventional practices well known in the art. The following sections provide additional guidance for practicing the methods of the present disclosure.

[0100] In some embodiments, the cancer therapies to be administered to an individual to treat cancer can be provided as a composition. In some embodiments, the methods described herein can involve a composition to be administered as a single composition. In some embodiments, each drug can be administered separately (although still administered concurrently), i.e., in a separate solution or drug form as described herein. Pharmaceutical formulations are well recognized and known in the art.

[0101] In some embodiments, the drug or composition for use in the methods described herein can be formulated with excipient materials such as sodium citrate, disodium hydrogen phosphate heptahydrate, sodium dihydrogen phosphate, Tween-80, and / or stabilizers. The drug or composition for use in the methods described herein can be provided, for example, at a suitable concentration in a buffer solution and can be stored at an appropriate temperature to maintain the efficacy of the drug, such as a temperature of 2°C - 8°C. In some other embodiments, the pH of the composition is between about 5.5 and about 7.5 (e.g., 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, or 7.5).

[0102] The pharmaceutical composition for the method can also include a reagent that reduces drug aggregation upon formulation. Examples of aggregation reducers include one or more amino acids selected from the group consisting of methionine, arginine, lysine, aspartic acid, glycine, and glutamic acid. The pharmaceutical composition can also include sugars (e.g., sucrose, trehalose, mannitol, sorbitol, or xylitol) and / or tonicity modifiers (e.g., sodium chloride, mannitol, or sorbitol) and / or surfactants (e.g., polysorbate-20 or polysorbate-80).

[0103] As described above for the cancer treatment of the present disclosure, the composition used in conjunction with the method can be administered by a parenteral mode (e.g., intravenous, subcutaneous, intraperitoneal, or intramuscular injection). As used herein, the phrases “parenteral administration” and “administered parenterally” mean a mode of administration typically by injection and include, but are not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraocular, intracardiac, intradermal, intraperitoneal, intratracheal, subcutaneous, subepidermal, intraarticular, subcapsular, subarachnoid, intraspinal, epidural, and intrasternal injection and infusion.

[0104] The compositions used with the methods can be formulated into solutions, microemulsions, dispersions, liposomes or other ordered structures suitable for stable storage at high concentrations. Sterile injectable solutions can be prepared by incorporating the required amount of the agent described herein, as needed, into a suitable solvent with one or a combination of the ingredients listed above, followed by filtration sterilization. Generally, dispersions are prepared by incorporating the agent described herein into a sterile vehicle that contains a basic dispersion medium and other required ingredients from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the methods of preparation are vacuum drying and freeze drying, which yield a powder of the agent described herein plus any additional required ingredients from its previously sterile-filtered solution. The proper fluidity of the solution can be maintained, for example, by coating with lecithin and the like, by maintaining the desired particle size in the case of dispersions, and by using surfactants. Prolonged absorption of injectable compositions can be achieved by including agents that delay absorption, such as monostearates and gelatin.

[0105] In certain embodiments, the compositions can be prepared with carriers that will avoid rapid release of the compound, such as controlled release formulations, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Many methods for preparing such formulations are patented or well known. See, for example, Sustained and Controlled Release Drug Delivery Systems, edited by J.R. Robinson, Marcel Dekker, Inc., New York (1978).

[0106] In some embodiments, the compositions are formulated in sterile distilled water or phosphate buffered saline. The pH of the pharmaceutical formulation can be between about 5.5 and about 7.5 (e.g., 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, or 7.5).

[0107] Cancer treatments for treating cancers that express ALPP and / or ALPP2, alone or in combination with a cancer target antigen (e.g., an oncogenic driver as described herein), can be provided in a kit. In one embodiment, the kit comprises (a) a container containing an individual cancer therapy as described herein, and optionally (b) an information material. The information material can be descriptive, instructional, marketing, or other material related to the methods and / or use of the agents described herein to achieve a therapeutic benefit.

[0108] In some embodiments, the kit further comprises a second agent (e.g., a chemotherapy or immunotherapy drug as described herein) for treating the cancers described herein. For example, the kit comprises a first container containing a standard-of-care inhibitor or anti-proliferative agent and a second container containing a second drug regimen (e.g., a chemotherapy or immunotherapy drug or drug combination).

[0109] The form of the information material of the kit is not limited. In one embodiment, the information material can contain information about the production of the compound, the molecular weight of the compound, concentration, expiration date, batch, or production site information, etc. In one embodiment, the information material relates to methods of administering the cancer treatment and the chemotherapy or immunotherapy drugs to treat a subject having cancer, for example, at a suitable dose, dosage form, or mode of administration (e.g., the dose, dosage form, or mode of administration described herein). The information can be provided in various formats, including printed text, computer-readable material, video recording, or audio recording, or information providing a link or address to a substantial material, for example, on the Internet.

[0110] In addition to the cancer treatment or agent, the kit can further comprise materials or reagents necessary for determining the baseline levels of ALPP and / or ALPP2, as well as other components such as solvents or buffers, stabilizers, or preservatives. The cancer treatment can be provided in any form described herein, for example, in liquid, dry, or lyophilized form, substantially pure and / or sterile. In some embodiments, when the agent is provided in liquid solution form, the liquid solution is an aqueous solution. When the agent is provided as a lyophilized product, the lyophilized powder is generally reconstituted by adding a suitable solvent. The solvent can be optionally provided in the kit, for example, sterile water or a buffer (e.g., PBS).

[0111] The kit may include one or more containers for a drug or composition. In some embodiments, the kit contains separate containers, dividers, or compartments for the drug and the information material. For example, the cancer treatment may be contained in a bottle, vial, or syringe, and the information material may be contained in a plastic sleeve or package. In other embodiments, the separate elements of the kit are contained within a single undivided container. For example, the cancer treatment or agent may be contained in a bottle, vial, or syringe with the information material in the form of a label affixed thereto. In some embodiments, the kit includes a plurality (e.g., a pack) of separate containers, each containing one or more unit dosage forms (e.g., the dosage forms described herein) of the agent. The containers may include combined unit doses, e.g., a unit containing two cancer treatments in the desired ratio. For example, the kit may include a plurality of syringes, ampoules, foil packs, blister packs, or medical devices, e.g., each containing a single combined unit dose. The containers of the kit may be airtight, waterproof (e.g., no moisture change or evaporation occurs), and / or light - impermeable.

[0112] The kit optionally includes a device suitable for administering the cancer treatment, e.g., a syringe or other suitable delivery device. The device may be pre - loaded with one or two agents, or it may be empty but suitable for loading. Definitions

[0113] Where a range of values is provided, it is to be understood that each intermediate value, to the tenth of the unit of the lower limit (unless the context clearly dictates otherwise), between the upper and lower limits of that range, as well as any other stated or intermediate value within the stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the disclosure, subject to any expressly excluded limits in the stated range.

[0114] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of this disclosure. All publications mentioned herein are incorporated by reference herein to disclose and describe the methods and / or materials associated with the cited publications. Only the disclosures of the publications discussed herein prior to the filing date of this application are provided. Nothing herein is to be construed as an admission that this disclosure is not entitled to antedate such publications by virtue of prior disclosure. Any discrepancies between the disclosures of the references discussed herein and the disclosure of this application are to be resolved in favor of the disclosure of this application. Further, the provided publication dates may differ from the actual publication dates, which may need to be independently confirmed.

[0115] Unless otherwise defined, all technical and scientific terms used herein have the meaning commonly understood by one of ordinary skill in the art to which this disclosure pertains. Some specific terms related to the description of this disclosure are defined below.

[0116] As used in this specification and the appended claims, the singular forms "a / an" and "the", as well as similar references used in the context of describing particular embodiments (especially in the context of certain of the following claims), may be construed to cover both the singular and the plural, unless specifically stated otherwise. Thus, for example, "active agent" refers not only to a single active agent, but also to a combination of two or more different active agents, "dosage form" refers to a combination of dosage forms, as well as a single dosage form, etc. In some embodiments, unless explicitly indicated to refer only to alternatives or the alternatives are mutually exclusive, the term "or" as used herein (including in the claims) is used to mean "and / or".

[0117] In some embodiments, the numbers used to describe and claim certain embodiments of this disclosure, representing amounts of ingredients, properties (such as molecular weight, reaction conditions), etc., should be understood to be modified in some cases by the term "about". In some embodiments, the term "about" is used to indicate that a value includes the standard deviation of the mean value of the device or method used to determine that value. In some embodiments, the numerical parameters set forth in the written description and the appended claims are approximations, which may vary depending on the desired properties sought to be obtained by a particular embodiment. In some embodiments, the numerical parameters should be interpreted in accordance with the number of significant figures reported and by applying conventional rounding techniques. Although the numerical ranges and parameters setting forth the broad scope of some embodiments of this disclosure are approximations, the numerical values reported in specific instances are reported as precisely as possible. The numerical values presented in some embodiments of this disclosure may contain certain errors necessarily caused by the standard deviation found in their corresponding test measurements. The reference to a range of values herein is merely intended to serve as a convenient method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each separate value is incorporated into the specification as if it were individually recited herein. In some embodiments, "about" means the specified value ± 10%.

[0118] The terms "comprise", "have", and "include" are open-ended conjunctive verbs. Any form or tense of one or more of these verbs, such as "comprises", "comprising", "has", "having", "includes", and "including", is also open-ended. For example, any method that "comprises", "has", or "includes" one or more steps is not limited to having only those one or more steps and may also cover other unlisted steps. Similarly, any composition or device that "comprises", "has", or "includes" one or more features is not limited to having only those one or more features and may cover other unlisted features.

[0119] As used herein, "co-administer" means the combined administration of one or more drugs with another drug. In some embodiments, two drugs are administered simultaneously. Co-administration can also refer to any particular time period of administering either drug or both drugs. For example, as described herein, one drug can be administered hours or days before another drug and still be considered co-administered. In some embodiments, co-administration can refer to administering either drug such that both drugs are present in the patient's body at any time. In some embodiments, one drug can be administered before or after another drug, as long as they are both present in the patient's body for a sufficient time for the patient to receive the intended clinical or pharmacological benefit.

[0120] As used herein, "anti-cancer therapy" means any therapy for treating or preventing cancer. For example, an anti-cancer therapy as described herein can refer to a chemical for cancer treatment, such as a chemotherapy drug or compound, or a combination of drugs or compounds. In some embodiments, an anti-cancer therapy can refer to a drug or compound, or a combination of drugs or compounds, that induces immunogenicity in cells (e.g., cancer cells or cancer stem cells). In some embodiments, inducing immunogenicity in cancer cells can include, for example, any means for inducing cancer cells to progress to a more differentiated state associated with more limited proliferative capacity and limited lifespan. This can be achieved, for example, by upregulating or enhancing the expression of self and tumor antigens such that such cells are more susceptible to immune-based therapies.

[0121] As used herein, "DNA damaging agent" refers to an agent or compound that introduces damage to the DNA of cancer cells through multiple mechanisms. For example, DNA damage can be caused by errors in DNA replication or hindrance of DNA repair mechanisms, which can include double-strand break (DSB) repair via homologous recombination (HR) and non-homologous end joining (NHEJ) pathways. DNA damaging agents are widely used in oncology to treat both blood cancers and solid cancers. Some common modalities include, but are not limited to, ionizing radiation, platinum-based drugs (e.g., cisplatin, oxaliplatin, and carboplatin), cyclophosphamide, chlorambucil, doxorubicin, and temozolomide. Other commonly used drugs for treating cancer are described in detail herein. As used herein, "DNA damaging agent" can refer to a chemotherapeutic agent or regimen, or can refer to any agent known or available in the art capable of introducing DNA damage to cancer cells.

[0122] As used herein, "EGFR" refers to the EGFR gene, also known as the "epidermal growth factor" gene and "HER1". Many mutations in EGFR are known to be associated with cancers, including NSCLC.

[0123] As used herein, "EGFR activating mutation" refers to a mutation in the EGFR gene in a patient's cell DNA that results in abnormal expression of the EGFR gene, i.e., a mutation that "activates" the expression of the EGFR gene. EGFR activating mutations are most commonly found in non-small cell lung cancer (NSCLC), glioblastoma, and colorectal cancer. EGFR activating mutations typically occur in exons 18 - 21 of the EGFR gene, which is part of the gene encoding the tyrosine kinase domain of the EGFR protein. EGFR mutations according to the present disclosure can be point mutations, missense mutations, substitution mutations, etc. In NSCLC, the most common activating mutations observed are exon 19 deletions and the L858R point mutation in exon 21. Other EGFR mutations found in lung cancer include, but are not limited to, the C797S mutation, as well as EGFR exon 20 insertions, T790M substitutions, and L858R missense mutations.

[0124] As described herein, the methods of the present invention can be used to treat NSCLC in which a patient or subject has an EGFR activating mutation. For EGFR activating mutations, the gene mutations discussed render cancer cells resistant to inhibitors. For example, non-small cell lung cancer with an EGFR mutation is resistant to inhibitors targeting EGFR (e.g., EGFR inhibitors). Some patients who will benefit from the methods of the present invention will be patients with NSCLC who are resistant to EGFR-targeting inhibitors. The combination therapy includes administering an antibody-drug conjugate targeting ALPP and / or ALPP2, as described herein, and an EGFR inhibitor.

[0125] As used herein, "drug-resistant cell" or "DRC" refers to a cell that has developed resistance to a specific drug. As described herein, non-small cell lung cancer cells can be drug-resistant cells or can develop into drug-resistant cells.

[0126] As used herein, "drug-tolerant persister cell" or "DTPC" refers to a cell that exhibits a reversible phenotype. After discontinuation of drug treatment, DTPCs can resume proliferation and drug sensitivity. DTPCs can ultimately acquire several types of drug resistance mechanisms under continuous treatment. As described herein, non-small cell lung cancer cells can be drug-resistant cells or can develop into drug-resistant cells. The methods described herein prevent drug-tolerant persister cells (DTPCs) from developing into drug-resistant cells (DRCs). The methods described herein, namely, the administration of an antibody-drug conjugate targeting ALPP and / or ALPP2 in combination with an EGFR inhibitor, also address drug-tolerant persister cells (DTPCs) and drug-resistant cells (DRCs) by preventing the emergence of resistance to EGFR inhibitors as described herein.

[0127] A pharmaceutical composition comprising one or more of the cancer treatments described herein may comprise a "therapeutically effective amount" of a cancer treatment as described herein. The terms "therapeutically effective amount", "pharmacologically effective dose", "pharmacologically effective amount" or simply "effective amount" may be used interchangeably and refer to the amount of an agent that is effective in a patient to produce the desired pharmacological, therapeutic or prophylactic result (e.g., reducing cancer cells or reducing the cancer cell burden (i.e., a decrease in the number of cancer cells), tumor size, tumor density, lymph node involvement, metastasis, cancer recurrence or relapse, or related symptoms). A pharmacologically effective amount results in the improvement of one or more symptoms of a disorder (e.g., a blood cancer), or prevents the progression of a disorder, or causes the regression of a disorder, or prevents a disorder. Such an effective amount can be determined based on the effect of the agent administered (e.g., a cancer treatment as described herein), or if more than one agent is used, e.g., a cancer treatment followed by a second cancer treatment or agent as described herein, based on the combined effect of the agents. The therapeutically effective amount of an agent can also vary depending on factors such as the stage, condition, age, sex and weight of the individual, and the ability of the compound to elicit a desired response in the individual (e.g., improving at least one disorder parameter or improving at least one symptom of a disorder). A therapeutically effective amount is also an amount in which the therapeutic beneficial effects outweigh any toxic or detrimental effects of the composition. In some instances, an "effective amount" is an amount that treats (including prevents) one or more symptoms and / or the underlying cause of cancer. In some instances, an effective amount is a therapeutically effective amount. In some instances, an effective amount is an amount that prevents the development of one or more signs or symptoms of a particular disease or condition.

[0128] As used herein, "gene expression" or "expression" refers to the processes of gene transcription, translation, and post-translational modification.

[0129] As used herein, "immunotherapy drug" refers to a drug or compound that stimulates or inhibits the immune system to help the body fight cancer, infection, and / or other diseases. Immunotherapy drugs can be antibodies, for example, monoclonal antibodies. In some embodiments, the immunotherapy drug can be an immune checkpoint inhibitor drug, for example, a drug that targets programmed cell death protein (PD-1) or its ligand PDL-1 and / or cytotoxic T lymphocyte antigen 4 (CTLA-4) receptor. For example, useful immunotherapy drugs include but are not limited to pembrolizumab ipilimumab pembrolizumab nivolumab atezolizumab pidilizumab (CT-011), toripalimab (JS-001), avelumab tislelizumab (BGB-A317), durvalumab and cemiplimab Immunotherapy drugs that target PD-1 include but are not limited to pembrolizumab nivolumab and cemiplimab Immunotherapy drugs that target PD-L1 include but are not limited to atezolizumab avelumab and durvalumab Immunotherapy drugs that target CTLA-4 include but are not limited to ipilimumab Additional immunotherapy drugs that target these checkpoint inhibitors are known and available in the art and are encompassed within the scope of this disclosure.

[0130] "Pharmaceutically acceptable" means a material that is not biologically or otherwise undesirable, that is, the material can be incorporated into a pharmaceutical composition administered to a patient without causing any undesirable biological effects or interacting with any other component in a composition containing the material in a harmful manner. When the term "pharmaceutically acceptable" is used to refer to a pharmaceutical carrier or excipient, this means that the carrier or excipient has met the required standards for toxicology and manufacturing testing, or it is included in the Inactive Ingredient Guide formulated by the U.S. Food and Drug Administration (USFood and Drug Administration) or similar foreign regulatory agencies. "Pharmacologically active" (or "active") as in "pharmacologically active" (or simply "active") derivatives or analogs refers to derivatives or analogs with the same type of pharmacological activity as the parent compound and approximately equal in degree. Some pharmacologically active derivatives may have improved pharmacological activity. The term "pharmaceutically acceptable salt" includes acid addition salts formed with inorganic acids such as, for example, hydrochloric acid or phosphoric acid, or organic acids such as acetic acid, oxalic acid, tartaric acid, mandelic acid, etc. Salts formed with free carboxyl groups can also be derived from inorganic bases such as, for example, sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide or ferric hydroxide, and organic bases such as isopropylamine, trimethylamine, histidine, procaine, etc.

[0131] As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, etc. that are physiologically compatible. The composition may contain a pharmaceutically acceptable salt, for example, an acid addition salt or a base addition salt.

[0132] As used herein, "reducing" refers to lowering or reducing, such as reducing cancer cell load. In some embodiments, administration of such a drug can result in "reduced" or reduced cancer cell load (i.e., a decrease in the number of cancer cells), tumor size, tumor density, blast involvement, proliferation, quiescent (G0) cell proportion, lymph node involvement, metastasis, or related symptoms in a patient compared to a patient not administered a cancer treatment as described herein. "Reducing" can also refer to a reduction in disease symptoms caused by a treatment as described herein (alone or co-administered with another drug).

[0133] As used herein, the term "cancer" refers to a malignancy characterized by the abnormal proliferation of cells, the growth of which exceeds and is out of coordination with the growth of surrounding normal tissues.

[0134] As used herein, "oncogenic driver" refers to a gene involved in initiating or maintaining cancer. Mutations that cause cancer often affect three major types of genes, e.g., proto-oncogenes, tumor suppressor genes, and DNA repair genes. These changes are sometimes referred to as the "drivers" of cancer. These mutations typically occur in genes encoding signaling proteins that are essential for maintaining normal cell proliferation and survival.

[0135] As used herein, the term "subject" or "patient" refers to a mammal, preferably a human, having cancer and for whom further treatment can be provided.

[0136] As used herein, "healthy" refers to an individual who does not have cancer.

[0137] As used herein, the term "ELISA" refers to enzyme-linked immunosorbent assay. The assay generally involves contacting a fluorescently labeled protein sample with an antibody having specific affinity for those proteins. Detection of these proteins can be accomplished by a variety of methods, including but not limited to laser fluorometry.

[0138] As used herein, "subject" or "individual" or "patient" refers to any patient in need of therapy and generally refers to the recipient of the therapy. "Subject" or "patient" refers to any animal classified as a mammal, e.g., humans and non-human mammals. Examples of non-human animals include dogs, cats, cows, horses, sheep, pigs, goats, rabbits, etc. Unless otherwise indicated, the terms "patient" or "subject" are used interchangeably herein. In some embodiments, a subject suitable for treatment applications can be a primate (e.g., human) and non-human primates.

[0139] As used herein, the terms "treating" and "treatment" or "alleviating" refer to a reduction or alleviation in the severity and / or frequency of symptoms, elimination of symptoms and / or root cause, and improvement or remediation of an injury. In certain aspects, as used herein, the term "treatment" refers to prevention of recurrence of symptoms. In other aspects, as used herein, the term "treatment" refers to prevention of the root cause of symptoms associated with a disease or condition such as a blood cancer. The phrase "administering to a patient" refers to the process of introducing a composition or drug into a patient by means of introduction recognized in the art. "Treatment" or "alleviation" also includes administering a compound or agent to a subject to prevent or delay the onset of symptoms, complications, or biochemical markers of a disease (e.g., cancer), thereby alleviating symptoms or preventing or inhibiting further development of the disease, condition, or disorder. Subjects in need of treatment include subjects who already have a disease or condition, subjects who have previously had the disease or condition and are at risk of recurrence, and subjects at risk of developing the disease or condition.

[0140] Unless otherwise specified herein or clearly contradicted by the context, all methods described herein can be performed in any suitable order. The use of any and all examples or exemplary language (e.g., "such as") provided with respect to certain embodiments herein is merely intended to better illuminate the disclosure and does not pose a limitation to the scope of the disclosure otherwise claimed. No language in this specification should be construed as indicating any non-claimed element as essential for the practice of the disclosure.

[0141] The grouping of alternative elements or embodiments of the disclosure disclosed herein should not be construed as a limitation. Each member of the group can be cited and claimed individually or in any combination with other members of the group or other elements found herein. For purposes of convenience or patentability, one or more members of the group can be included in or deleted from the group.

[0142] Having described the disclosure in detail, it will be apparent that modifications, variations, and equivalent embodiments are possible without departing from the scope of the disclosure as defined by the appended claims. In addition, it should be understood that all examples in this disclosure are provided as non-limiting examples. Examples

[0143] The following examples are included to illustrate embodiments of the disclosure. The following examples are presented by way of illustration only and assist one of ordinary skill in the art in using the disclosure. These examples are not intended to limit the scope of the disclosure in any way. Those of ordinary skill in the art should understand, in accordance with the disclosure, that many changes can be made in the specific embodiments disclosed without departing from the spirit and scope of the disclosure and still obtain the same or similar results.

[0144] To illustrate the method claimed in the invention, in vitro and in vivo, treatment of lung adenocarcinoma cells expressing EGFR with a small molecule EGFR inhibitor was shown to amplify ALPP cell surface expression. In addition, it was demonstrated that treatment with other therapeutic agents enhanced ALPP protein expression. Treatment of mice bearing lung adenocarcinoma with the EGFR inhibitor gefitinib and an anti-ALPP antibody conjugated to monomethyl auristatin F (MMAF) achieved significantly improved anti-cancer efficacy compared to treatment with gefitinib or MMAF alone. A similar combined efficacy of gefitinib plus anti-ALPP-MMAF was observed in in vitro and in vivo models of triple-negative breast cancer.

[0145] As described below, diagnostic tests for combination therapies comprising anti-ALPP / ALPPL2 agents include the steps of assessing (1) baseline ALPP / ALPPL2 surface expression in cancer cells, as measured by histological analysis of a tissue biopsy or a test for evidence of tumor dissemination of ALPP / ALPPL2 expression based on blood; and (2) co-expression of cancer cell surface oncogenic drivers that can be directly targeted by an inhibitor.

[0146] In addition, a "two-hit" combination treatment strategy is demonstrated, which includes (1) treatment with a standard-of-care inhibitor anti-proliferative agent to enhance ALPP / ALPPL2 expression on the cancer cell surface; and (2) an anti-ALPP / ALPPL2 antibody-drug conjugate or immunotherapy or radionuclide therapy. Example 1

[0147] Immunohistochemical (IHC) analysis of ALPP protein in normal tissues showed limited expression in the testis and placenta, while it was negative in the heart, kidney, ovary, stomach, brain, liver, spleen, lung, colon, and breast ( Figure 1A , B). In contrast, representative IHC staining of ALPP in lung and breast tumors indicated strong positivity ( Figure 1A , B). By mass spectrometry analysis of biotinylated surface proteins that are frequently co-expressed in 7 cancer types, representative target EGFR and ALPP / ALPPL2 expression are as Figure 1C shown.

[0148] As a proof of concept, co-expressing EGFR and ALPP H1650 lung adenocarcinoma cells were treated with several EGFR-targeted TKIs ( Figure 2B ), and ALPP upregulation was demonstrated ( Figure 2A , B). Using SKBR3 cells, induction of ALPP by EGFR-TKI stimulation could also be extended to breast cancer ( Figure 2D ). When basal ALPP expression was negative in MCF7 breast cancer cells, receptor inhibition did not induce ALPP ( Figure 2C , D). Compared with small molecule TKI inhibition of EGFR, stimulation with an anti-HER-2 (ERBB2) monoclonal antibody against HER-2 expressed by SKBR3 cells similarly induced ALPP, which confirmed that the concept of detecting and targeting cell surface receptors is widely applicable ( Figure 2E ).

[0149] Targeting EGFR with an inhibitor, such as in the case of gefitinib in EGFR overexpressing mutant lung adenocarcinoma (LUAD) cancer cell lines H1650 and PC9, led to a significant upregulation of surface ALPP expression, as confirmed by mass spectrometry and immunofluorescence ( Figure 3A-D). Immunoblotting further confirmed the upregulation of ALPP after gefitinib treatment, while stimulation of EGFR with its natural ligand EGF decreased ALPP expression( Figure 3B ). Treatment of EGFR wild-type, KRAS mutant LUAD cell lines H2291 and H1838 with gefitinib also increased ALPP expression, although to a lesser extent( Figure 3B ).

[0150] Targeting cell surface ALPP with an anti-ALPP antibody showed internalization in EGFR mutant H1650 LUAD cells( Figure 4A ). Next, an anti-ALPP antibody conjugated with monomethyl auristatin F (MMAF) was synthesized. MMAF is a microtubule-disrupting agent that induces cell cycle arrest and apoptosis. Briefly, the drug-linker complex is Mc-vc-PAB-MMAF. The payload drug MMAF in this complex is an auristatin derivative that induces cell death by disrupting microtubule dynamics. The linker contains: a valine-citrulline (Val-Cit) dipeptide module that is cleaved in lysosomes after internalization of the antibody-drug conjugate (ADC); and a self-removing PBA module that releases the native form of MMAF. Mc-vc-PAB-MMAF was prepared by CBL, and the purity of the compound was >95%. Mc-vc-PAB-MMAF was conjugated to the Cys residue on the antibody via a maleimide functional group. General conjugation procedure: The antibody was partially reduced using dithiothreitol (DTT), tris(2-carboxyethyl)phosphine (TCEP), or 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB) to generate free interchain cysteine residues. Mc-vc-PAB-MMAF was conjugated to the antibody via these free cysteine residues through a maleimide-thiol reaction. After conjugation, the remaining free Mc-vc-PAB-MMAF was quenched, and all small molecule substances were removed by ultrafiltration to obtain the ADC.

[0151] The anti-cancer efficacy of gefitinib and ALPP-MMAF-ADC alone and in combination therapy was tested in vitro using H1650 LUAD cells. The combination therapy showed a synergistic effect and the highest anti-cancer efficacy( Figure 4B -C). An additional study of this strategy was conducted using an orthotopic xenograft model of H1650 tumor-bearing mice, which confirmed that the combination of gefitinib plus ALPP-MMAF-ADC produced improved anti-cancer effects compared to the control or either treatment alone( Figure 4E ).

[0152] To demonstrate broader clinical relevance, additional tests were performed using triple-negative breast cancer (TNBC) cells, which similarly showed high surface ALPP expression associated with surface EGFR expression ( Figure 5A ). Consistent with the findings in lung cancer, inhibition of EGFR by gefitinib increased ALPP expression in the TNBC cell lines BT20 and HCC1937 ( Figure 5B ). The combination therapy of gefitinib plus ALPP-MMAF-ADC produced strong anti-cancer effects in vitro and in an orthotopic xenograft model of TNBC ( Figure 5C -D).

[0153] Table 1 provides a list of cell surface targets co-expressed with ALPP / ALPPL2 on lung adenocarcinoma and breast tumors, and these cell surface targets are known to be treated with drugs other than EGFR and HER-2. These surface target candidates have good overlap and can be extended to various cancer types.

[0154] Diagnostic tests that determine the co-expression of cell surface targets and ALPP / ALPPL2 by IHC or other means will allow the evaluation of the potential benefits of combinations of inhibitors and ALPP-targeted therapies for a wide range of cancer types. Table 1 - Other possible targets co-expressed with ALPP / ALPP2 on tumor surfaces TKI, tyrosine kinase inhibitor; ACD, antibody-drug conjugate; monoAb, monoclonal antibody Example 2

[0155] Epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) therapy is considered the standard treatment for lung cancer with EGFR activating mutations, but has limited performance. Placental alkaline phosphatase (ALPP) and related ALPPL2 are expressed in a variety of solid tumors including lung cancer. Tumors with EGFR activating mutations were found to suppress ALPP expression, while EGFR TKI upregulates and maintains ALPP surface expression in lung adenocarcinoma (LUAD). EGFR inhibition leads to dephosphorylation and activation of the transcriptional regulator FoxO3a of ALPP, contributing to overexpression of ALPP. Evaluation in vitro of the combination of EGFR TKI plus ALPP antibody conjugated with monomethyl auristatin F (ALPP-MMAF) led to a significant increase in cell death in EGFR mutant LUAD cell lines HCC827 and PC9 compared to either treatment alone. EGFR TKI also upregulates ALPP expression and enhances targeted killing of drug-resistant LUAD cells. Gefitinib treatment in a gefitinib-resistant LUAD xenograft model upregulated the expression of ALPP in tumor cells but not in normal tissues. Gefitinib plus ALPP-MMAF led to greater tumor shrinkage compared to gefitinib or ALPP-MMAF alone. These findings support combination therapy for LUAD involving an EGFR inhibitor and an ALPP antibody-drug conjugate.

[0156] Epidermal growth factor receptor (EGFR), a member of the type 1 receptor tyrosine kinases, is activated by EGF and other ligands and transduces important cell growth signals. It is expressed in more than 60% of lung adenocarcinoma (LUAD) and is mutated in 40%-60% of tumors from patients in Southeast Asia and 10%-15% of Caucasians. EGFR TKI therapy has been used as the standard of care for lung cancer patients with EGFR activating mutations. Despite prolonged overall survival and a high initial response to TKI treatment, the disease ultimately progresses, mainly due to insufficient tumor cell killing and subsequent acquisition of drug resistance. TKI-refractory tumors are also resistant to most available drugs as well as immune checkpoint inhibitors. There remains an unmet need for new treatment modalities for patients with EGFR activating mutations.

[0157] Placental alkaline phosphatase (ALPP, also known as PLAP) and ALPPL2 (also known as ALPG) are members of the alkaline phosphatase family, which are expressed only in the placenta and share 98% similarity in amino acid sequence. Several studies have documented the expression of ALPP and ALPPL2 in various cancer types. To this end, assessment of ALPP protein levels in 12,381 tumors by immunohistochemistry showed that ALPP was strongly expressed mainly in seminoma, testicular embryonal carcinoma, and yolk sac tumors, and its expression was reduced in other cancer types. In lung cancer, ALPP expression was relatively reduced and was limited to adenocarcinoma.

[0158] The restricted expression of ALPP and ALPPL2 in normal tissues and their accessibility on the surface of cancer cells support their potential as therapeutic targets. To this end, chemical library screening yielded selective and potent ALPP inhibitors (which specifically bind to ALPP-positive tumors in vitro) and targeted cervical cancer in a mouse model of the disease. A fluorescent derivative of the ALPP inhibitor was used as a bispecific linker that directed chimeric antigen receptor-T cells to fluorescein on ALPP-positive tumor cells for chimeric antigen receptor (CAR) T cell-mediated cancer killing. Targeting ALPP with α-ALPP and α-CD3 bispecific antibodies led to the killing of ALPP-positive colorectal cancer cell lines. The expression of ALPP in colorectal cancer has led to its consideration for CAR T cell therapy. ALPP-CAR-T cells mediate potent cytotoxicity against cancer cells, and the combination of ALPP-CAR-T cells with anti-PD-1, PD-L1, or LAG-3 checkpoint inhibitors further increased the therapeutic efficacy of CAR T cells. Second-generation CAR T cells with fully humanized scFv against ALPP effectively killed HeLa cells expressing ALPP. A clinical trial using α-ALPP CAR T cells to treat ovarian cancer and endometrial cancer has been initiated, and another clinical study evaluating the efficacy of ALPP / ALPPL2 antibody-drug conjugates in advanced solid tumors is ongoing.

[0159] In the present study, factors involved in regulating the expression of ALPP in LUAD were investigated. The expression of ALPP in LUAD with activated EGFR mutations was significantly lower compared to EGFR wild-type (WT) tumors, and it was demonstrated that EGFR TKI significantly upregulated the expression of ALPP. FoxO3a was identified as an upstream transcriptional regulator of ALPP in the context of EGFR inhibition. The combination therapy of EGFR TKI plus ALPP-MMAF led to enhanced anti-cancer effects and prevented the formation of drug-resistant cell clones in EGFR TKI-sensitive LUAD cell lines HCC827 and PC9 in vitro. In a xenograft mouse model of LUAD, the combination therapy also led to enhanced anti-cancer responses compared to gefitinib or ALPP-MMAF alone.

[0160] Cell culture

[0161] Table 4 provides detailed information on the human cancer cell lines used in this study. Cells were grown in RPMI 1640 (catalog number 10-040-CV, Corning) supplemented with 10% heat-inactivated fetal bovine serum (FBS, catalog number 16140-071, Gibco) and maintained at 37 °C in a humidified atmosphere containing 5% CO2.

[0162] Antibodies, chemicals, and virus strains

[0163] Table 5 provides detailed information on the antibodies, chemicals, and virus strains used in this study. Creative Biolabs conjugated the ALPP antibody (catalog number NB110-3638, Novusbiologicals) with monomethyl auristatin F (MMAF).

[0164] Proteomics analysis

[0165] As described previously, ALPP and ALPPL2 expression analyses were performed by mass spectrometry in whole cell extracts and the surfaceome compartment. 19-23 Each data set was normalized relative to the total spectral counts for each compartment. 24 .

[0166] FoxO3a overexpression

[0167] The open reading frame of FoxO3a was inserted into the pLOC-RFP vector and packaged into lentivirus. Stable FoxO3a overexpression in LUAD cell lines HCC827 and H1650 was achieved by lentiviral infection and subsequent selection of blasticidin-resistant cells, and the overexpression of FoxO3a was verified by immunoblotting.

[0168] Immunofluorescence

[0169] LUAD cells fixed with 1% paraformaldehyde were stained with ALPP antibody (Catalog No. NB110 - 3638, Novus Biologicals) and Alexa488 - conjugated secondary antibody. Images were acquired in a z - series on a spinning - disk confocal system.

[0170] Flow cytometry

[0171] LUAD cells were stained with ALPP antibody (Catalog No. NB110 - 3638, Novus Biologicals) and Alexa488 - conjugated secondary antibody (Catalog No. A11029, Invitrogen), and then flow cytometry analysis was performed on an LSRII flow cytometer (BD).

[0172] For flow - cytometry - based cell cycle analysis, ethanol - fixed cells were stained with Hoechst 33342 (1 μg / ml, Catalog No. 62249, Invitrogen), and then cell cycle analysis was performed using an LSRII flow cytometer (BD).

[0173] Immunohistochemistry (IHC) analysis

[0174] The tissue microarray used for IHC staining of ALPP in this study included 204 surgically resected lung cancer tumor specimens, which were collected according to the institutional review board protocol and archived as formalin - fixed paraffin - embedded specimens in the Thoracic Tissue Bank of the University of Texas MD Anderson Cancer Center's University of Texas Excellence in Research Professional Program. Table 3 provides the patient characteristics of the analyzed cohort. The human normal tissue microarray used for IHC staining of ALPP was obtained from Novus Biologicals (Catalog No. NB110 - 3638). IHC staining was performed as previously described 25 。

[0175] Cell viability assay

[0176] The cell viability of LUAD cells was determined using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay (MTS) kit (Catalog No. G3580, Promega).

[0177] Chromatin immunoprecipitation (ChIP)

[0178] ChIP was performed in HCC827 and H1650 cells using the Pierce Magnetic ChIP Kit (Catalog No. 26157, Thermo Scientific) according to the manufacturer's instructions. The nuclear lysates were incubated overnight at 4 °C with antibodies (positive antibody: 10 μL; negative antibody: 2 μL; FoxO3a antibody: 8 μL (Catalog No. 720128, Invitrogen)). Subsequently, the DNA-protein complexes were enriched with Protein A / G magnetic beads, and the DNA was recovered through a DNA purification column. The relative abundance of genomic DNA fragments was determined using the SsoAdvanced Universal SYBR Green Supermix (Catalog No. 1725271, Bio-Rad) and the primers shown in SEQ ID NO: 1-10 (as shown in Table 2 below). Table 2. Promoter Region-Specific Primers for the Human ALPP Gene Primer Sequence (5'-3') SEQ ID NO ALPP - P1 - F CTACTGCCAACCACGGATGAATG 1 ALPP - P1 - R CAAGGGCTGTTGCCATATTTCC 2 ALPP - P2 - F TCGAAAAATAATTGTGGGGTGGC 3 ALPP - P2 - R GCTGAGTTAGGAAATTTCTGGGC 4 ALPP - P3 - F AAAAATAATTGTGGGGTGGCGG 5 ALPP - P3 - R CATTCCTTCCTCCTGCTTATTGC 6 ALPP - P4 - F CGTCCAAACATTAGTGTGAGTGC 7 ALPP - P4 - R CCCTTGCTCCATCATCTTACCTT 8 ALPP - P5 - F AAGGTAAGATGATGGAGCAAGGG 9 ALPP - P5 - R CTATATTTCCCAGAAGCTGGGGC 10

[0179] Total RNA Extraction and Quantitative PCR (qPCR)

[0180] Total RNA was extracted using the RNeasy Mini Kit (Catalog No. 74104, QIAGEN). Reverse transcription of total RNA was performed using the High-Capacity cDNA Reverse Transcription Kit (Catalog No. 4368813, Applied Biosystems). TaqMan Universal Master Mix II (Catalog No. 4440040, Applied Biosystems) was used for the analysis of ALPP expression. The probe for ALPP was purchased from Thermo Fisher Scientific (Hs03046558_s1).

[0181] Immunoblotting

[0182] Total proteins were extracted in RIPA buffer (Catalog No. 89901, Pierce) containing a complete protease inhibitor mixture (Catalog No. 04693116001, Roche) and phosSTOP (Catalog No. 04906837001, Roche). Information on the antibodies is provided in Table 4.

[0183] Antibody Internalization Assay

[0184] According to the manufacturer's instructions, pHrodo was used TMThe iFL Red Red Micro-Protein Labeling Kit (Catalog No. P36014, Thermo Fisher) was used to evaluate antibody internalization. Briefly, 100 μg of anti-ALPP antibody (Catalog No. MAB59051, R&D systems) in 100 μl of PBS was mixed with 10 μl of 1 M sodium bicarbonate and 5 μl of 2 mM pHrodo, and then incubated at room temperature for 30 minutes. Subsequently, the pHrodo-conjugated anti-ALPP antibody was purified using gel resin. The cells were washed twice with PBS and incubated with the pHrodo-conjugated anti-ALPP antibody (10 μg / ml) for 24 hours, then fixed in 2% paraformaldehyde, washed twice with PBS, and counterstained with DAPI. Images were captured using a fluorescence microscope.

[0185] In Vivo Studies

[0186] The animal experimental protocol was approved by the IRB of The University of Texas MD Anderson Cancer Center and complied with the Guidelines for the Care and Use of Laboratory Animals published by NIH (Bethesda, MD). BALB / c nude mice (Catalog No. 194, Charles River) were housed in a specific pathogen-free facility. For the orthotopic xenograft model of LUAD, a total of 1×10 6 cells of the H1650 cell line expressing firefly luciferase were suspended in 50 μl of 50% Matrigel matrix (Corning) / Opti-MEM medium and injected into the lungs of 8- to 10-week-old nude mice. For gefitinib treatment, the mice received gefitinib (50 mg / kg) by oral gavage daily starting from day 17 after cancer cell inoculation for 10 days. For the gefitinib / ALPP-ADC combination treatment, the mice received an additional ALPP antibody conjugated with MMAF (ALPP-MMAF) (5 mg / kg, i.v.) on days 19 and 26. Tumor growth was monitored twice a week for 5 weeks using the Xenogeny In Vivo Imaging System (IVIS, Alameda County, CA). The mice were euthanized on day 30, and the tumors were harvested and processed for routine histology and immunohistochemistry analysis.

[0187] Gene Set Enrichment Analysis (GESA)

[0188] For GESA, the signal enrichment scores were calculated using the "ReactomePA" and "clusterProfiler" packages in R and the GSEA dataset (gsea-msigdb.org / gsea / index.jsp), with a significance threshold of FDR q-value < 0.05 26,27 The enrichment results were visualized using the "enrichplot" package.

[0189] Single-cell RNA sequencing (scRNA-seq)

[0190] scRNA-seq data were retrieved from the GEO dataset (GSE150949) 28 Preprocessing, dimensionality reduction based on principal component analysis (PCA), and t-distributed stochastic neighbor embedding (t-SNE) were performed using the Seurat package (version 4.3.0) implemented in R statistical software (version 4.3) (https: / / www.r-project.org / ) to visualize cell clusters from different treatment groups. The expression and percentage of ALPP were calculated accordingly. In addition, cells were classified into S / G2M or G1 phase, and the cell cycle scores were calculated using the CellCycleScoring function under the Seurat package 29 .

[0191] Statistical analysis

[0192] For continuous variables, statistical significance was determined by two-sided Student's t-test unless otherwise stated. For categorical variables, statistical significance was determined by Fisher's exact test for two-category classification comparisons or the χ 2 test for trends in multiple categorical variables. Figures were generated in GraphPad Prism version 9.0.0.

[0193] Results

[0194] Expression of ALPP and ALPPL2 in LUAD

[0195] To evaluate the expression of ALPP and ALPPL2 in lung cancer, the ALPP and ALPPL2 protein levels in whole cell extracts (WCE) and surface compartments of 49 lung adenocarcinoma (LUAD) and 22 small cell lung cancer (SCLC) cell lines were evaluated, which revealed that ALPP (and to a lesser extent, ALPPL2) was mainly expressed in LUAD compared to SCLC.( Figure 6Aand Table 4). Evaluation of their mRNA expression levels in 48 LUAD, 24 lung squamous cell carcinoma (LUSC), and 50 SCLC cell lines from the Cancer Cell Line Encyclopedia (CCLE) similarly revealed that ALPP was mainly expressed in LUAD, which was consistent with the proteomics results ( Figure 6B ). Analysis of ALPP and ALPPL2 mRNA expression in LUAD and LUSC in The Cancer Genome Atlas (TCGA) also revealed higher expression in LUAD compared to LUSC ( Figure 6C ).

[0196] Since the expression level of ALPP was higher than that of ALPPL2 in LUAD ( Figures 6A - 6C ), the focus was placed on ALPP as a potential therapeutic target. Using a tissue microarray (TMA) consisting of 140 LUAD and 64 LUSC tumors, ALPP expression was evaluated by immunohistochemistry (IHC). Among 204 tumors, 37 (18.1%) had positive cytoplasmic ALPP staining and 23 (11.3%) had positive membranous ALPP staining ( Figure 6D ). Surface expression of ALPP in EGFR-mutant HCC827 and PC9 LUAD cells was also confirmed by immunofluorescence ( Figure 6E ). Positive membranous ALPP staining was more common in LUAD tumors (21 out of 140) than in LUSC tumors (2 out of 64; Fisher's exact test p-value: 0.015), which was consistent with previous reports. Positive membranous ALPP staining was associated with smoking status (trend p-value of χ 2 test: 0.0001) (Table 3). There was no statistical evidence of an association between positive tumor membranous ALPP staining and gender or stage (Table 3). Expression of ALPP in normal human tissues was evaluated. Except for placenta and testicular tissues, ALPP protein was expressed negatively in other tissues including the lung ( Figures 14A - 14C ). Table 3. Positive membranous ALPP staining in tissue microarrays of lung adenocarcinoma and squamous cell carcinoma Statistical significance was determined by Fisher's exact test for two-category classification comparisons or the χ 2 test for trends in multiple categorical variables. Two-sided P values were reported. Abbreviation: wt - wild type.

[0197] EGFR TKI upregulates ALPP expression in LUAD cells

[0198] The relatively low expression of ALPP in LUAD may limit its utility as a therapeutic target. Activation of oncogenes usually leads to uncontrolled cell proliferation, and previous studies have reported an inverse association between ALPP expression and cell proliferation. To investigate whether oncogenes contribute to the suppression of ALPP expression, the ALPP gene expression in LUAD was compared with the WT and driver mutations of EGFR, KRAS, NF1, and BRAF. In the TCGA dataset, the ALPP expression of LUAD with EGFR driver mutations was reduced compared with that of EGFR-WT tumors ( Figure 7A ), which was consistent with the findings from an independent cohort of 181 East Asian LUAD patients ( Figure 15A ). To test whether the effect of EGFR signaling on ALPP expression depends on its activating mutation status, gefitinib-resistant EGFR mutant H1650 and EGFR-WT H2291 LUAD cells were cultured in growth medium with or without epidermal growth factor (EGF) (the endogenous ligand of EGFR). In both cell lines cultured in EGF-containing growth medium, the ALPP expression was significantly reduced ( Figure 7B ). EGF induced AKT phosphorylation at serine 473 (Ser473) and ERK phosphorylation at threonine 202 (T202) and tyrosine 204 (Y204) residues, while treatment with the EGFR TKI gefitinib inhibited the phosphorylation of AKT and ERK ( Figure 7C ). In addition, treatment of EGFR TKI-sensitive EGFR mutant HCC827 and PC9 cells with gefitinib or osimertinib showed an approximately 60- and 110-fold increase in ALPP expression ( Figure 7D and Figure 15B ). Immunofluorescence staining and flow cytometry analysis demonstrated the enrichment of cell surface expression of ALPP after EGFR inhibition ( Figure 7E and Figure 7F ). The ALPP expression levels from independent datasets confirmed a consistent increase after EGFR TKI treatment ( Figures 7G - 7H and Figure 15C ).

[0199] To determine whether other EGFR inhibitors induce ALPP expression, treatment of EGFR mutant H1650 and HCC827 LUAD cells with inhibitors including lapatinib, afatinib, and osimertinib produced similar results ( Figure 7I ). Upregulation of ALPP by EGFR inhibitors was also observed in EGFR-WT LUAD cell lines H2291, H1838, and H1651 ( Figure 7J)。However, the ALPP non-expressing cell lines H1395, H1944, and HCC2279 did not upregulate ALPP in response to gefitinib treatment, while the ALPP-positive LUAD cell lines H2291, H1650, H1838, and H1651 showed elevated ALPP levels( Figure 7J )。

[0200] FoxO3a is a transcriptional regulator of ALPP

[0201] Given the inverse association between ALPP expression and cell proliferation, GESA analysis of the TCGA LUAD dataset confirmed the negative correlation between ALPP expression and the cell cycle( Figure 8A )。KEGG pathway analysis also revealed that the cell cycle is one of the top pathways negatively correlated with ALPP expression( Figure 8B )。Treatment of HCC827 and PC9 cells with gefitinib or osimertinib revealed a statistically significant increase in G0 / G1 cell cycle arrest( Figure 8C )。

[0202] Next, it was tested whether the signaling pathways directly downstream of EGFR were involved in ALPP upregulation. Small molecule inhibition of PI3K / AKT (NVP-BKM120) or MEK / ERK (AZD8330, SCH772984) signaling in HCC827 and H1650 LUAD cells led to a dramatic induction of ALPP expression( Figure 8D )。FoxO family transcription factors are involved in cell cycle regulation and are regulated by PI3K / AKT and MEK / ERK signaling. At the mRNA level, EGFR mutant H1650 and HCC827 LUAD cells expressed low FoxO1 but expressed significant FoxO3a( Figure 16A )。The transcription of FOXO3A was not affected by gefitinib treatment( Figure 16B )。Ingenuity pathway analysis of upstream regulators revealed consistent activation of FoxO3a but not FoxO1 in 4 LUAD cell lines treated with osimertinib( Figure 8E and Figure 16C )。Phosphorylation of FoxO3a at Ser294 and Ser425 leads to nuclear export and cytoplasmic retention of FoxO3a, resulting in loss of transcriptional activity and degradation. Inhibition of FoxO3a using the small molecule inhibitor AS1842856 reduced ALPP protein expression in LUAD cells and attenuated gefitinib-mediated ALPP upregulation( Figures 8F - 8G )。Conversely, overexpression of FoxO3a in both the H1650 cell line and the HCC827 cell line led to upregulation of basal ALPP expression, which was further enhanced when the corresponding cancer cells were treated with gefitinib( Figure 8H) Treatment of EGFR-mutant H1650 and HCC827 LUAD cells with gefitinib inhibited the phosphorylation of FoxO3a at Ser294 and Ser425 residues, reduced cytoplasmic FoxO3a and promoted its nuclear translocation, thus indicating transcriptional activation( Figures 8I - 8J ) Osimertinib also inhibited the phosphorylation of EGFR and FoxO3a and increased ALPP expression( Figure 8K )。

[0203] To clarify whether FoxO3a is a transcriptional regulator of ALPP, in silico prediction of putative transcription factors of ALPP was first performed using the online tool PROMO. Seven potential binding sites for FoxO3a were identified within the 2-kb promoter region upstream of the ALPP gene( Figure 17A ) ChIP-qPCR was then performed and it was confirmed that gefitinib treatment induced the binding of FoxO3a to the ALPP promoter sequence, which led to a concomitant increase in ALPP mRNA levels in both the H1650 and HCC827 LUAD cell lines( Figure 8L and Figure 17B )。Collectively, these data demonstrate that FoxO3a is a transcriptional regulator of ALPP.

[0204] EGFR TKI maintains the upregulation of ALPP

[0205] Treatment of HCC827 and PC9 cells with gefitinib or osimertinib for one to four days led to a gradual and continuous increase in the percentage of ALPP and ALPP + cells( Figures 9A - 9C ) A previous single-cell transcriptomics study involved PC9 cells treated with osimertinib. Querying the ALPP expression of this dataset and finding that the ALPP gene expression gradually increased after osimertinib treatment( Figures 9D - 9E ) Interestingly, the ratio of ALPP-positive cells increased sharply after osimertinib treatment, with less than 1% of LUAD cells expressing basal ALPP on day 0 to nearly 50% of LUAD cells expressing ALPP by day 14( Figure 9F ) Drug-tolerant persistent cells (DTPC) are a population of cells that survive and persist during drug treatment and cause subsequent therapy resistance and disease recurrence. The study determined that ALPP expression was maintained in DTPC and persistent expression was observed in osimertinib DTPC( Figure 9G and Figure 18A ) DTPC were further generated from the HCC9827 and PC9 LUAD cell lines( Figures 18B - 18C ), and ALPP expression in Gef-DTPC and Osi-DTPC was evaluated, both of which showed persistent ALPP expression( Figures 9H - 9I), indicating that EGFRTKI maintains ALPP expression in drug-tolerant cells. ALPP + Gef-DTPC and Osi-DTPC also increased significantly ( Figure 9J ).

[0206] To determine whether continuous ALPP expression requires continuous treatment with EGFR inhibitors, HCC827 and PC9 cells were treated with gefitinib or osimertinib for 48 hours and then for an additional 48 hours in the absence of the inhibitor. ALPP expression decreased significantly in the absence of EGFR inhibitor and recovered upon addition of the inhibitor ( Figures 9K - 9L ). Similar results were observed in Gef-DTPC ( Figures 9M - 9N ).

[0207] To further explore whether ALPP expression is upregulated in EGFR inhibitor-resistant cells, gefitinib-resistant (GR) HCC827 and PC9 cells were generated ( Figure 18D ). Compared with parental cells, ALPP expression was higher in GR cells, and gefitinib treatment further enhanced ALPP upregulation ( Figures 10A - 10B ). Flow cytometry analysis of ALPP showed that most gefitinib-resistant cells expressed high levels of ALPP after gefitinib challenge ( Figure 10C ). These results were consistent with ALPP upregulation in erlotinib-resistant HCC827 and HCC4006 and gefitinib-resistant PC9 LUAD cells ( Figures 10D - 10E ). Transcriptomic analysis of PC9 xenograft tumors treated with erlotinib also revealed increased ALPP mRNA expression in erlotinib-responsive tumors compared with untreated tumors, and persistent elevation of ALPP gene expression in erlotinib-resistant tumors ( Figure 10F ). Using publicly available transcriptomic data, the transcription of ALPP in untreated tumors and EGFRTKI-resistant tumors was also examined. Compared with untreated tumors, increased ALPP levels were observed in NSCLC resistant to first- and second-generation EGFR TKIs ( Figure 10G ). Similarly, paired comparisons of ALPP expression in tumors before and after resistance to osimertinib revealed a general upregulation of ALPP ( Figure 10H ).

[0208] Combination of EGFR TKI and ALPP-ADC treatment enhances cancer cell killing

[0209] The in vitro efficacy of a combination regimen consisting of an EGFR TKI and an anti-ALPP antibody conjugated with monomethyl auristatin F (MMAF), a microtubule-disrupting agent that induces apoptosis, was evaluated. The combination resulted in increased cell death compared to either treatment alone ( Figure 11A and Figure 19A ). Titration of the ADC revealed dose-dependent cytotoxicity of ALPP-MMAF ( Figure 11B ). Treatment with gefitinib or osimertinib followed by treatment with ALPP-MMAF also resulted in potent cytotoxicity ( Figure 11C ). Similarly, ALPP-MMAF showed efficacy in gefitinib-resistant HCC827 and PC9 cells ( Figure 11D ). Continuous treatment of HCC827 and PC9 cells with gefitinib or osimertinib led to the emergence of drug-resistant clones, while the addition of ALPP-MMAF to gefitinib- or osimertinib-treated HCC827 and PC9 cells effectively inhibited the formation of EGFR TKI-resistant clones ( Figure 11E and Figure 19B ).

[0210] The dual regimen was then tested in the gefitinib-resistant cell line H1650. Surface ALPP was targeted using a Phrodo-Red-conjugated ALPP antibody in H1650 LUAD cells, and internalization was demonstrated ( Figure 12A ). Combination treatment showed a synergistic effect with a potent cancer-killing effect ( Figures 12B - 12C ).

[0211] In addition, H1650 (H1650 Luc ) LUAD cells expressing firefly luciferase were orthotopically implanted into BALB / c nude mice, and tumor-bearing mice were treated daily with 50 mg / kg gefitinib or saline control for 10 days. Tumor and other organ tissues were then harvested, and ALPP expression was evaluated by IHC. Consistent with the in vitro observations, tumor-bearing mice treated with gefitinib showed a significant increase in surface expression of tumor ALPP ( Figure 12D ). ALPP protein staining in other tissues was negative or showed no significant difference compared to the vehicle control ( Figure 20 ). Using an independent cohort of H1650 Luc tumor-bearing mice, the anti-cancer efficacy of 50 mg / kg gefitinib, 5 mg / kg ALPP-MMAF was evaluated alone and in combination ( Figure 12E ). Treatment with gefitinib or ALPP-MMAF alone led to a decrease in H1650 LucThe relative fluorescence units (RFU) of the tumors were significantly reduced statistically. Notably, tumor-bearing mice treated with gefitinib plus ALPP-MMAF showed complete responses and were tumor-free based on IVIS imaging ( Figures 12F - 12G ).

[0212] Discussion

[0213] EGFR TKI monotherapy is the first-line treatment for lung cancer patients with EGFR-activating mutations. Although the initial response to these drugs is high, resistance to EGFR TKI inevitably emerges, leading to cancer progression within 1-2 years after the start of therapy. Combination therapies can maximize anti-tumor efficacy and significantly impede the development of drug resistance. Here, it was demonstrated that EGFR inhibitor-driven ALPP upregulation provides a viable "second-hit" combination regimen that incorporates EGFR TKI and ALPP-MMAF, with improved efficacy against TKI-sensitive and refractory cancer cells ( Figure 13 ).

[0214] ALPP is a GPI-anchored protein that is expressed on the cell surface in some cancers, while normal tissue expression is largely limited to the placenta and is currently being explored as a target for cancer therapy. However, the expression level of ALPP is relatively low in most cancer types. In lung cancer, ALPP is mainly expressed in adenocarcinoma. Consistent with previous studies, evaluation of ALPP mRNA expression and surface protein expression in human lung tumors and cancer cell lines demonstrated variable expression with outliers frequently observed in LUAD. In the TMA of lung tumors, ALPP surface staining was found in 11.3% of all analyzed lung tumors, with the highest frequency of ALPP surface staining (17.6%) observed in LUAD. Notably, ALPP staining positivity was associated with smoking status. Previous studies reported that serum ALPP levels increased up to 10-fold in smoking individuals compared to non-smokers. In addition, a comparison of epigenome-wide association studies (EWA) of current smokers, former smokers, and never smokers from 1,793 participants revealed lower methylation of CpG islands in the ALPP locus in smokers compared to non-smokers. Recently, a study identified ALPP as one of the risk biomarkers for smoking-related lung cancer. Since the data indicate that basal expression of ALPP is required for EGFR TKI-mediated upregulation, inhibition of EGFR may more strongly promote ALPP expression in patients with a smoking history.

[0215] Previous studies have documented an inverse relationship between ALPP expression and the cell proliferation status. Consistent with these observations, significant ALPP upregulation has been found in cancer cells treated with EGFR inhibitors. Importantly, the enhanced ALPP expression in cancer cells is transient and reversible, suggesting that ALPP expression may be associated with cell quiescence. To support this, the key regulator of cell quiescence, FoxO3a, was identified as an upstream transcriptional regulator of ALPP. FoxO3a is one of four related FoxO transcription factors that protect cells from various physiological stresses and plays a central role in DNA repair, growth arrest, and apoptosis in response to DNA damage and oxidative stress. Inactivation of FoxO3a, which is frequently reported in various malignancies, is attributed to the overactivation of the PI3K-AKT or MEK-ERK signaling pathways, which negatively regulate its transcriptional activity through phosphorylation of FoxO3a at Thr32, Ser253, and Ser294, promoting and maintaining nuclear exclusion and proteasomal degradation. Previous studies have well demonstrated that EGFR signaling inhibits FoxO3a activation. Erlotinib inhibition of EGFR leads to nuclear accumulation and transcriptional activation of FoxO3a. In NSCLC cell lines, gefitinib treatment interrupts EGF-induced phosphorylation and inactivation of FoxO3a. In the present study, it was found that EGFR TKI treatment inhibits FoxO3a phosphorylation in LUAD cells, leading to FoxO3a nuclear translocation, which is accompanied by increased ALPP mRNA and protein levels. Inhibition of FoxO3a using the small molecule inhibitor AS1842856 reduced ALPP protein expression and blocked EGFR TKI-mediated ALPP upregulation, and ChIP-qPCR assays demonstrated direct binding of FoxO3a to the promoter of ALPP. Collectively, the data identify FoxO3a as a transcriptional regulator of ALPP, which underlies EGFR TKI-driven ALPP upregulation.

[0216] These findings prompted us to evaluate whether the EGFR TKI-mediated enhancement of surface ALPP expression in cancer cells might increase the efficacy of ALPP-targeted therapies. To this end, it was demonstrated that combination therapy consisting of gefitinib / osimertinib and ALPP-MMAF resulted in significantly improved cancer killing compared to either treatment modality alone. Treatment of EGFR-mutant LUAD tumor-bearing mice with gefitinib led to increased ALPP surface expression, particularly in tumors, but not in normal tissues. Treatment of EGFR-mutant LUAD tumor-bearing mice with the combination of gefitinib plus ALPP-MMAF resulted in significant anti-cancer effects that exceeded the efficacy of gefitinib or ALPP-MMAF treatment alone. This synergistic combination approach demonstrated the potential of targeting both EGFR signaling and ALPP expression to enhance treatment outcomes in EGFR-mutant lung cancer.

[0217] Acquired drug resistance to EGFR TKIs, which typically occurs within 2 years after the start of EGFR inhibitor treatment, remains a major clinical challenge. EGFR-dependent resistance usually occurs due to the acquisition of additional EGFR mutations (e.g., EGFRT790M, exon 19 deletions, L858R, or C797S), which occurs in approximately 50% of early EGFR TKI cases or in about 10%-20% of patients receiving osimertinib treatment, and may potentially be addressed by using different generations of EGFR inhibitors or combination regimens. EGFR-independent resistance includes the expression of other receptor tyrosine kinases, EMT, and small cell lung cancer transformation. For the vast majority of EGFR-independent resistance, there remains a lack of therapies. This discovery demonstrates that ALPP is upregulated in cancer cells closely related to EGFR signaling. Importantly, EGFR TKIs can maintain ALPP expression even in drug-refractory cancer cells. In vitro evaluation of the efficacy of ALPP-MMAF in DTPC and gefitinib-resistant cells revealed effective killing of gefitinib- or osimertinib-refractory cancer cells. In addition, ALPP-MMAF in combination with gefitinib or osimertinib also prevented the formation of drug-resistant clones. A recent study aimed at identifying surface therapeutic targets in EMT-related EGFR TKI-resistant NSCLC also listed ALPP as one of the highly upregulated proteins. These findings support the feasible application of ALPP-targeted regimens in addressing EGFR-independent resistance.

[0218] In summary, this study provides mechanistic insights into the upregulation of ALPP in cancer cells and identifies FoxO3a as a transcriptional regulator of ALPP. Importantly, this study presents a new combination therapeutic strategy that exploits enhanced ALPP expression in cancer cells, thereby potentially increasing the efficacy of targeted therapies in LUAD with EGFR activating mutations. Table 4 - Human cancer cell lines used in this study Table 5 - Reagents used in this study

[0219] The various embodiments described above can be combined to provide further embodiments. All U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications, and non-patent publications mentioned and / or listed in the application data sheet in this specification are hereby incorporated by reference in their entirety. If desired, aspects of the embodiments can be modified to incorporate the concepts of various patents, applications, and publications to provide additional embodiments.

[0220] In view of the foregoing detailed description, these and other changes can be made to the embodiments. Generally, in the following claims, the terms used should not be construed as limiting the claims to the specific embodiments disclosed in the specification and claims, but should be construed to include the entire scope of all possible embodiments together with the full scope of equivalents to which such claims are entitled. Thus, the claims are not limited by this disclosure.

Claims

1. A method for treating cancer in a patient in need thereof, the cancer co-expressing alkaline phosphatase (ALPP) and / or ALPP2 protein and carrying an EGFR activating mutation, the method comprising administering to the patient, in combination with an EGFR inhibitor, an antibody-drug conjugate targeting ALPP and / or ALPP2 in the cells.

2. A method for treating cancer in a patient in need thereof, the cancer co-expressing alkaline phosphatase (ALPP) and / or ALPP2 protein and carrying an EGFR activating mutation, the method comprising: identifying the EGFR activating mutation in the cells from a biological sample obtained from the patient; detecting and / or quantifying the cell surface expression of ALPP and / or ALPP2 in the cells; administering, in combination with an EGFR inhibitor, an antibody-drug conjugate therapy targeting ALPP and / or ALPP2 in the cancer cells.

3. A method for treating drug-tolerant or drug-resistant cancer cells co-expressing alkaline phosphatase (ALPP) and / or ALPP2 protein in a patient in need thereof, the method comprising: identifying the EGFR activating mutation in the cells from a biological sample obtained from the patient; detecting and / or quantifying the cell surface expression of ALPP and / or ALPP2 in the cells; administering, in combination with an EGFR inhibitor, an antibody-drug conjugate therapy targeting ALPP and / or ALPP2 in the cancer cells.

4. A method for preventing the emergence of resistance of cancer cells co-expressing alkaline phosphatase (ALPP) and / or ALPP2 protein to an EGFR inhibitor, the method comprising administering, in combination with the EGFR inhibitor, an antibody-drug conjugate therapy targeting ALPP and / or ALPP2 in the cancer cells.

5. The method according to any one of claims 1 to 4, wherein the cancer cells have increased cell surface expression of ALPP and / or ALPP2 relative to healthy cells.

6. The method according to any one of claims 1 to 5, wherein the EGFR mutation comprises exon 19 deletion, T790M point mutation, and / or L858R point mutation.

7. The method according to any one of claims 1 to 6, wherein the cancer having the EGFR mutation is resistant to an inhibitor targeting EGFR.

8. The method according to any one of claims 1 to 7, wherein the cancer cells are drug-tolerant persistent cells (DTPC) or drug-resistant cells (DRC).

9. The method according to any one of claims 1 to 8, wherein administering the antibody-drug conjugate therapy targeting ALPP and / or ALPP2 in the cancer cells and the EGFR inhibitor prevents the drug-tolerant persistent cells (DTPC) from developing into drug-resistant cells (DRC).

10. The method according to any one of claims 1 to 9, wherein the method treats drug-tolerant persistent cells (DTPC) and drug-resistant cells (DRC) to prevent the emergence of resistance to an EGFR inhibitor.

11. The method according to any one of claims 1 to 10, wherein the cancer co-expressing alkaline phosphatase (ALPP) and / or ALPP2 protein is ovarian cancer, breast cancer, cervical cancer, endometrial cancer, pancreatic cancer, gastric cancer, colorectal cancer, lung cancer, urothelial cancer, brain cancer, testicular cancer, seminoma, and mesothelioma.

12. The method according to any one of claims 1 to 11, wherein the cancer is testicular germ cell tumor, uterine corpus endometrial cancer, pancreatic adenocarcinoma, pancreatic ductal adenocarcinoma, bladder urothelial cancer, triple-negative breast cancer, gastric adenocarcinoma, esophageal cancer, uterine carcinosarcoma, rectal adenocarcinoma, head and neck squamous cell carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, colon adenocarcinoma, mesothelioma, and acute myeloid leukemia.

13. The method according to claim 11, wherein the lung cancer is non-small cell lung cancer.

14. The method according to any one of claims 1 to 10, wherein detecting and / or quantifying the cell surface expression of placental alkaline phosphatase (ALPP) and / or ALPP2 in the cancer cells comprises histological analysis, immunohistochemical (IHC) staining of ALPP protein, blood-based tests, tissue-based tests, or imaging techniques.

15. The method according to claim 11, wherein the tissue-based test comprises tissue biopsy, flow cytometry, immunohistochemistry (IHC), western blot (WB), polymerase chain reaction (PCR), or immunofluorescence (IF).

16. The method according to claim 11, wherein the tissue-based test includes a test or Oncotype test.

17. The method according to claim 11, wherein the blood-based test comprises a circulating tumor cell (CTC) test, a complete blood count (CBC), or a test or assay for measuring circulating proteins, autoantibodies, cell-free circulating DNA, or extracellular vesicle-derived proteins.

18. The method according to claim 12, wherein the tissue biopsy is analyzed by hematoxylin and eosin (H&E) staining and / or microscopy.

19. The method according to any one of claims 1 to 15, wherein the antibody-drug conjugate comprises an antibody targeting ALPP conjugated to a chemotherapy drug.

20. The method according to any one of claims 1 to 16, wherein the EGFR inhibitor comprises a tyrosine kinase inhibitor (TKI).

21. The method according to any one of claims 1 to 17, wherein the antibody-drug conjugate therapy targeting ALPP and / or ALPP2 is administered in combination with the EGFR inhibitor.

22. The method according to any one of claims 1 to 18, wherein the EGFR inhibitor is selected from gefitinib, osimertinib, mobocertinib, amivantamab, CLN081, and / or DZD9008.

23. The method according to claim 16, wherein the antibody-drug conjugate comprises SGN-ALPV, Zynlonta TM , and 24. The method according to any one of claims 1 to 20, wherein the antibody-drug conjugate therapy targeting ALPP and / or ALPP2 in the cancer cells and the EGFR inhibitor are administered simultaneously.

25. The method according to any one of claims 1 to 21, wherein the antibody-drug conjugate therapy targeting ALPP and / or ALPP2 in the cancer cells and the EGFR inhibitor are administered sequentially.

26. A method for treating cancer in a patient in need thereof, the cancer carrying an EGFR activating mutation, the method comprising: administering an antibody-drug conjugate targeting ALPP and / or ALPP2 on the surface of cancer cells; wherein these cancer cells exhibit increased expression of ALPP and / or ALPP2 relative to healthy cells; wherein the antibody-drug conjugate targeting ALPP and / or ALPP2 comprises an antibody targeting ALPP and / or ALPP2 conjugated to MMAF; wherein these cancer cells contain an activating mutation in the EGFR gene, resulting in resistance to EGFR tyrosine kinase inhibitors.

Images