Modified RNA polymerase activity

Abstract

The present invention relates to mutant host cells with reduced RNA polymerase subunit expression, polynucleotides and expression vectors for use in host cells with reduced RNA polymerase subunit expression, and host cells and methods for producing polypeptides of interest.

Description

[0001] Reference to Sequence Listing

[0002] This application contains a sequence listing in computer-readable form, which is incorporated herein by reference. BACKGROUND OF THE INVENTION FIELD OF THE INVENTION

[0004] The present invention relates to mutant host cells with reduced expression of RNA polymerase subunits, polynucleotides and expression vectors for reducing the expression of RNA polymerase subunits in host cells, and host cells and methods for producing a polypeptide of interest. BACKGROUND ART

[0005] Expressing recombinant genes in recombinant host cells, such as bacterial or fungal host cells, is a common method for producing recombinant proteins. Recombinant proteins produced in such systems are enzymes and other valuable proteins. For industrial and commercial purposes, the productivity of the cell system used (i.e., the total protein yield per fermentation unit) is an important factor in the production cost. Traditionally, increases in yield have been achieved by mutagenesis, signal peptide optimization, and screening of a large number of mutants with increased production of the protein of interest. However, this method is mainly only applicable to overproducing endogenous proteins in isolates containing the enzyme of interest. Therefore, for each new protein or enzyme product, a long strain and process development program is required to achieve improved productivity.

[0006] For the overexpression of heterologous proteins in recombinant host cell systems, the production process is considered a complex multi-stage and multi-component process. Cell growth and product formation are determined by a variety of parameters, including the composition of the medium, fermentation pH, fermentation temperature, dissolved oxygen tension, shear stress, and bacterial morphology.

[0007] Various methods have been used in bacteria to improve transcription. For the expression of heterologous genes, codon-optimized synthetic genes can improve the transcription rate (WO9923211, Novozymes A / S). To obtain high-level expression of a specific gene, a well-established procedure is to target multiple copies of the recombinant gene construct to the locus of a highly expressed endogenous gene.

[0008] However, multi-copy strains typically reach the expression limit of the host cell, after which the integration of additional copies of the recombinant gene does not further increase the recombinant yield.

[0009] At the molecular level, the expression of a polypeptide of interest can be divided into the following steps: i) transcription of the gene of interest from DNA into RNA, ii) translation of the RNA into a polypeptide, and iii) maturation and secretion of the polypeptide of interest.

[0010] During step i), RNA in all cellular organisms is synthesized by a complex molecular machine, the DNA-dependent RNA polymerase (RNAP or Rpo). In its simplest bacterial form, the enzyme consists of at least four subunits with a total molecular mass of approximately 400 kDa. Eukaryotic enzymes consist of more than a dozen subunits with a total molecular mass of approximately 500 kDa. From bacteria to eukaryotes (including fungal and mammalian cells), the bacterial core Rpo with catalytic ability (subunit composition: 2x RpoA (α), 1x RpoB (β), 1x RpoB' (β'), and 1x RpoZ (ω)) is evolutionarily conserved in terms of sequence, structure, and function (Borukhov & Nudler, Trends in Microbiology, 16(3), 2008, 126-134).

[0011] Despite these methods being proposed, further increasing the production of recombinant proteins in genetically modified host cells remains of continuing interest. The object of the present invention is to provide modified host cells and protein production methods with increased recombinant protein productivity and / or yield. Summary of the Invention

[0012] As disclosed herein, the inventors of the present invention have determined that, for increasing the yield during recombinant protein production, a bottleneck can be said to be that the transcriptional capacity of the host cell is not optimal. In other words, the formation of transcripts (RNA) of the polypeptide of interest must compete with all other transcriptional processes occurring in the host cell (i.e., all other transcribed genes in the host cell).

[0013] Surprisingly, the inventors have demonstrated that, for recombinant cells producing a recombinant protein of interest, a reduction in the expression of native RNA polymerase subunits improves the secretion and / or yield of the recombinant protein of interest. After reducing the expression of the RNA polymerase subunit α (RpoA), the recombinant protein yield was significantly increased, i.e., increased by 12%, when compared with the protein yield from host cells with unmodified RpoA expression, and the biomass formation was reduced by 18% when compared with the biomass formation of host cells with unmodified RpoA expression. As described in the examples, the inventors have determined that a reduction in RNAP subunit expression unexpectedly results in an increase in the yield of different classes of proteins of interest (amylase and protease). Thus, we expect these findings to also apply to other proteins of interest, such as other enzymes, and particularly other heterologous proteins. In addition, a reduction in RNA polymerase subunit expression results in a reduction in biomass formation (a reduction of 18%), which is beneficial in terms of fermentation, for example, due to less biomass to be removed per polypeptide product, resulting in higher efficiency in downstream processing and product formulation, which is completely unexpected.

[0014] Without wishing to be bound by any theory, a reduction in the expression of RNA polymerase subunits can address the transcription and / or translation bottleneck of a polypeptide of interest, particularly when the RNA transcript (mRNA) of the polypeptide of interest has good stability and / or when several copies of the gene of interest are integrated into the genome of the host cell, and thus provide an increased yield of the polypeptide of interest. Fine-tuning the expression of RNA polymerase subunits can ensure that, in proportion to the formation of the mRNA of other host cell genes, more RNA transcripts of the gene of interest can be generated, which results in an overall increase in the yield of the polypeptide of interest. In addition, a reduction in the expression of RNA polymerase subunits can unexpectedly be used as a tool to reduce biomass formation without compromising product yield or cell viability but rather actually increasing product yield simultaneously.

[0015] Accordingly, in a first aspect, the present invention relates to a mutant cell that comprises in its genome a first heterologous promoter operably linked to a first polynucleotide encoding a polypeptide of interest, and one or more second polynucleotides encoding one or more RNA polymerase (Rpo) subunit polypeptides, wherein the expression of the one or more Rpo subunit polypeptides is reduced or eliminated as compared to a non-mutated otherwise isogenic cell or a parental cell.

[0016] In a second aspect, the present invention relates to a method for producing one or more polypeptides of interest, the method comprising,

[0017] a) providing a mutant cell according to the first aspect,

[0018] b) culturing the cells under conditions conducive to the expression of the one or more polypeptides of interest; and

[0019] c) optionally recovering the one or more polypeptides of interest.

[0020] In a third aspect, the present invention relates to nucleic acid constructs that comprise a heterologous promoter and / or a mutated Shine-Dalgarno sequence operably linked to a second polynucleotide encoding one or more RNA polymerase (Rpo) subunit polypeptides.

[0021] In a fourth aspect, the present invention relates to expression vectors that comprise the nucleic acid constructs according to the third aspect.

[0022] Definitions

[0023] For the purposes of this detailed description, the following definitions apply. Note that the singular forms "a / an" and "the" include plural referents unless the context clearly dictates otherwise.

[0024] Unless otherwise defined or clearly indicated by the context, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0025] Amylase: The term "amylase" means a polypeptide having amylase activity, such as α - amylase (EC 3.2.1.1), which catalyzes the hydrolysis of 1,4 - α - glycosidic bonds in amylose and amylopectin. Non - limiting examples of amylases are the α - amylases shown in SEQ ID NO:7.

[0026] Amylase activity: Amylase activity can be determined in various ways known to those skilled in the art. For example, amylase activity can be measured by the assay described in the "enzymatic assay" section of the examples.

[0027] Bacterial RNA polymerase subunit: The term "bacterial RNA polymerase subunit" means any bacterial RNA polymerase subunit polypeptide selected from the list of subunits β (beta), β' (beta prime), α (alpha), and ω (omega).

[0028] Biomass: In the context of the present invention, the term "biomass" means the accumulation of cells during cultivation. For the fermentation of bacterial cells, the term "biomass" also includes spores and other cell structures. For the fermentation of fungal cells, the term "biomass" also includes hyphae and other cell structures. Biomass is typically measured as the dry weight or wet weight of a plurality of fungal cells. Additionally or alternatively, biomass can be measured by determining the optical density of the culture broth at a specific wavelength (e.g., at a wavelength of 650 nm for bacterial cell cultures).

[0029] cDNA: The term "cDNA" means a DNA molecule that can be prepared by reverse - transcribing mature, spliced mRNA molecules obtained from eukaryotic or prokaryotic cells. cDNA lacks the intron sequences that may be present in the corresponding genomic DNA. The initial primary RNA transcript is the precursor of mRNA, which is processed through a series of steps (including splicing) and then presented as mature, spliced mRNA.

[0030] Coding sequence: The term "coding sequence" means a polynucleotide that directly specifies the amino acid sequence of a polypeptide. The boundaries of a coding sequence are typically determined by an open reading frame that starts with a start codon (such as ATG, GTG, or TTG) and ends with a stop codon (such as TAA, TAG, or TGA). The coding sequence can be genomic DNA, cDNA, synthetic DNA, or a combination thereof.

[0031] Control sequence: The term "control sequence" means a nucleic acid sequence involved in regulating the expression of a polynucleotide in or outside a specific organism. Each control sequence can be native (i.e., from the same gene) or heterologous (i.e., from a different gene) to the polynucleotide encoding the polypeptide, and native or heterologous to each other. Such control sequences include, but are not limited to, leader sequences, polyadenylation sequences, propeptides, prepeptides, signal peptides, promoters, terminators, enhancers, and transcription or translation initiation and termination sequences. At a minimum, the control sequence includes a promoter and transcription and translation termination signals. A non-limiting example of a promoter is shown by the P3 promoter having SEQ ID NO:38. For the purpose of introducing specific restriction sites that facilitate the ligation of the control sequence to the coding region of the polynucleotide encoding the polypeptide, these control sequences may be provided with multiple linkers.

[0032] Eukaryotic RNA polymerase: The term "eukaryotic RNA polymerase" means any eukaryotic polymerase, including RNA polymerase I, RNA polymerase II, or RNA polymerase III, and also includes any subunit from a eukaryotic RNA polymerase.

[0033] Expression: The term "expression" means any step involved in the production of a polypeptide, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0034] Expression vector: An "expression vector" refers to a linear or circular DNA construct containing a DNA sequence encoding a polypeptide, the coding sequence being operably linked to suitable control sequences capable of affecting the expression of the DNA in a suitable host. Such control sequences may include a promoter that affects transcription, optional operator sequences that control transcription, a sequence encoding a suitable ribosome binding site on the mRNA, an enhancer, and sequences that control the termination of transcription and translation.

[0035] Extension: The term "extension" means adding one or more amino acids to the amino and / or carboxyl terminus of an RNA polymerase subunit polypeptide, where the "extended" subunit polypeptide modifies RNA polymerase activity, e.g., decreases RNA polymerase activity.

[0036] Fragment: The term "fragment" means a polypeptide in which one or more amino acids are absent from the amino and / or carboxyl terminus of the mature RNA polymerase subunit polypeptide, where the fragment modifies RNA polymerase activity, e.g., decreases RNA polymerase activity.

[0037] Fusion polypeptide: The term "fusion polypeptide" is a polypeptide in which one polypeptide is fused to the N-terminus and / or C-terminus of the polypeptide of the present invention. The fusion polypeptide is produced by fusing a polynucleotide encoding another polypeptide to the polynucleotide of the present invention or by fusing two or more polynucleotides of the present invention together. Techniques for producing fusion polypeptides are known in the art and include ligating the coding sequences encoding the polypeptides so that they are in frame and the expression of the fusion polypeptide is under the control of one or more identical promoters and terminators. Inteins can also be used to construct fusion polypeptides, where the fusion polypeptide is produced post-translationally (Cooper et al., 1993, EMBO J. 12:2575-2583; Dawson et al., 1994, Science 266:776-779). The fusion polypeptide may further comprise a cleavage site between the two polypeptides. At the time of secretion of the fusion protein, this site is cleaved, thereby releasing the two polypeptides. Examples of cleavage sites include, but are not limited to, those disclosed in Martin et al., 2003, J. Ind. Microbiol. Biotechnol. 3:568-576; Svetina et al., 2000, J. Biotechnol. 76:245-251; Rasmussen-Wilson et al., 1997, Appl. Environ. Microbiol. 63:3488-3493; Ward et al., 1995, Biotechnology 13:498-503; and Contreras et al., 1991, Biotechnology 9:378-381; Eaton et al., 1986, Biochemistry 25:505-512; Collins-Racie et al., 1995, Biotechnology 13:982-987; Carter et al., 1989, Proteins: Structure, Function, and Genetics 6:240-248; and Stevens, 2003, Drug Discovery World 4:35-48.

[0038] Gene: The term "gene", such as "rpoA gene", means a polynucleotide sequence that includes a polynucleotide sequence encoding a polypeptide product / POI (protein of interest), a promoter sequence, and a Shine-Dalgarno sequence (ribosome binding site, RBS) upstream of the polynucleotide sequence encoding the POI. Transcription of the gene and / or translation of the gene product can be modified, for example, by using different promoters and / or by using an altered Shine-Dalgarno sequence. As a non-limiting example, transcription of the rpoA gene can be modified by replacing the native promoter with a heterologous promoter. As another non-limiting example, translation of the RpoA polypeptide can be modified by providing a mutated Shine-Dalgarno sequence in the rpoA gene, the mutated Shine-Dalgarno sequence containing one or more nucleic acid substitutions in the native Shine-Dalgarno sequence of "AAGGAGG".

[0039] Heterologous: For a host cell, the term "heterologous" means that a polypeptide or nucleic acid is not naturally present in the host cell. For a polypeptide or nucleic acid, the term "heterologous" means that the control sequence (e.g., promoter) of the polypeptide or nucleic acid is not naturally associated with the polypeptide or nucleic acid, i.e., the control sequence is from a gene other than the gene encoding the mature polypeptide.

[0040] Host strain or host cell: "Host strain" or "host cell" refers to an organism into which an expression vector, phage, virus, or other DNA construct (including a polynucleotide encoding a polypeptide of interest (e.g., amylase)) has been introduced. Exemplary host strains are microbial cells (e.g., bacteria, filamentous fungi, and yeast) that are capable of expressing the polypeptide of interest and / or fermenting sugars. The term "host cell" includes protoplasts produced from the cell.

[0041] Introduce: In the case of inserting a nucleic acid sequence into a cell, the term "introduce" means "transfect", "transform", or "transduce", as known in the art.

[0042] Isogenic cell: In the context of a host cell, the term "isogenic" refers to parental or clonal host cells having substantially equal genotypes, e.g., parental host cells having substantially the same background mutations as the progeny cells, yet having specific differences due to the subsequent introduction of additional mutations or polynucleotides into the progeny cells, resulting in the progeny cells having the additional mutations and / or polynucleotides, but the progeny cells being isogenic to the parental cells in other respects.

[0043] Isolated: The term "isolated" means a polypeptide, nucleic acid, cell, or other specific material or component that has been separated from at least one other material or component (including but not limited to, other proteins, nucleic acids, cells, etc.). Thus, an isolated polypeptide, nucleic acid, cell, or other material is in a form not found in nature. Isolated polypeptides include, but are not limited to, culture broths containing secreted polypeptides expressed in host cells.

[0044] Mature polypeptide: The term "mature polypeptide" means a polypeptide in its mature form after N-terminal and / or C-terminal processing (e.g., removal of a signal peptide). In one aspect, the mature polypeptide is SEQ ID NO:3.

[0045] Native: The term "native" means a nucleic acid or polypeptide that naturally occurs in a host cell.

[0046] Nucleic acid: The term "nucleic acid" encompasses DNA, RNA, heteroduplexes, and synthetic molecules capable of encoding a polypeptide. The nucleic acid can be single-stranded or double-stranded and can be chemically modified. The terms "nucleic acid" and "polynucleotide" are used interchangeably. Because the genetic code is degenerate, more than one codon can be used to encode a particular amino acid, and the compositions and methods of the present invention encompass nucleotide sequences encoding a particular amino acid sequence. Unless otherwise specified, nucleic acid sequences are presented in the 5' to 3' orientation.

[0047] Nucleic acid construct: The term "nucleic acid construct" means a single-stranded or double-stranded nucleic acid molecule isolated from a naturally occurring gene or modified in a manner not otherwise found in nature to contain segments of nucleic acid or synthetic and comprising one or more control sequences operably linked to a nucleic acid sequence.

[0048] Operably linked: The term "operably linked" means that the designated components are in a relationship that allows them to function in the intended manner (including but not limited to juxtaposition). For example, a regulatory sequence is operably linked to a coding sequence such that the expression of the coding sequence is under the control of the regulatory sequence. In another example, an SD sequence is operably linked to a coding sequence such that both sequences will be transcribed into one mRNA.

[0049] Protease: The term "protease" means a polypeptide having protease activity that catalyzes the hydrolytic degradation of a protein or polypeptide into smaller amino acid polymers (EC 3.4.21.-). A non-limiting example of a protease is the polypeptide shown in SEQ ID NO:9.

[0050] Protease activity: Protease activity can be determined in various ways known to those skilled in the art. For example, protease activity can be measured by the assay described in the "Enzymatic assay" section of the examples.

[0051] Purified: The term "purified" means a nucleic acid, polypeptide, or cell that is substantially free of other components, as determined by analytical techniques well known in the art (e.g., a purified polypeptide or nucleic acid may form discrete bands in an electrophoretic gel, a chromatographic eluate, and / or a medium subjected to density gradient centrifugation). A purified nucleic acid or polypeptide is at least about 50% pure, typically at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5%, about 99.6%, about 99.7%, about 99.8%, or more pure (e.g., by weight or mole percentage). In a related sense, a composition is enriched in a molecule when the concentration of the molecule is significantly increased after applying purification or enrichment techniques. The term "enriched" means that a compound, polypeptide, cell, nucleic acid, amino acid, or other specified material or component is present in a composition at a relative or absolute concentration higher than that in the starting composition.

[0052] In one aspect, as used herein, the term "purified" means that a polypeptide or cell is substantially free of components from the production organism (especially insoluble components). In other aspects, the term "purified" means that a polypeptide is substantially free of insoluble components (especially insoluble components) from the native organism from which it is obtained. In one aspect, a polypeptide is separated from some soluble components of the organism and the medium from which it is recovered. A polypeptide can be purified (i.e., separated) by one or more of the unit operations of filtration, precipitation, or chromatography.

[0053] Accordingly, a polypeptide can be purified such that only small amounts of other proteins, especially other polypeptides, are present. As used herein, the term "purified" can refer to the removal of other components present in the cells from which the polypeptide is derived, especially other proteins and most especially other enzymes. A polypeptide can be "substantially pure", i.e., free of other components from the organism that produces it (e.g., the host organism used for recombinant production of the polypeptide). In one aspect, the polypeptide is at least 40% pure by weight of the total polypeptide material present in the preparation. In one aspect, the polypeptide is at least 50%, 60%, 70%, 80%, or 90% pure by weight of the total polypeptide material present in the preparation. As used herein, a "substantially pure polypeptide" can refer to a polypeptide preparation that contains at most 10%, preferably at most 8%, more preferably at most 6%, more preferably at most 5%, more preferably at most 4%, more preferably at most 3%, even more preferably at most 2%, most preferably at most 1%, and even most preferably at most 0.5% by weight of other polypeptide material associated with it natively or recombinantly.

[0054] Accordingly, preferably, on a weight basis of the total polypeptide material present in the formulation, the substantially pure polypeptide is at least 92% pure, preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 97% pure, more preferably at least 98% pure, even more preferably at least 99% pure, and most preferably at least 99.5% pure. The polypeptides of the present invention are preferably in substantially pure form (i.e., the formulation is substantially free of other polypeptide materials related to their native or recombinant origin). For example, this can be achieved by preparing the polypeptide using well-known recombinant methods or using classical purification methods.

[0055] Recombinant: The term "recombinant" is used in its conventional meaning and refers to the manipulation (e.g., cutting and rejoining) of nucleic acid sequences to form a sequence group different from the sequence groups found in nature. The term recombinant refers to a cell, nucleic acid, polypeptide, or vector that has been modified from its native state. Thus, for example, a recombinant cell expresses a gene not found within the cell in its native (non-recombinant) form, or expresses a native gene at a different level or under different conditions compared to that found in nature. The terms "recombinant" are synonymous with "genetically modified" and "transgenic".

[0056] Recovery: The term "recover or recovery" refers to the removal of a polypeptide from at least one fermentation broth component selected from the list of cells, nucleic acids, or other specified materials. For example, the polypeptide can be recovered from the whole fermentation broth or from a cell-free fermentation broth by methods such as polypeptide crystal harvesting, filtration (e.g., depth filtration (by using filter aids or packed filter media, cloth filtration in a cassette filter, drum filtration, rotary drum filtration, rotary vacuum drum filtration, candle filter, horizontal leaf filter, or the like, sheet or pad filtration in a frame or modular device) or membrane filtration (using plate filtration, module filtration, candle filtration, microfiltration, crossflow, dynamic crossflow, or dead-end operation of ultrafiltration)) or by centrifugation (using a horizontal centrifuge, disk stack centrifuge, hydro cyclone, or the like) or by precipitating the polypeptide and using related solid-liquid separation methods to harvest the polypeptide from the broth medium by using particle size fractionation. Recovery encompasses the separation and / or purification of the polypeptide.

[0057] RNA polymerase activity: The term "RNAP activity" or "RNA polymerase activity" means the ability to synthesize RNA molecules from a DNA template through the process of transcription.

[0058] As a non-limiting example, RNAP activity can be determined using a Rifampicin dilution assay, where RNAP activity is evaluated by determining rifampicin resistance, i.e., cell survival in the presence of rifampicin is associated with increased RNAP activity, while cell death in the presence of rifampicin is associated with decreased RNAP activity. Such an assay is shown in Example 6.

[0059] RNA polymerase subunit polypeptide: The term "RNA polymerase subunit polypeptide" or "RNAP subunit" or "Rpo subunit" means any subunit of RNA polymerase throughout the animal kingdom. RNA polymerases containing several subunits are involved in catalyzing the transcription of DNA into RNA using four ribonucleoside triphosphates as substrates. This reaction is also known as EC:2.7.7.6. RNA in all cellular organisms is synthesized by a complex molecular machine, the DNA-dependent RNA polymerase (RNAP or Rpo). In its simplest bacterial form, the enzyme contains at least four subunits with a total molecular mass of approximately 400 kDa. Eukaryotic enzymes contain more than a dozen subunits with a total molecular mass of approximately 500 kDa. From bacteria to eukaryotes (including fungal cells and mammalian cells), the bacterial core Rpo with catalytic ability (subunit composition: 2x RpoA (α), 1x RpoB (β), 1x RpoB' (β'), and 1x RpoZ (ω)) is evolutionarily conserved in terms of sequence, structure, and function, see Table 1 (Borukhov & Nudler, Trends in Microbiology [Advances in Microbiology], 16(3), 2008, 126 - 134).

[0060] Table 1: This table shows a comparison scheme of RNA polymerase subunits aligned according to sequence and / or functional homology (Barba-Aliaga et al., Front. Mol. Biosci. [Frontiers in Molecular Biosciences], April 21, 2021).

[0061]

[0062] RpoA polypeptide: The term "RpoA polypeptide" or "RNAP subunit α" or "RpoA subunit" means the DNA-directed RNA polymerase subunit α that is involved in catalyzing the transcription of DNA into RNA using four ribonucleoside triphosphates as substrates. This reaction is also known as EC:2.7.7.6. A non-limiting example of an RpoA polypeptide is the Bacillus licheniformis RpoA polypeptide shown in SEQ ID NO:2.

[0063] rpoA gene: The term "rpoA gene" means a polynucleotide sequence encoding the RNA polymerase subunit alpha polypeptide RpoA (such as DNA-directed RNA polymerase subunit alpha (EC 2.7.7.6), also known as RNAP subunit alpha). RpoA / RNAP subunit alpha is a DNA-dependent RNA polymerase that catalyzes the transcription of DNA into RNA using four ribonucleoside triphosphates as substrates. A non-limiting example of the rpoA gene is the rpoA gene from Bacillus licheniformis shown in SEQ ID NO:3, which contains the 7-nucleotide-long Shine-Dalgarno sequence "AAGGAGG" at the 5' end at positions 1-7 of SEQ ID NO:3. A non-limiting example of the RpoA polypeptide is the RpoA polypeptide from Bacillus licheniformis shown in SEQ ID NO:2.

[0064] The term "rpoA gene" includes the polynucleotide sequence upstream of the start codon "ATG", which includes the Shine-Dalgarno (SD) sequence "AAGGAGG", as shown in SEQ ID NO:3. During the transcription of the rpoA gene, the SD sequence is transcribed onto the mRNA together with the polynucleotide sequence encoding RpoA. The SD sequence is a ribosome binding site and is typically located 5-9 bases upstream of the start codon AUG. The SD RNA sequence helps recruit the ribosome to the mRNA by aligning the ribosome with the start codon to initiate protein synthesis. Mutations in the SD sequence can reduce or increase translation in the host cell, resulting in a decrease or increase in polypeptide levels, respectively (Veláquez et al., Journal of Bacteriology, May 1991, pp. 3261–3264). Therefore, modification of the SD sequence in the rpoA gene can reduce or increase the level of the RpoA polypeptide. This change is due to a decrease or increase in the pairing efficiency of rpoA mRNA with the ribosome. A non-limiting example of a mutated SD sequence is the mutated SD sequence in the rpoA gene of Bacillus licheniformis shown by the nucleotide sequence of SEQ ID NO:4, where G is replaced by A at the position corresponding to position 3 "G3A" of SEQ ID NO:3 (native SD + rpoA sequence). During translation, although this mutation affects the mRNA-ribosome pairing efficiency, the mutation does not impair the sequence of the mature RpoA polypeptide.

[0065] Homologs of RpoA in eukaryotic cells include RNA polymerase I subunits RPAC40 and RPAC19, RNA polymerase II subunits RPB3 and RPB11, and RNA polymerase III subunits RPAC40 and RPAC19 (see Table 1).

[0066] Sequence identity: The degree of relatedness between two amino acid sequences or two nucleotide sequences is described by the parameter "sequence identity".

[0067] For the purposes of the present invention, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453) is used to determine the sequence identity between two amino acid sequences as the output of "longest identity", which algorithm is implemented as in the Needle program of the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277, preferably version 6.6.0 or later). The parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (the EMBOSS version of BLOSUM62) substitution matrix. In order for the Needle program to report the longest identity, the non-simplified (-nobrief) option must be specified on the command line. The output of "longest identity" marked by Needle is calculated as follows:

[0068] (Identical residues × 100) / (Alignment length - total number of gaps in the alignment)

[0069] For the purposes of the present invention, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, ibid.) is used to determine the sequence identity between two polynucleotide sequences as the output of "longest identity", which algorithm is implemented as in the Needle program of the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, ibid.) (preferably version 6.6.0 or later). The parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EDNAFULL (the EMBOSS version of NCBI NUC4.4) substitution matrix. In order for the Needle program to report the longest identity, the non-simplified option must be specified on the command line. The output of "longest identity" marked by Needle is calculated as follows:

[0070] (Identical deoxyribonucleotides × 100) / (Alignment length – total number of gaps in the alignment)

[0071] Shine-Dalgarno sequence: The term "Shine-Dalgarno sequence" or "SD sequence" refers to the ribosome binding site on an RNA sequence, which is typically located 5-9 bases upstream of the start codon AUG in bacterial and archaeal cells. The SD RNA sequence helps recruit the ribosome to the mRNA by aligning the ribosome with the start codon to initiate protein synthesis. Mutations in the SD sequence can decrease or increase translation in the host cell, resulting in a decrease or increase in polypeptide levels, respectively (Veláquez et al., Journal of Bacteriology, May 1991, pp. 3261–3264). Thus, modification of the SD sequence in the rpo subunit gene can decrease or increase the level of the RPO subunit polypeptide. This change in the level of the RPO subunit is due to a decrease or increase in the pairing efficiency between the rpo subunit mRNA and the ribosome.

[0072] Mutated Shine-Dalgarno sequence: The term "mutated Shine-Dalgarno sequence" or "mutated SD sequence" refers to an SD sequence that contains one or more nucleic acid modifications, such as nucleic acid substitutions, nucleic acid deletions, or nucleic acid insertions. As described above, depending on the mutation, modification of the SD sequence can decrease or increase the translation of a gene located downstream of the modified or mutated SD sequence.

[0073] Signal peptide: A "signal peptide" is an amino acid sequence attached to the N-terminal portion of a protein that facilitates the secretion of the protein outside the cell. The mature form of an extracellular protein lacks the signal peptide, which is excised during the secretion process.

[0074] Subsequence: The term "subsequence" refers to a polynucleotide in which one or more nucleotides are deleted from the 5' end and / or 3' end of the mature RNA polymerase subunit polypeptide coding sequence; wherein the subsequence encodes a fragment of an RNA polymerase subunit that does not reduce RNA polymerase activity.

[0075] Therapeutic polypeptide: The term "therapeutic polypeptide" refers to any polypeptide or protein or variant thereof that is suitable for the treatment of human diseases or disorders or is suitable for veterinary medicine. Non-limiting examples of therapeutic polypeptides are antibody-based drugs, Fc fusion proteins, anticoagulants, blood factors, bone morphogenetic proteins, engineered protein scaffolds, enzymes, growth factors, hormones, interferons (such as interferon α-2b), interleukins, lactoferrin, α-lactalbumin, β-lactalbumin, ovomucoid, ovalbumin, cytokines, obestatin, human galactosidase (such as human α-galactosidase A), and thrombolytics.

[0076] Variant: The term "variant" means an RNA polymerase subunit polypeptide having RNA polymerase activity and containing engineered mutations (i.e., substitutions, insertions (including extensions) and / or deletions (e.g., truncations)) at one or more positions. Substitution means replacing the amino acid occupying a position with a different amino acid; deletion means removing the amino acid occupying a position; and insertion means adding 1-5 amino acids (e.g., 1-3 amino acids, especially 1 amino acid) adjacent to and immediately following the amino acid occupying a position.

[0077] Wild type: When referring to an amino acid sequence or a nucleic acid sequence, the term "wild type" means that the amino acid sequence or the nucleic acid sequence is a native or naturally occurring sequence. As used herein, the term "naturally occurring" refers to any substance found in nature (e.g., a protein, an amino acid or a nucleic acid sequence). In contrast, the term "non-naturally occurring" refers to any substance not found in nature (e.g., recombinant nucleic acid and protein sequences produced in the laboratory, or modifications of wild type sequences). Detailed Description

[0078] Overview of Sequence Information

[0079]

[0080]

[0081]

[0082] Reduced Expression of RNA Polymerase Subunits Reduced RNA polymerase activity in the host cell

[0083] In one aspect, the invention relates to a reduction in the transcription and / or translation of one or more RNA polymerase subunits, which results in a decrease in the total RNA polymerase (RNAP) activity. Studies have shown that reducing transcription and / or translation increases the yield of the polypeptide of interest in recombinant host cells, while also reducing biomass formation.

[0084] A decrease in RNAP activity and / or a decrease in the transcription and / or translation of one or more RNA polymerase subunits can be achieved, for example, by:

[0085] a) operably linking a second polynucleotide encoding an RNAP subunit to a second heterologous promoter that is weaker than the native promoter of the RNAP subunit encoding gene, for example, by replacing the native promoter with a weaker second heterologous promoter,

[0086] b) operably link the second polynucleotide to a mutated Shine-Dalgarno sequence that contains one or more nucleic acid modifications as compared to the native SD sequence of the RNAP subunit-encoding gene, wherein the mutated SD sequence results in weaker ribosome binding of RNA during translation of the RNAP subunit,

[0087] c) use CRISPRi, RNAi or other interference techniques known to the person skilled in the art to target the coding sequence of the RNAP subunit gene or its transcript during transcription or translation, respectively,

[0088] d) delete one or more genes encoding the RNAP subunit, and / or

[0089] e) introduce one or more mutations in one or more of these RNAP subunit genes to provide mutated RNAP subunits with reduced RNAP activity.

[0090] In certain embodiments, the second polynucleotide is operably linked to a second heterologous promoter, wherein transcription from the second heterologous promoter results in a decrease in transcription relative to transcription from the native promoter of the RNAP subunit-encoding gene, and wherein the SD sequence upstream of the RNAP subunit-encoding gene is not mutated.

[0091] The present invention relates to a reduction in the expression of one or more RNA polymerase (RNAP) subunit polypeptides. In one aspect, the present invention relates to a reduction in the expression of one or more RNAP subunit polypeptides selected from the group consisting of:

[0092] (a) polypeptides having at least 60% sequence identity to SEQ ID NO:2, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37 or SEQ ID NO:40;

[0093] (b) A polypeptide encoded by a polynucleotide that has at least 60% sequence identity with the mature polypeptide coding sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:36, or SEQ ID NO:39, or its cDNA sequence;

[0094] (c) A polypeptide derived from SEQ ID NO:2, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37, or SEQ ID NO:40 by substitution, deletion, or addition of one or several amino acids;

[0095] (d) A polypeptide derived from the polypeptide of (a), (b), or (c), wherein the N-terminus and / or C-terminus has been extended by addition of one or more amino acids; and

[0096] (e) A fragment of the polypeptide of (a), (b), (c), or (d).

[0097] In one aspect, the one or more RNAP subunit polypeptides have at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:2, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37 or SEQ ID NO:40.

[0098] The one or more RNAP subunit polypeptides preferably comprise, consist essentially of or consist of the amino acid sequence of SEQ ID NO:2, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37 or SEQ ID NO:40 or the amino acid sequence of its mature polypeptide.

[0099] The polypeptide may have an N-terminal and / or C-terminal extension of one or more amino acids, such as 1-5 amino acids.

[0100] In some embodiments, the second polynucleotide encoding the one or more RNA subunit polypeptides has at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:36 or SEQ ID NO:39 or its cDNA sequence.

[0101] The second polynucleotide preferably comprises, consists essentially of or consists of the nucleotide sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:36 or SEQ ID NO:39.

[0102] In another aspect, the RNAP subunit polypeptide is derived from SEQ ID NO:2, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37 or SEQ ID NO:40 by substitution, deletion or addition of one or several amino acids. In another aspect, the polypeptide is derived from the mature polypeptide of SEQ ID NO:2, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37 or SEQ ID NO:40 by substitution, deletion or addition of one or several amino acids. In one aspect, the number of amino acid substitutions, deletions and / or insertions introduced into the polypeptides of SEQ ID NO:2, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37 or SEQ ID NO:40 is at most 15, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15. The amino acid changes can be of a minor nature, i.e., conservative amino acid substitutions or insertions that do not significantly affect the folding and / or activity of the protein; typically small deletions of 1-30 amino acids; small amino-terminal or carboxyl-terminal extensions, such as a methionine residue at the amino terminus; small linker peptides of up to 20-25 residues; or small extensions that facilitate purification by altering the net charge or another function (such as a polyhistidine segment, an epitope or a binding module).

[0103] Essential amino acids in a polypeptide can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, 1989, Science 244:1081-1085). In the latter technique, a single alanine mutation is introduced at each residue in the molecule, and the RNA polymerase activity of the resulting molecule is tested to identify the amino acid residues critical for the activity of the molecule. See also, Hilton et al., 1996, J. Biol. Chem. 271:4699-4708. The active site of an enzyme or other biological interaction can also be determined by physical analysis of the structure, as determined by techniques such as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, along with mutagenesis of putative contact-site amino acids. See, for example, de Vos et al., 1992, Science 255:306-312; Smith et al., 1992, J. Mol. Biol. 224:899-904; Wlodaver et al., 1992, FEBS Lett. 309:59-64. The identity of essential amino acids can also be inferred from alignment with related polypeptides, and / or from sequence homology and conserved catalytic mechanisms with related polypeptides or polypeptides / proteins within a polypeptide or protein family that share a common ancestor (typically having similar three-dimensional structures, functions, and significant sequence similarity). Additionally or alternatively, protein structure prediction tools can be used for protein structure modeling to identify essential amino acids and / or active sites of a polypeptide. See, for example, Jumper et al., 2021, “Highly accurate protein structure prediction with AlphaFold”, Nature 596:583-589.

[0104] Using known mutagenesis, recombination, and / or shuffling methods, followed by relevant screening procedures, single or multiple amino acid substitutions, deletions, and / or insertions can be made and tested, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241:53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86:2152-2156; WO 95 / 17413; or WO 95 / 22625. Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991, Biochemistry 30:10832-10837; US 5,223,409; WO 92 / 06204), and site-directed mutagenesis (Derbyshire et al., 1986, Gene 46:145; Ner et al., 1988, DNA 7:127).

[0105] The mutagenesis / shuffling methods can be combined with high-throughput, automated screening methods to detect the activity of the cloned, mutagenized polypeptides expressed by the host cells (Ness et al., 1999, Nature Biotechnology 17:893-896). The mutagenized DNA molecules encoding the active polypeptides can be recovered from the host cells and rapidly sequenced using standard methods in the art. These methods allow for the rapid determination of the importance of individual amino acid residues in the polypeptide.

[0106] The RNAP subunit polypeptide can be a fusion polypeptide.

[0107] Host cell

[0108] The present invention also relates to recombinant host cells that comprise a polynucleotide of the present invention operably linked to one or more control sequences that direct the production of the polypeptide of the present invention.

[0109] A construct or vector comprising a polynucleotide is introduced into a host cell such that the construct or vector is maintained as a chromosomal integrant or as a self-replicating extrachromosomal vector, as described earlier. The choice of host cell will depend to a large extent on the gene encoding the polypeptide of interest and its source. The polypeptide of interest can be native or heterologous to the recombinant host cell. In addition, at least one of the one or more control sequences can be heterologous to the first polynucleotide encoding the polypeptide of interest. Additionally or alternatively, the one or more control sequences can be operably linked to a second polynucleotide, preferably heterologous to the second polynucleotide. The recombinant host cell can comprise a single copy or at least two copies of the first polynucleotide encoding the polypeptide of interest, such as at least three, at least four, at least five, at least six or more copies. Additionally or alternatively, the recombinant host cell can comprise a single copy or at least two copies of the second polynucleotide encoding the RNAP subunit polypeptide, such as at least three, at least four, at least five, at least six or more copies.

[0110] The host cell can be any microbial cell useful for the recombinant production of the polypeptide of interest, such as a prokaryotic cell or a fungal cell.

[0111] According to a first aspect, the present invention relates to a mutant cell that comprises in its genome a first heterologous promoter operably linked to a first polynucleotide encoding a polypeptide of interest, and one or more second polynucleotides encoding one or more RNA polymerase (Rpo) subunit polypeptides, wherein the expression of the one or more Rpo subunit polypeptides is reduced or eliminated compared to a non-mutated isogenic cell or parental cell in other respects.

[0112] In one embodiment, the second polynucleotide is operably linked to a second heterologous promoter.

[0113] In one embodiment, the second polynucleotide is operably linked to a mutated Shine-Dalgarno sequence derived from the parental Shine-Dalgarno sequence.

[0114] In another embodiment, the second polynucleotide comprises one or more nucleic acid insertions, deletions or substitutions.

[0115] In one embodiment, the expression of the second polynucleotide is reduced by a CRISPR inhibition construct.

[0116] In another embodiment, the expression of the second polynucleotide is reduced by RNA interference.

[0117] In one embodiment, the parental Shine-Dalgarno sequence has at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the polynucleotide sequence of AAGGAGG or with SEQ ID NO:58.

[0118] In one embodiment, the second polynucleotide is native to the cell.

[0119] In one embodiment, the cell comprises at least two second polynucleotides, such as at least three or at least four second polynucleotides, each second polynucleotide encoding an RNA polymerase subunit polypeptide.

[0120] In one embodiment, one or more of the RNA polymerase subunit polypeptides are one or more bacterial RNA polymerase subunit polypeptides selected from the list of subunit β (beta), subunit α (alpha) and subunit ω (omega).

[0121] In one embodiment, one or more of the second polynucleotides encode one or more bacterial RNA polymerase subunit α (alpha) RpoA.

[0122] In one embodiment, one or more of the second polynucleotides encode one or more bacterial RNA polymerase subunit β (beta) RpoB.

[0123] In one embodiment, one or more of the second polynucleotides encode one or more bacterial RNA polymerase subunit β' (beta') RpoB'.

[0124] In one embodiment, one or more of the second polynucleotides encode one or more bacterial RNA polymerase subunit ω (omega) RpoZ.

[0125] In one embodiment, one or more primary second polynucleotides encode one or more bacterial RNA polymerase subunit α (alpha) RpoA, and one or more secondary second polynucleotides encode one or more bacterial RNA polymerase subunit β (beta) RpoB and / or (β') RpoB'.

[0126] In one embodiment, one or more primary second polynucleotides encode one or more bacterial RNA polymerase subunit α (alpha) RpoA, and one or more secondary second polynucleotides encode one or more bacterial RNA polymerase subunit ω (omega) RpoZ.

[0127] In one embodiment, one or more first - level second polynucleotides encode one or more bacterial RNA polymerase subunit beta (β) RpoB, and one or more second - level second polynucleotides encode one or more bacterial RNA polymerase subunit omega (ω) RpoZ.

[0128] In one embodiment, one or more first - level second polynucleotides encode one or more bacterial RNA polymerase subunit beta - prime (β') RpoB', and one or more second - level second polynucleotides encode one or more bacterial RNA polymerase subunit omega (ω) RpoZ.

[0129] In one embodiment, one or more first - level second polynucleotides encode one or more bacterial RNA polymerase subunit alpha (α) RpoA, one or more second - level second polynucleotides encode one or more bacterial RNA polymerase subunit beta (β) RpoB and / or (β') RpoB', and one or more third - level second polynucleotides encode one or more bacterial RNA polymerase subunit omega (ω) RpoZ.

[0130] In one embodiment, a second polynucleotide, such as a first - level, second - level, or third - level second polynucleotide, encodes an RpoA polypeptide comprising or consisting of an amino acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:2.

[0131] In one embodiment, a second polynucleotide, such as a first - level, second - level, or third - level second polynucleotide, encodes an RpoA polypeptide and comprises or consists of a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the nucleic acid sequence of SEQ ID NO:1.

[0132] In one embodiment, a second polynucleotide, such as a primary, secondary, or tertiary second polynucleotide, encodes an RpoB polypeptide comprising or consisting of an amino acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:11.

[0133] In one embodiment, a second polynucleotide, such as a primary, secondary, or tertiary second polynucleotide, encodes an RpoB polypeptide and comprises or consists of a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the nucleic acid sequence of SEQ ID NO:10.

[0134] In one embodiment, a second polynucleotide, such as a primary, secondary, or tertiary second polynucleotide, encodes an RpoB' polypeptide comprising or consisting of an amino acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:40.

[0135] In one embodiment, a second polynucleotide, such as a primary, secondary, or tertiary second polynucleotide, encodes an RpoB' polypeptide and comprises or consists of a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the nucleic acid sequence of SEQ ID NO:39.

[0136] In one embodiment, a second polynucleotide, such as a primary, secondary, or tertiary second polynucleotide, encodes an RpoZ polypeptide comprising or consisting of an amino acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:13.

[0137] In one embodiment, a second polynucleotide, such as a primary, secondary, or tertiary second polynucleotide, encodes an RpoZ polypeptide and comprises or consists of a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the nucleic acid sequence of SEQ ID NO:12.

[0138] In one embodiment, the second polynucleotide is heterologous to the cell.

[0139] In one embodiment, the first polynucleotide is operably linked to one or more promoters that direct the production of the polypeptide of interest, preferably, the promoter is heterologous to the first polynucleotide.

[0140] In one embodiment, the heterologous promoter comprises or consists of a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the nucleic acid sequence of SEQ ID NO:38.

[0141] In one embodiment, the cell contains at least two copies of the first polynucleotide in its genome, such as at least three, at least four, or at least five, or at least six or more copies.

[0142] In one embodiment, one or more RNA polymerase subunit polypeptides are one or more archaeal RNA polymerase subunit polypeptides selected from the following list: Rpo1, Rpo2, Rpo3, Rpo11, Rpo4, Rpo5, Rpo6, Rpo8, Rpo10, Rpo12, Rpo7, or Rpo13.

[0143] In one embodiment, one or more RNA polymerase subunit polypeptides are subunit polypeptides of eukaryotic RNA polymerase I, RNA polymerase II, and / or RNA polymerase III.

[0144] In one embodiment, one or more RNA polymerase subunit polypeptides are one or more eukaryotic RNA polymerase I subunit polypeptides selected from the following list: RPA190, RPBA135, RPAC40 (AC40), RPAC19 (AC19), RPB6, RPB5, RPB8, RPB10, RPB12, RPA14, RPA43, RPA12, RPA49, and RPA34.5.

[0145] In one embodiment, one or more RNA polymerase subunit polypeptides are one or more eukaryotic RNA polymerase subunit polypeptides selected from the following list: RPAC40 (AC40), RPAC19 (AC19), RPO3, RPO11, RPB3, and RPB11.

[0146] In one embodiment, the second polynucleotide encodes an RPAC40 (AC40) polypeptide and comprises or consists of a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the nucleic acid sequence of SEQ ID NO: 14, SEQ ID NO: 16, or SEQ ID NO: 18.

[0147] In one embodiment, one or more RNA polymerase subunit polypeptides are one or more eukaryotic RNA polymerase I subunit polypeptides selected from the following list: RPA190, RPBA135, RPAC40 (AC40), RPAC19 (AC19), RPB6, RPB5, RPB8, RPB10, RPB12, RPA14, RPA43, RPA12, RPA49, and RPA34.5.

[0148] In one embodiment, the second polynucleotide encodes an RPAC40 (AC40) polypeptide comprising or consisting of an amino acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 15, SEQ ID NO: 17, or SEQ ID NO: 19.

[0149] In one embodiment, the second polynucleotide encodes an RPAC19 (AC19) polypeptide and comprises or consists of: a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleic acid sequence of SEQ ID NO:20, SEQ ID NO:22 or SEQ ID NO:24.

[0150] In one embodiment, the second polynucleotide encodes an RPAC19 (AC19) polypeptide comprising or consisting of: an amino acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO:21, SEQ ID NO:23 or SEQ ID NO:25.

[0151] In one embodiment, one or more RNA polymerase subunit polypeptides are one or more eukaryotic RNA polymerase II subunit polypeptides selected from the following list: RPB1, RPB2, RPB3, RPB11, RPB6, RPB5, RPB8, RPB10, RPB12, RPB4, RPB7, RPB9, TFIIFα and TFIIFβ.

[0152] In one embodiment, the second polynucleotide encodes an RPB3 polypeptide and comprises or consists of: a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleic acid sequence of SEQID NO:26, SEQ ID NO:28 or SEQ ID NO:30.

[0153] In one embodiment, the second polynucleotide encodes an RPB3 polypeptide comprising or consisting of an amino acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO:27, SEQ ID NO:29 or SEQ ID NO:31.

[0154] In one embodiment, the second polynucleotide encodes an RPB11 polypeptide and comprises or consists of a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleic acid sequence of SEQ ID NO:32, SEQ ID NO:34 or SEQ ID NO:36.

[0155] In one embodiment, the second polynucleotide encodes an RPB11 polypeptide comprising or consisting of an amino acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO:33, SEQ ID NO:35 or SEQ ID NO:37.

[0156] In one embodiment, one or more RNA polymerase subunit polypeptides are one or more eukaryotic RNA polymerase III subunit polypeptides selected from the list: RPC160, RPC128, RPAC40 (AC40), RPAC19 (AC19), RPB6, RPB5, RPB8, RPB10, RPB12, RPC17, RPC25, RPC11, RPC53, RPC37, RPC82, RPC34 and RPC31.

[0157] In one embodiment, one or more RNA polymerase subunit polypeptides are one or more yeast RNA polymerase subunit polypeptides selected from the list: Rpb5 (ABC27), Rpb6 (ABC23 or Rpo26), Rpb8 (ABC14.5), Rpb10 (ABC10β) and Rpb12 (ABC10α).

[0158] In one embodiment, one or more RNA polymerase subunit polypeptides comprise an N-terminal extension and / or a C-terminal extension of 1 to 10 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids, preferably, and an extension of 1 to 6 amino acid residues in the N-terminal and / or 1 to 6 amino acids in the C-terminal, such as 1-5, or 1-4, or 1-3, or 1-2 amino acids, and wherein the extended polypeptide has RNA polymerase activity.

[0159] In one embodiment, the cell is a eukaryotic cell.

[0160] In one embodiment, the cell is a mammalian cell.

[0161] In one embodiment, the cell is a prokaryotic cell.

[0162] In one embodiment, the cell is a yeast recombinant host cell, such as, for example, a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell, such as Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, Saccharomyces oviformis, or Yarrowia lipolytica cell.

[0163] In one embodiment, the cell is a filamentous fungal recombinant host cell, such as, for example, an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filobasidium, Fusarium, Humicola, Monilia, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, or Trichoderma cell, in particular, an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium tropicum, Chrysosporium merdarium, Coprinus cinereus, Coriolus hirsutus, Fusarium bacillisporum, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium proliferatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Talaromyces emersonii, Thermoascus aurantiacus, Thielavia terrestris, Trichoderma longibrachiatum, Trichoderma versicolor, Trichoderma viride, or Trichoderma reesei cell.

[0164] In one embodiment, the cell is an Aspergillus cell.

[0165] In one embodiment, the cell is an Aspergillus niger cell.

[0166] In one embodiment, the cell is an Aspergillus oryzae cell.

[0167] In one embodiment, the cell is a Trichoderma cell.

[0168] In one embodiment, the cell is a Trichoderma reesei cell.

[0169] In one embodiment, the cell is a prokaryotic recombinant host cell, e.g., a Gram-positive cell selected from the group consisting of Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus, or Streptomyces cells, or a Gram-negative bacterium selected from the group consisting of Campylobacter, Escherichia coli, Flavobacterium, Fusobacterium, Helicobacter, Pelobacter, Neisseria, Pseudomonas, Salmonella, and Ureaplasma cells, such as Bacillus alcalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis, Bacillus thuringiensis, Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus agalactiae, and Streptococcus zooepidemicus, Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus, and Streptomyces lividans cells.

[0170] In one embodiment, the cell is a Bacillus cell.

[0171] In one embodiment, the cell is a Bacillus licheniformis cell.

[0172] In one embodiment, the cell is a Bacillus subtilis cell.

[0173] In one embodiment, the cell is isolated.

[0174] In one embodiment, the cell is purified.

[0175] In one embodiment, relative to the transcription of a second polynucleotide when operably linked to its native or endogenous promoter, a second heterologous promoter operably linked to the second polynucleotide results in a decrease in the transcription of the second polynucleotide.

[0176] In one embodiment, relative to the transcription of a second polynucleotide when operably linked to its native or endogenous Shine-Dalgarno sequence, a mutated Shine-Dalgarno sequence operably linked to the second polynucleotide results in a decrease in the transcription of the second polynucleotide.

[0177] In one embodiment, the polypeptide of interest comprises an enzyme; preferably, the enzyme is selected from the group consisting of: hydrolase, isomerase, ligase, lyase, oxidoreductase, or transferase; more preferably, it is aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, α-galactosidase, β-galactosidase, α-glucosidase, β-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, nuclease, oxidase, pectinolytic enzyme, peroxidase, phosphodiesterase, phytase, polyphenol oxidase, proteolytic enzyme, ribonuclease, transglutaminase, xylanase, and β-xylosidase; even more preferably, the one or more polypeptides of interest comprise amylase or protease.

[0178] In one embodiment, the polypeptide of interest comprises a therapeutic polypeptide selected from the group consisting of: antibody, antibody fragment, antibody-based drug, Fc fusion protein, anticoagulant, blood factor, bone morphogenetic protein, engineered protein scaffold, enzyme, growth factor, clotting factor, hormone, interferon (such as interferon α-2b), interleukin, lactoferrin, α-lactalbumin, β-lactalbumin, ovomucoid, ovalbumin, cytokine, obestatin, human galactosidase (such as human α-galactosidase A), vaccine, protein vaccine, and thrombolytic agent.

[0179] In one embodiment, the polypeptide of interest comprises a nanobody (Nb); preferably, the nanobody consists of a single variable light chain (VL).

[0180] In one embodiment, the first polynucleotide encodes a polypeptide having amylase activity and comprises or consists of the following: a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the nucleic acid sequence of SEQ ID NO:6.

[0181] In one embodiment, the polypeptide of interest is amylase, such as amylase comprising or consisting of a mature polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the amino acid sequence of SEQ ID NO:7.

[0182] In one embodiment, the first polynucleotide encodes a polypeptide having protease activity and comprises or consists of: a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the nucleic acid sequence of SEQ ID NO:8.

[0183] In one embodiment, the polypeptide of interest is a protease, such as a protease comprising or consisting of a mature polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO:9.

[0184] In one embodiment, when cultured under the same conditions, the expression of one or more Rpo subunit polypeptides is reduced by at least 10%, such as at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90% or at least 95% compared to the expression of one or more Rpo subunit polypeptides of the parental cell.

[0185] In one embodiment, the mutated Shine-Dalgarno sequence comprises the following nucleic acid substitutions at the position corresponding to position 5 of the parental Shine-Dalgarno sequence having the nucleic acid sequence of SEQ ID NO:58: adenine (A), G5A; cytosine (C), G5C; or thymine (T), G5T.

[0186] In one embodiment, the mutated Shine-Dalgarno sequence comprises at least one nucleic acid substitution, insertion and / or deletion at one or more nucleotide positions corresponding to positions 1 to 7 of the nucleic acid sequence "AAGGAGG", or at one or more nucleotide positions of the nucleic acid sequence at positions 1 - 7 of SEQ ID NO:3.

[0187] In one embodiment, the mutated Shine-Dalgarno sequence comprises at least one nucleic acid substitution, insertion and / or deletion at one or more nucleotide positions of the nucleic acid sequences "GAGGGGTG", "AAGGGAG" or "GGAGGTTG".

[0188] In one embodiment, the mutated Shine-Dalgarno sequence comprises at least one nucleic acid substitution, insertion, and / or deletion at a position corresponding to position 3 of the nucleic acid sequence "AAGGAGG", or at a position of the nucleic acid sequence at positions 1-7 of SEQ ID NO:3.

[0189] In one embodiment, the mutated Shine-Dalgarno sequence comprises the following nucleic acid substitutions at a position corresponding to position 3 of the nucleic acid sequence "AAGGAGG": adenine (A), G3A; cytosine (C), G3C; or thymine (T), G3T.

[0190] In one embodiment, the mutated Shine-Dalgarno sequence comprises the following nucleic acid substitution at a position corresponding to position 3 of the nucleic acid sequence "AAGGAGG": adenine (A), G3A.

[0191] In one embodiment, the mutated Shine-Dalgarno sequence comprises or consists of: a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the nucleic acid sequence of "AAAGAGG" or with the nucleic acid sequence at positions 1-7 of SEQ ID NO:4.

[0192] In one embodiment, the mutated Shine-Dalgarno sequence comprises or consists of: the nucleic acid sequence of "AAAGAGG" or the nucleic acid sequence at positions 1-7 of SEQ ID NO:4.

[0193] In one embodiment, the second polynucleotide is operably linked to the mutated Shine-Dalgarno sequence, thereby forming a coding nucleic acid sequence that comprises or consists of: a coding nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the nucleic acid sequence of "AAGGAGG" or "AAAGAGG", or with the nucleic acid sequence at positions 1-7 of SEQ ID NO:3 or 4, or with the nucleic acid sequence of "GAGGGGTG", "AAGGGAG", or "GGAGGTTG".

[0194] In one embodiment, when cultured under the same conditions, transcription and / or translation of the second polynucleotide is reduced compared to the parental cell.

[0195] In one embodiment, the transcription and / or translation of the second polynucleotide (RNAP subunit) is reduced by at least 1%, such as at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% relative to the transcription and / or translation of the RNAP subunit of the parental cell.

[0196] In one embodiment, the transcription and / or translation of the second polynucleotide (RNAP subunit) is reduced relative to the transcription and / or translation of the parental cell after culturing for at least 24 hours, such as at least 48 hours, at least 72 hours, at least 96 hours, at least 120 hours or at least 144 hours.

[0197] In one embodiment, the yield of the polypeptide of interest is increased compared to the parental cell when cultured under the same conditions.

[0198] In one embodiment, the yield of the polypeptide of interest is increased by at least 1% relative to the yield of the parental cell, such as at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34% or at least 35%.

[0199] In one embodiment, the yield of the polypeptide of interest is increased by at least 12% relative to the yield of the parental cell.

[0200] In one embodiment, after culturing for at least 24 hours, such as at least 48 hours, at least 72 hours, at least 96 hours, at least 120 hours or at least 144 hours, the yield of the polypeptide of interest is increased relative to the yield of the parental cell.

[0201] In one embodiment, during cell culture, when cultured under the same conditions, the biomass is reduced relative to the biomass during the parental cell culture.

[0202] In one embodiment, the biomass is reduced by at least 1% relative to the biomass of the parental cell, such as at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34% or at least 35%.

[0203] In one embodiment, the biomass formation is reduced by at least 18% relative to the biomass formation of the parental cell.

[0204] In one embodiment, after culturing for at least 24 hours, such as at least 48 hours, at least 72 hours, at least 96 hours, at least 120 hours or at least 144 hours, the biomass is reduced relative to the biomass of the parental cell.

[0205] In one embodiment, the culturing is a fed-batch, batch or continuous culturing method, preferably a fed-batch culturing method.

[0206] The prokaryotic host cell can be any Gram-positive or Gram-negative bacterium. Gram-positive bacteria include, but are not limited to: Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus, and Streptomyces. Gram-negative bacteria include, but are not limited to: Campylobacter, Escherichia coli, Flavobacterium, Fusobacterium, Helicobacter, Pelobacter, Neisseria, Pseudomonas, Salmonella, and Ureaplasma.

[0207] The bacterial host cell can be any Bacillus cell, including, but not limited to: Bacillus alcalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis cells. In the examples, the Bacillus cells are Bacillus amyloliquefaciens, Bacillus licheniformis, and Bacillus subtilis cells.

[0208] For the purposes of the present invention, Bacillus species / genus / species shall be defined as described in Patel and Gupta, 2020, Int. J. Syst. Evol. Microbiol. [International Journal of Systematic and Evolutionary Microbiology] 70:406-438.

[0209] The bacterial host cell can also be any Streptococcus cell, including, but not limited to: Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis, and Streptococcus zooepidemicus cells.

[0210] The bacterial host cell can also be any Streptomyces cell, including, but not limited to: Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus, and Streptomyces lividans cells.

[0211] Methods for introducing DNA into prokaryotic host cells are well known in the art and any suitable method can be used, including but not limited to protoplast transformation, competent cell transformation, electroporation, conjugation, transduction, wherein the DNA is introduced as a linearized or circular polynucleotide. Those skilled in the art will be able to readily identify a suitable method for introducing DNA into a given prokaryotic cell depending, for example, on the genus. Methods for introducing DNA into prokaryotic host cells are described, for example, in Heinze et al., 2018, BMC Microbiology 18:56, Burke et al., 2001, Proc. Natl. Acad. Sci. USA 98:6289-6294, Choi et al., 2006, J. Microbiol. Methods 64:391-397, and Donald et al., 2013, J. Bacteriol. 195(11):2612-2620.

[0212] The host cell can be a fungal cell. "Fungi" as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota, as well as the Oomycota and all mitosporic fungi (as defined in, for example, Hawksworth et al., Ainsworth and Bisby’s Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK).

[0213] Fungal cells can be transformed by processes involving protoplast-mediated transformation, Agrobacterium-mediated transformation, electroporation, gene gun methods, and shock wave-mediated transformation (as reviewed in Li et al., 2017, Microbial Cell Factories 16:168) and by the procedures described in EP 238023, Yelton et al., 1984, Proc. Natl. Acad. Sci. USA 81:1470-1474; Christensen et al., 1988, Bio / Technology 6:1419-1422, and Lubertozzi and Keasling, 2009, Biotechn. Advances 27:53-75. However, any method known in the art for introducing DNA into a fungal host cell can be used, and the DNA can be introduced as a linearized or circular polynucleotide.

[0214] The fungal host cell can be a yeast cell. "Yeast" as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the Fungi Imperfecti (Blastomycetes). For the purposes of the present invention, yeast shall be defined as described in Biology and Activities of Yeast (edited by Skinner, Passmore, and Davenport, Soc. App. Bacteriol. Symposium Series No. 9, 1980).

[0215] The yeast host cell can be a cell of the genus Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces or Yarrowia, such as Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, Saccharomyces oviformis or Yarrowia lipolytica cells. In a preferred embodiment, the yeast host cell is a Pichia or Komagataella cell, such as Pichia pastoris cells (Komagataella phaffii).

[0216] The fungal host cell can be a filamentous fungal cell. "Filamentous fungi" includes all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra). Filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic. In contrast, vegetative growth of yeasts, such as Saccharomyces cerevisiae, is by budding of single cells and carbon catabolism can be fermentative.

[0217] The filamentous fungal host cell may be a cell of Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma. In a preferred embodiment, the filamentous fungal host cell is a cell of Aspergillus, Trichoderma, or Fusarium. In another preferred embodiment, the filamentous fungal host cell is an Aspergillus niger, Aspergillus oryzae, Trichoderma reesei, or Fusarium venenatum cell.

[0218] For example, the filamentous fungal host cell can be Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus, Coriolus hirsutus, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusariumsulphureum), Fusarium torulosum, Fusarium trichothecioides, Fusarium lamelliforme, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Talaromyces emersonii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei or Trichoderma viride cells.

[0219] In one aspect, the host cell is isolated.

[0220] In another aspect, the host cell is purified.

[0221] Production method

[0222] In a second aspect, the present invention relates to a method for producing one or more polypeptides of interest, the method comprising:

[0223] a) providing a mutant cell according to the first aspect,

[0224] b) culturing the cells under conditions conducive to the expression of the one or more polypeptides of interest; and

[0225] c) optionally, recovering the one or more polypeptides of interest.

[0226] The host cells are cultured in a nutrient medium suitable for producing polypeptides using methods known in the art. For example, the cells can be cultured by shake flask culture or by small-scale or large-scale fermentation (including continuous, batch, fed-batch or solid-state and / or microcarrier-based fermentations) in a suitable medium and under conditions that permit the expression and / or isolation of the polypeptide in a laboratory or industrial fermentor. Suitable media can be obtained from commercial suppliers or can be prepared according to published compositions (e.g., in the catalog of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, then the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, then it can be recovered from the cell lysate.

[0227] Polypeptides can be detected using methods specific for polypeptides known in the art, including but not limited to the use of specific antibodies, enzyme product formation, enzyme substrate disappearance, or assays that measure the relative or specific activity of the polypeptide.

[0228] Polypeptides can be recovered from the medium using methods known in the art, including but not limited to collection, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation. In one aspect, the whole fermentation broth containing the polypeptide is recovered. In another aspect, the cell-free fermentation broth containing the polypeptide is recovered.

[0229] Polypeptides can be purified by a variety of procedures known in the art to obtain substantially pure polypeptides and / or polypeptide fragments (see, e.g., Wingfield, 2015, Current Protocols in Protein Science; 80(1):6.1.1 - 6.1.35; Labrou, 2014, Protein Downstream Processing, 1129:3 - 10).

[0230] In an alternative aspect, the polypeptide is not recovered.

[0231] Polynucleotide

[0232] The invention also relates to one or more second polynucleotides encoding the RNAP subunit polypeptides of the invention, as described herein.

[0233] The second polynucleotide can be operably linked to a second heterologous promoter.

[0234] Additionally or alternatively, the second polynucleotide can be operably linked to a mutated SD sequence.

[0235] The mutated SD sequence and / or the second heterologous promoter are located upstream of the second polynucleotide.

[0236] The second polynucleotide, second heterologous promoter, and / or mutated SD sequence can be genomic DNA, cDNA, synthetic DNA, synthetic RNA, mRNA, or a combination thereof. The second polynucleotide and / or mutated SD sequence can be cloned from a strain of the genus Bacillus, Trichoderma, Aspergillus, or related organisms.

[0237] In one embodiment, the second polynucleotide and / or mutated SD sequence of the present invention is isolated from Bacillus licheniformis cells.

[0238] In one embodiment, the second polynucleotide and / or mutated SD sequence of the present invention is isolated from Bacillus subtilis cells.

[0239] In one embodiment, the second polynucleotide and / or mutated SD sequence of the present invention is isolated from Aspergillus niger cells.

[0240] In one embodiment, the second polynucleotide and / or mutated SD sequence of the present invention is isolated from Aspergillus oryzae cells.

[0241] In one embodiment, the second polynucleotide and / or mutated SD sequence of the present invention is isolated from Trichoderma reesei cells.

[0242] The mutated SD sequence is mutated by introducing nucleotide substitutions, insertions, or deletions that do not result in a change in the amino acid sequence of the RNAP subunit polypeptide.

[0243] Additionally or alternatively, the second polynucleotide sequence is mutated by introducing nucleotide substitutions, insertions, or deletions that do not result in a change in the amino acid sequence of the RNAP subunit polypeptide but correspond to the codon usage of the host organism intended for the production of the polypeptide of interest, or by introducing nucleotide substitutions that result in a different amino acid sequence. For a general description of nucleotide substitutions, see, for example, Ford et al., 1991, Protein Expression and Purification 2:95-107.

[0244] In one aspect, the polynucleotide is isolated.

[0245] In another aspect, the polynucleotide is purified.

[0246] Nucleic acid construct

[0247] The present invention also relates to a nucleic acid construct comprising the polynucleotide of the present invention, wherein the polynucleotide is operably linked to one or more control sequences that direct the expression of the RNAP subunit coding sequence in a suitable host cell under conditions compatible with these control sequences.

[0248] A polynucleotide can be manipulated in a variety of ways to provide for the expression of an RNAP subunit polypeptide. Depending on the expression vector, it may be desirable or necessary to manipulate the polynucleotide prior to insertion into the vector. Techniques for modifying polynucleotides using recombinant DNA methods are well known in the art.

[0249] Promoter

[0250] A control sequence may be a promoter, i.e., a polynucleotide that is recognized by a host cell for expression of a first polynucleotide encoding a polypeptide of interest. A control sequence may be a promoter, i.e., a polynucleotide that is recognized by a host cell for expression of a second polynucleotide encoding an RNAP subunit polypeptide. A promoter contains transcriptional control sequences that mediate the expression of a polypeptide. A promoter may be any polynucleotide that shows transcriptional activity in a host cell, including mutant promoters, truncated promoters, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides that are homologous or heterologous to the host cell.

[0251] Examples of suitable promoters for directing transcription of the polynucleotides of the present invention in bacterial host cells are described in Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Lab., NY; Davis et al., 2012, ibid.; and Song et al., 2016, PLOS One 11(7):e0158447.

[0252] Examples of suitable promoters for directing transcription of the polynucleotides of the present invention in filamentous fungal host cells are promoters obtained from cells of the genus Aspergillus, Fusarium, Rhizomucor, and Trichoderma, such as the promoters described in Mukherjee et al., 2013, “Trichoderma: Biology and Applications” and Schmoll and 2016, “Gene Expression Systems in Fungi: Advancements and Applications”, Fungal Biology.

[0253] For expression in yeast hosts, examples of useful promoters are described by Smolke et al., 2018, “Synthetic Biology: Parts, Devices and Applications” (Chapter 6: Constitutive and Regulated Promoters in Yeast: How to Design and Make Use of Promoters in S. cerevisiae) and Schmoll and 2016, “Gene Expression Systems in Fungi: Advancements and Applications”, Fungal Biology.

[0254] Terminator

[0255] The control sequence may also be a transcription terminator recognized by the host cell to terminate transcription. The terminator is operably linked to the 3'-end of the polynucleotide encoding the polypeptide. Any terminator functional in the host cell can be used in the present invention.

[0256] Preferred terminators for bacterial host cells can be obtained from the genes of Bacillus clausii alkaline protease (aprH), Bacillus licheniformis α-amylase (amyL), and Escherichia coli ribosomal RNA (rrnB).

[0257] Preferred terminators for filamentous fungal host cells can be obtained from Aspergillus or Trichoderma species, such as the genes of Aspergillus niger glucoamylase, Trichoderma reesei β-glucosidase, Trichoderma reesei cellobiohydrolase I, and Trichoderma reesei endoglucanase I, such as the terminators described in Mukherjee et al., 2013, “Trichoderma: Biology and Applications” and Schmoll and 2016, “Gene Expression Systems in Fungi: Advancements and Applications”, Fungal Biology.

[0258] Preferred terminators for yeast host cells can be obtained from the genes of Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells are described by Romanos et al., 1992, Yeast 8:423-488.

[0259] mRNA stabilizer

[0260] The control sequence can also be an mRNA stabilizing region downstream of the promoter and upstream of the coding sequence of the gene, which increases the expression of the gene encoding the polypeptide of interest.

[0261] Examples of suitable mRNA stabilizing regions are obtained from the Bacillus thuringiensis cryIIIA gene (WO 94 / 25612) and the Bacillus subtilis SP82 gene (Hue et al., 1995, J. Bacteriol. 177:3465-3471).

[0262] Examples of mRNA stabilizing regions for fungal cells are described in Geisberg et al., 2014, Cell 156(4):812-824 and Morozov et al., 2006, Eukaryotic Cell 5(11):1838-1846.

[0263] Leader sequence

[0264] The control sequence can also be a leader sequence, i.e., an untranslated region of the mRNA that is important for translation in the host cell. The leader sequence is operably linked to the 5'-end of the first polynucleotide encoding the polypeptide of interest and / or operably linked to the second polynucleotide encoding the RNAP subunit. Any leader sequence that is functional in the host cell can be used.

[0265] Suitable leader sequences for bacterial host cells are described by Hambraeus et al., 2000, Microbiology 146(12):3051-3059 and Kaberdin and 2006, FEMS Microbiol. Rev. 30(6):967-979.

[0266] Preferred leader sequences for filamentous fungal host cells can be obtained from the genes of Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.

[0267] Suitable leader sequences for yeast host cells can be obtained from the genes of the following: Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH2 / GAP).

[0268] Polyadenylation sequence

[0269] The control sequence can also be a polyadenylation sequence, i.e., a sequence operably linked to the 3'-end of the first polynucleotide and / or the second polynucleotide, which is recognized by the host cell as a signal for adding polyadenylate residues to the transcribed mRNA. Any polyadenylation sequence functional in the host cell can be used.

[0270] Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes of the following: Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.

[0271] A useful polyadenylation sequence for yeast host cells is described by Guo and Sherman, 1995, Mol. Cellular Biol. 15:5983-5990.

[0272] Signal peptide

[0273] The control sequence can also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of the polypeptide of interest and directs the polypeptide of interest into the secretory pathway of the cell. The 5'-end of the coding sequence of the first polynucleotide itself may contain a signal peptide coding sequence that is naturally linked to the coding sequence segment encoding the polypeptide of interest in the translation reading frame. Alternatively, the 5'-end of the coding sequence may contain a signal peptide coding sequence that is heterologous to the coding sequence. In cases where the coding sequence does not naturally contain a signal peptide coding sequence, a heterologous signal peptide coding sequence may be required. Alternatively, the heterologous signal peptide coding sequence can simply replace the native signal peptide coding sequence in order to enhance the secretion of the polypeptide of interest. Any signal peptide coding sequence that directs the expressed polypeptide of interest into the secretory pathway of the host cell can be used.

[0274] The effective signal peptide coding sequence of a bacterial host cell is a signal peptide coding sequence obtained from the genes of the following: Bacillus NCIB 11837 maltogenic amylase, Bacillus licheniformis subtilisin, Bacillus licheniformis β-lactamase, Bacillus stearothermophilus α-amylase, Bacillus stearothermophilus neutral proteases (nprT, nprS, nprM), and Bacillus subtilis prsA. Additional signal peptides are described by Freudl, 2018, Microbial Cell Factories 17:52.

[0275] The effective signal peptide coding sequence of a filamentous fungal host cell is a signal peptide coding sequence obtained from the genes of the following: Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor miehei aspartic protease, such as the signal peptides described by Xu et al., 2018, Biotechnology Letters 40:949-955.

[0276] Useful signal peptides of a yeast host cell are obtained from the genes of the following: Saccharomyces cerevisiae α-factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding sequences are described by Romanos et al., 1992, ibid.

[0277] Propeptide

[0278] The control sequence may also be a propeptide coding sequence encoding a propeptide located at the N-terminus of the polypeptide. The resulting polypeptide is called a proenzyme or pro-polypeptide (or in some cases is called a zymogen). Pro-polypeptides are usually inactive and can be converted into active polypeptides by catalytic cleavage or autocatalytic cleavage of the propeptide from the pro-polypeptide. The propeptide coding sequence can be obtained from the genes of the following: Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), Myceliophthora thermophila laccase (WO 95 / 33836), Rhizomucor miehei aspartic protease, and Saccharomyces cerevisiae α-factor.

[0279] In the case where both a signal peptide sequence and a propeptide sequence are present, the propeptide sequence is located immediately adjacent to the N-terminus of the polypeptide and the signal peptide sequence is located immediately adjacent to the N-terminus of the propeptide sequence. Additionally or alternatively, when both a signal peptide sequence and a propeptide sequence are present, the polypeptide may comprise only a portion of the signal peptide sequence and / or only a portion of the propeptide sequence. Alternatively, the final or isolated polypeptide may comprise a mixture of the mature polypeptide and a polypeptide comprising a partial or full-length propeptide sequence and / or signal peptide sequence.

[0280] Regulatory sequence

[0281] It may also be desirable to add regulatory sequences that regulate the expression of the polypeptide of interest relative to the growth of the host cell. It may also be desirable to add regulatory sequences that regulate the expression of the RNAP subunit polypeptide relative to the growth of the host cell. Examples of regulatory sequences are those that cause gene expression to be turned on or off in response to chemical or physical stimuli, including the presence of a regulatory compound. Regulatory sequences in prokaryotic systems include the lac, tac, and trp operon systems. In yeast, the ADH2 system or GAL1 system can be used. In filamentous fungi, the Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA α-amylase promoter, and Aspergillus oryzae glucoamylase promoter, Trichoderma reesei cellobiohydrolase I promoter, and Trichoderma reesei cellobiohydrolase II promoter can be used. Other examples of regulatory sequences are those that allow gene amplification. In fungal systems, these regulatory sequences include the dihydrofolate reductase gene that is amplified in the presence of methotrexate and the metallothionein gene that is amplified with heavy metals.

[0282] Shine-Dalgarno sequence

[0283] The control sequence can also be a Shine-Dalgarno (SD) sequence. The SD sequence is a ribosome-binding site on the RNA sequence, which is typically located 5-9 bases upstream of the start codon AUG. At the DNA level, the SD sequence is located upstream of the start codon ATG. The SD RNA sequence helps recruit the ribosome to the mRNA by aligning the ribosome with the start codon to initiate protein synthesis. Mutations in the SD sequence can reduce or increase translation in the host cell, resulting in a decrease or increase in polypeptide levels, respectively (Veláquez et al., Journal of Bacteriology, May 1991, pp. 3261–3264). Thus, modification of the SD sequence in the rpo subunit / rnap subunit gene can reduce or increase the level of the RNAP subunit polypeptide. This change in the RNAP subunit level is due to a decrease or increase in the pairing efficiency of the rnap subunit mRNA with the ribosome.

[0284] A mutated Shine-Dalgarno sequence can be obtained by one or more nucleic acid modifications such as nucleic acid substitutions, nucleic acid deletions or nucleic acid insertions. As described above, depending on the mutation, the modification of the SD sequence can reduce or increase the translation of a gene located downstream of the modified or mutated SD sequence.

[0285] In a third aspect, the invention relates to a nucleic acid construct comprising a second heterologous promoter and / or a mutated Shine-Dalgarno sequence operably linked to a second polynucleotide encoding one or more RNA polymerase (Rpo) subunit polypeptides.

[0286] In one embodiment, the nucleic acid construct is isolated.

[0287] In one embodiment, the nucleic acid construct is purified.

[0288] Expression vector

[0289] In a fourth aspect, the invention relates to an expression vector comprising the nucleic acid construct according to the third aspect.

[0290] The invention also relates to a recombinant expression vector comprising the polynucleotide, promoter, and transcription and translation termination signals of the invention. The polynucleotides and control sequences can be ligated together to produce a recombinant expression vector, which may include one or more convenient restriction sites to allow the insertion or substitution of the polynucleotide encoding the polypeptide at such sites. Alternatively, the polynucleotide can be expressed by inserting the polynucleotide or a nucleic acid construct comprising the polynucleotide into a suitable vector for expression. When producing an expression vector, the coding sequence is positioned in the vector such that the coding sequence is operably linked to the appropriate control sequences for expression.

[0291] The recombinant expression vector can be any vector (e.g., plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can cause the expression of the polynucleotide. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector can be a linear or closed circular plasmid.

[0292] The vector can be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity and whose replication is independent of chromosomal replication, such as a plasmid, an extrachromosomal element, a minichromosome or an artificial chromosome. The vector can contain any means for ensuring self-replication. Alternatively, the vector can be a vector that integrates into the genome when introduced into a host cell and replicates with the chromosome into which it has been integrated. Moreover, a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the host cell can be used, or a transposon can be used.

[0293] The vector preferably contains one or more selectable markers that allow for the convenient selection of cells such as transformed cells, transfected cells, transduced cells, etc. A selectable marker is a gene whose product provides biocide resistance or virus resistance, resistance to heavy metals, prototrophy for auxotrophs, etc.

[0294] The vector preferably contains at least one element that allows the vector to integrate into the genome of the host cell or to replicate autonomously in the cell independently of the genome.

[0295] For integration into the host cell genome, the vector can rely on a polynucleotide sequence encoding a polypeptide or any other element of the vector for integration into the genome by homologous recombination (such as homology-directed repair (HDR)) or non-homologous recombination (such as non-homologous end joining (NHEJ)).

[0296] For autonomous replication, the vector can further contain an origin of replication that enables the vector to replicate autonomously in the host cell under discussion. The origin of replication can be any plasmid replicon that functions in the cell to mediate autonomous replication. The term "origin of replication" or "plasmid replicon" refers to a polynucleotide that enables a plasmid or vector to replicate in vivo.

[0297] More than one copy of the polynucleotide of the present invention can be inserted into the host cell to increase the production of the polypeptide. For example, 2 or 3 or 4 or 5 or more copies are inserted into the host cell. An increased copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene together with the polynucleotide, where cells containing the amplified copy of the selectable marker gene and thus the additional copy of the polynucleotide can be selected by culturing the cells in the presence of an appropriate selective agent.

[0298] Fermentation broth formulation or cell composition

[0299] The present invention also relates to a fermentation broth formulation or cell composition comprising live or killed cells of the present invention. The fermentation broth formulation or cell composition further comprises additional components for use in the fermentation process, such as, for example, the polypeptide of interest, cell debris, biomass, fermentation medium, and / or fermentation product. In some embodiments, the composition is a whole cell-killed culture broth containing organic acids, killed cells, and / or cell debris and the medium.

[0300] As used herein, the term "fermentation broth" refers to a preparation produced by cell fermentation that undergoes little or no recovery and / or purification. For example, when a microbial culture is incubated and grown to saturation under carbon-limiting conditions that permit protein synthesis (e.g., expression of an enzyme by a host cell) and secretion of the protein into the cell culture medium, a fermentation broth is produced. The fermentation broth can contain unfractionated or fractionated contents of the fermentation materials derived at the end of fermentation. Typically, the fermentation broth is unfractionated and contains spent medium and cell debris present, for example, after removal of microbial cells (e.g., filamentous fungal cells) by centrifugation. In some embodiments, the fermentation broth contains spent cell culture medium, extracellular enzymes, and viable and / or non-viable microbial cells.

[0301] In some embodiments, the fermentation broth formulation or cell composition contains a first organic acid component (comprising at least one organic acid having 1 to 5 carbons and / or its salt) and a second organic acid component (comprising at least one organic acid having 6 or more carbons and / or its salt). In some embodiments, the first organic acid component is acetic acid, formic acid, propionic acid, its salt, or a mixture of two or more of the foregoing; and the second organic acid component is benzoic acid, cyclohexanecarboxylic acid, 4-methylpentanoic acid, phenylacetic acid, its salt, or a mixture of two or more of the foregoing.

[0302] In one aspect, the composition contains one or more organic acids and optionally further contains killed cells and / or cell debris. In some embodiments, these killed cells and / or cell debris are removed from the whole cell-killed culture broth to provide a composition free of these components.

[0303] The fermentation broth formulation or cell composition can further contain preservatives and / or antimicrobial (e.g., bacteriostatic) agents, including but not limited to sorbitol, sodium chloride, potassium sorbate, and other agents known in the art.

[0304] The whole cell-killed culture broth or cell composition can contain un-fractionated contents of the fermentation materials derived at the end of fermentation. Typically, the whole cell-killed culture broth or cell composition contains spent medium and cell debris present after microbial cells (e.g., filamentous fungal cells) have grown to saturation and been incubated under carbon-limiting conditions to permit protein synthesis. In some embodiments, the whole cell-killed culture broth or cell composition contains spent cell culture medium, extracellular enzymes, and killed filamentous fungal cells. In some embodiments, methods known in the art can be used to permeabilize and / or lyse the microbial cells present in the whole cell-killed culture broth or composition.

[0305] The whole culture medium or cell composition as described herein is typically a liquid, but may contain insoluble components such as killed cells, cell debris, culture medium components, and / or one or more insoluble enzymes. In some embodiments, the insoluble components can be removed to provide a clarified liquid composition.

[0306] The whole culture medium formulations and cell compositions of the present invention can be produced by the methods described in WO 90 / 15861 or WO 2010 / 096673.

[0307] Removal or reduction of RNAP activity

[0308] The present invention also relates to methods for generating mutants of parental cells, which include disrupting, modifying, substituting, or deleting a promoter or a portion thereof that regulates the transcription of one or more RNAP subunit polypeptides, which results in mutant cells containing less RNAP activity compared to the parental cells when cultured under the same conditions.

[0309] The present invention also relates to methods for generating mutants of parental cells, which include disrupting, modifying, substituting, or deleting the SD sequence or a portion thereof upstream of the RNAP subunit-encoding gene, which results in a decrease in the ribosome-binding strength of the RNAP subunit mRNA during translation. Thus, when cultured under the same conditions, the mutation of the SD sequence results in mutant cells containing less RNAP activity compared to the parental cells. For the expression of a target polypeptide (product) that is toxic to the cells, the reduced RNAP activity may be advantageous, which results in more balanced cell growth and product expression, thereby increasing the total product yield.

[0310] The present invention also relates to methods for generating mutants of parental cells, which include disrupting, modifying, substituting, or deleting a second polynucleotide or a portion thereof encoding one or more RNAP subunit polypeptides, which results in mutant cells containing less RNAP activity compared to the parental cells when cultured under the same conditions.

[0311] A decrease in the transcription and / or translation of one or more RNA polymerase subunits, which reduces the total RNA polymerase (RNAP) activity, has been shown to increase the yield of the target polypeptide in recombinant host cells while also reducing biomass formation.

[0312] The reduction of RNAP activity and / or the reduction of transcription and / or translation of one or more RNA polymerase subunits can be achieved, for example, by:

[0313] a) operably linking a second polynucleotide encoding an RNAP subunit to a second heterologous promoter that is weaker than the native promoter of the RNAP subunit-encoding gene, for example, by replacing the native promoter with a weaker heterologous promoter,

[0314] b) operably link the second polynucleotide to a mutated Shine-Dalgarno sequence that contains one or more nucleic acid modifications as compared to the native SD sequence of the RNAP subunit-encoding gene, wherein the mutated SD sequence results in weaker ribosome binding of the RNA during translation of the RNAP subunit,

[0315] c) use CRISPRi, RNAi or other interference techniques known to the person skilled in the art to target the coding sequence of the RNAP subunit gene or its transcript during transcription or translation, respectively,

[0316] and / or

[0317] d) delete or mutate one or more of these RNAP subunit genes.

[0318] Mutant cells can be constructed by reducing or eliminating the expression of the second polynucleotide using methods well known in the art (e.g., one or more nucleotide insertions, one or more gene disruptions, one or more nucleotide substitutions, or one or more nucleotide deletions).

[0319] The second polynucleotide to be modified or inactivated can be, for example, a coding region or a part thereof that is crucial for activity, or a regulatory or control element required for the expression of the coding region (e.g., a functional part of a promoter sequence), and / or a regulatory or control element required for the transcription or translation of the polynucleotide. Other control sequences for possible modification include, but are not limited to, leader sequences, polyadenylation sequences, propeptide sequences, signal peptide sequences, transcription terminators, and transcriptional activators.

[0320] Modification or inactivation of the second polynucleotide can be carried out by subjecting the parental cells to mutagenesis and selecting mutant cells in which the expression of the second polynucleotide is reduced or eliminated. The mutagenesis can be specific or random, for example, it can be carried out by using suitable physical or chemical mutagens, by using suitable oligonucleotides, or by subjecting the DNA sequence to mutagenesis generated by PCR. In addition, mutagenesis can be carried out by using any combination of these mutagens.

[0321] Examples of physical or chemical mutagens include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), O-methylhydroxylamine, nitrous acid, ethyl methanesulfonate (EMS), sodium bisulfite, formic acid, and nucleotide analogs (see J.L. Bose, Springer Protocols 2016, Methods in Molecular Biology, The Genetic Manipulation of Staphylococci).

[0322] Additionally or alternatively, nucleotides may be inserted or removed such that a stop codon is introduced, a start codon is removed, or the open reading frame is altered. Such modification or inactivation may be accomplished by site-directed mutagenesis or mutagenesis generated by PCR according to methods known in the art or by targeted gene editing using one or more nucleases (e.g., zinc finger nucleases or CRISPR-associated nucleases). Additionally or alternatively, modification or inactivation may be achieved by gene silencing, genetic containment, genetic activation, and / or post-translational mutagenesis (e.g., by methods employing non-coding RNAs, RNAi, siRNA, miRNA, ribozymes, catalytically inactivated nucleases, CRISPRi, nucleotide methylation, and / or histone acetylation). A suitable method for reducing the expression of the rpo subunit polypeptide is CRISPR inhibition (CRISRPi), e.g., as disclosed in WO18009520. The modification may be transient and / or reversible, irreversible and / or stable, or the modification may be dependent on a chemical inducer or on culture conditions such as culture temperature.

[0323] The modification may be performed in vivo, i.e., directly on the cell expressing the second polynucleotide, or the modification may be performed in vitro.

[0324] Examples of convenient ways to modify the expression of the second polynucleotide are shown in Example 1.

[0325] Another convenient way to reduce or eliminate RNAP activity in cells is to use RNA polymerase-directed anti-mycobacterial drugs (antibiotics), such as rifampicin. This is particularly useful when using a T7 RNA polymerase-dependent expression system to translate a polypeptide of interest. Using the antibiotic will reduce or eliminate the native RNAP activity of the host cell without interfering with the expression of the polypeptide of interest. Suitable antibiotic concentrations will be known to the person skilled in the art. Non-limiting examples of antibiotic concentrations during culture are between 0.01–5.0 ng / μl, e.g., a concentration of about 0.2 ng / μl. The purpose of choosing this concentration is: i) to effectively inactivate and eliminate the native RNAP activity; and ii) not to significantly interfere with cell viability. Too high a concentration will significantly interfere with cell viability, and too low a concentration will not effectively reduce the native RNAP activity.

[0326] Additional examples of convenient ways to eliminate or reduce the expression of a polynucleotide are based on gene replacement, gene deletion, or gene disruption techniques. For example, in a gene disruption method, a nucleic acid sequence corresponding to an endogenous polynucleotide is mutagenized in vitro to produce a defective nucleic acid sequence, which is then transformed into a parental cell to produce a defective gene. By homologous recombination, the defective nucleic acid sequence replaces the endogenous polynucleotide. Desirably, the defective polynucleotide also encodes a marker that can be used to select transformants in which the polynucleotide has been modified or disrupted. In one aspect, the polynucleotide is disrupted with a selectable marker (such as those described herein).

[0327] The invention further relates to a mutant cell of a parental cell, the mutant cell comprising a disruption or deletion of a second polynucleotide or its control sequence or a silent gene encoding an RNAP subunit polypeptide, which results in the mutant cell producing less or no RNAP subunit polypeptide compared to the parental cell.

[0328] The mutant cell with reduced RNAP subunit polypeptide levels can be used as a host cell for expressing native and heterologous target polypeptides because the mutant has at least the following two advantages: i) increased yield of the target polypeptide; and ii) reduced biomass formation.

[0329] The invention is further described by the following examples, which should not be construed as limiting the scope of the invention.

[0330] Example

[0331] Strain

[0332] AEB1517: As previously described, this is a Bacillus subtilis donor strain for conjugating Bacillus licheniformis (see US5695976, US5733753, US5843720, US5882888, and W02006042548). This strain contains pLS20 and the methylase gene M.blil 904II (US20130177942) is expressed by a triple promoter at the amyE locus, and the pBC16-derived orfβ and the Bacillus subtilis comS gene (and the kanamycin resistance gene) are expressed by a triple promoter at the alr locus (making the strain require D-alanine).

[0333] PP3724: A derivative of AEB1517, in which a second gene cassette (pectate lyase) consisting of the comS gene expressed by a triple promoter is inserted at the pel locus (see US20190276855).

[0334] SJ1904: A derivative of Bacillus licheniformis Ca63, described in WO 2008 / 066931.

[0335] AN865: A derivative of SJ1904 with an amylase gene under a triple promoter.

[0336] JA4468: A derivative of SJ1904 with a protease gene under a triple promoter.

[0337] BN01: A derivative of SJ1904 with a protease gene under a triple promoter.

[0338] BN02: A derivative of SJ1904 with a protease gene under a triple promoter.

[0339] Halo-9: A derivative of SJ1904 with a protease gene under a triple promoter.

[0340] Plasmid

[0341] pMDT411: A derivative of pMDT454, see US2021021670

[0342] pMDT417: A derivative of pMDT452, see US2021021670

[0343] pEB-prsA: A derivative of pMDT411 with a prsA expression cassette driven by a triple promoter.

[0344] pTNA634: A derivative of pEB-prsA with a GFP expression cassette driven by a constitutive amyL promoter (PamyL4199) and amyL RBS (ribosome binding sequence).

[0345] pTNA635: A derivative of pTNA634 with a wild-type rpoA RBS instead of amyL RBS.

[0346] pTNA636: A derivative of pTNA634 with a mutant rpoA RBS instead of amyL RBS.

[0347] pTNA637: A derivative of pTNA634 without an RBS instead of amyL RBS.

[0348] Culture media and solutions

[0349] LB: 10 g / l tryptone, 5 g / l yeast extract, 5 g / l sodium chloride, adjusted to pH 7.0.

[0350] LB-agar: LB with 15 g / l bacteriological agar

[0351] TY: 20 g / L tryptone, 5 g / L yeast extract, 7 mg / L FeCl2, 1 mg / L MnCl2, 15 mg / L MgCl2

[0352] TY-agar: TY with 15 g / l bacteriological agar

[0353] M-9 buffer: 8.8 g / l disodium hydrogen phosphate·2H2O; 3 g / l potassium dihydrogen phosphate; 4 g / l sodium chloride; 0.2 g / l magnesium sulfate·7H2O

[0354] PRK-50: 110 g / l soy grits; 5 g / l disodium hydrogen phosphate·2H2O; antifoam (Struktol SB2121; Schill & Seilacher, Hamburg, Germany) 1 ml / l, pH adjusted to 8.0 with NaOH / H2PO4 before sterilization.

[0355] Supplemental medium: 30 g / l tryptone (casein hydrolysate, from Difco (BactoTM Casein Tryptone Digest 211699)); 4 g / l magnesium sulfate·7H2O; 7 g / l dipotassium hydrogen phosphate; 7 g / l disodium hydrogen phosphate·2H2O; 4 g / l diammonium sulfate; 0.78 g / l citric acid; vitamins (34.2 mg / l dichlorothiamine; 2.9 mg / l riboflavin; 23 mg / l nicotinic acid; 28.5 mg / l D-calcium pantothenate; 5.7 mg / l pyridoxal hydrochloride; 1.1 mg / l D-biotin; 2.9 mg / l folic acid); trace metals (39.2 mg / l MnSO4·H2O, 157 mg / l FeSO4·7H2O, 15.6 mg / l CuSO4·5H2O; 15.6 mg / l ZnCl2); antifoam (Struktol SB2121; Schill & Seilacher, Hamburg, Germany) 1.25 ml / l; pH adjusted to 6.0 with NaOH / H2PO4 before sterilization.

[0356] Feed medium: 820 g / l glucose·1H2O

[0357] Culture

[0358] Grow the Bacillus strains on LB- or TY-agar plates or in LB or TY liquid medium. For selection of erythromycin resistance, supplement the agar and liquid media with 5 μg / ml erythromycin. For selection of tetracycline resistance, supplement the agar and liquid media with 15 μg / ml tetracycline. Supplement the growth medium for the strains carrying the alr gene disruption with D-alanine to a final concentration of 0.1 mg / mL. Transform Bacillus in Spizizen I medium, which consists of: 1x Spizizen salts (6 g / L KH2PO4, 14 g / L K2HPO4, 2 g / L (NH4)2SO4, 1 g / L sodium citrate, 0.2 g / L MgSO4 pH 7.0), 0.5% glucose, 0.1% yeast extract, and 0.02% casein hydrolysate.

[0359] Enzymatic assay

[0360] Amylase assay: Measure amylase activity in the culture broth using Pureauto S AMY-G7 (Sekisui Medical). First, dilute the culture broth in the dissolution buffer (0.03 M CaCl2; 0.0025% BrijL23; 6.67 M urea), and then use the dilution buffer (0.03 M CaCl2; 0.0025% Brij L23) for subsequent sample dilution. Measure the enzyme activity using a Gallery Plus automated photometric analyzer. Mix 16 μL of the diluted sample with 200 μL of reagent 1 of the Pureauto kit, and then add 20 μL of reagent 2 thereto. After incubation at 37 °C for 3 min, measure the absorbance at 405 nm over time for 2 min. Include an amylase standard, and determine the final activity value KNU(T) / g.

[0361] Protease assay: The serine endopeptidase hydrolyzes the substrate N-succinyl-Ala-Ala-Pro-Phe p-nitroanilide. The reaction is carried out at 37 °C at pH 9.0. The release of pNA results in an increase in absorbance at 405 nm, and this increase is proportional to the enzyme activity measured against the standard.

[0362] In vivo GFP assay: The in vivo GFP expression level was measured as follows. First, the Bacillus strain with the GFP expression plasmid was grown overnight in LB liquid medium supplemented with 100 μg / ml D-Ala and 5 μg / ml erythromycin. 25 μL of the culture broth was transferred to a 96-well black plate and mixed with 75 μL of fresh LB medium for dilution. The GFP intensity of the diluted culture broth was measured at Ex 485 nm / Em 528 nm using a Synergy2 spectrophotometer (BioTek Instruments, Inc.).

[0363] Molecular biology methods

[0364] DNA manipulations and transformations were performed by standard molecular biology methods as described below:

[0365] - Sambrook et al. (1989): Molecular cloning: A laboratory manual. Cold Spring Harbor laboratory, Cold Spring Harbor, NY.

[0366] - Ausubel et al. (eds.) (1995): Current protocols in Molecular Biology. John Wiley and Sons.

[0367] - Harwood and Cutting (eds.) (1990): Molecular Biological Methods for Bacillus. John Wiley and Sons.

[0368] Competent cells of Bacillus subtilis and transformation were obtained as described by Yasbin et al. (1975, Transformation and transfection in lysogenic strains of Bacillus subtilis: evidence for selective induction of prophage in competent cells. J. Bacteriol. 121, 296-304). Conjugation of Bacillus licheniformis was carried out essentially as described in WO 1996 / 029418.

[0369] Genomic DNA was prepared using a commercially available QIAamp DNA Blood Kit (Qiagen). The corresponding DNA fragment was amplified by PCR using the PrimeStar GXL DNA Polymerase System (TaKaRa). The PCR amplification reaction mixture contained 1 μL of template DNA, 2 μL of sense primer (20 pmol / μL), 2 μL of antisense primer (20 pmol / μL), 10 μL of 5X PCR buffer, 4 μL of dNTP mixture, 30 μL of water, and 1 μL of DNA polymerase. A thermal cycler was used to amplify the fragment. The PCR product was purified from a 1.0% agarose gel with 1x TAE buffer using a QIAquick Gel Extraction Kit (Qiagen) according to the manufacturer's instructions.

[0370] The conditions for POE-PCR were as follows: The purified PCR product was used in a subsequent PCR reaction to generate a single fragment using splicing overlap extension PCR (SOE) with the PrimeStar GXL DNA Polymerase System (TaKaRa) as follows. The most 5'-end fragment and the most 3'-end fragment had complementary ends, which would allow SOE to be concatenated into the POE PCR product. The PCR amplification reaction mixture contained 50 ng of the gel-purified PCR product each. POE PCR was carried out as described by You, C et al. (2017) Methods Mol. Biol. 116, 183-92.

[0371] Procedure for fed-batch fermentation using a laboratory stirred tank fermenter

[0372] 1. Inoculation step

[0373] a) Grow the strain overnight on an LB-agar plate at 37 °C.

[0374] b) Wash the agar with M-9 buffer and collect the cell suspension. Measure OD650 by spectrophotometer.

[0375] c) Inoculate a PRK-50 shake flask (OD650 x ml of cell suspension = 1).

[0376] d) Incubate the shake flask overnight at 37 °C at 220 rpm.

[0377] e) Start the main fermenter by adding the growth shake flask culture (10% of the supplemented medium, i.e., 80 ml to 800 ml).

[0378] 2. Fermenter equipment

[0379] A standard laboratory fermenter equipped with the following: a temperature control system, pH control using ammonia water and phosphoric acid, and a dissolved oxygen electrode for measuring >20% oxygen saturation throughout the fermentation process.

[0380] 3. Fermentation parameters

[0381] Temperature: 37 °C.

[0382] Maintain the pH value between 6.8 and 7.2 using ammonia water and phosphoric acid.

[0383] Aeration: 1.5 L / min / kg of culture broth weight

[0384] Agitation: 1500 rpm.

[0385] Example 1. Construction of plasmid DNA for introducing mutations into the rpoA gene.

[0386] The purpose of this experiment was to prepare plasmid DNA for introducing single nucleotide mutations into the native rpoA gene to alter its ribosome binding sequence (= SD, Shine-Dalgarno sequence) in Bacillus licheniformis strains. Hereinafter, this mutation is referred to as the rpoA SD mutation.

[0387] Plasmid DNA pMDT411 has an expression cassette for a single guide RNA (sgRNA) to recruit the Mad7 nuclease to the sgRNA complementary region on the genome. To edit the ribosome binding region of the rpoA gene, a protospacer sequence was designed and cloned into pMDT411 (see Table 2).

[0388] Table 2.

[0389] Plasmid DNA Pre-spacer sequence SEQ ID NO pMDT411-rpoA tcgtagagccacttgagcgtg 41

[0390] The oligomeric DNAs for cloning are listed in Table 2. The pre-spacer sequence and homologous region with the desired rpoA SD mutation were inserted into pMDT411 by PoE PCR. First, each PCR fragment was amplified and purified by gel extraction using the QIAquick Gel Extraction Kit (Qiagen). Table 3 shows the primer pairs used. Then the purified fragments were combined by PoE PCR as described in the method section. Then the PoE PCR product was directly used to transform the Bacillus subtilis host PP3724 (hereinafter referred to as PP3724-pMDT411-rpoA), which is D-alanine auxotrophic. The transformants were spread onto TY plus erythromycin and D-alanine agar plates and incubated at 34 °C for 1-2 days. Plasmid DNA was purified from several transformants using the QIAGEN miniprep kit. The correct ligation of the plasmid DNA was screened by Sanger sequencing. Similarly, plasmid DNA pMDT417 containing the expression cassette of Mad7 nuclease was transformed into the Bacillus subtilis host PP3724 (hereinafter referred to as PP3724-pMDT417). The transformants were spread onto TY plus tetracycline and D-alanine agar plates and incubated at 34 °C for 1-2 days.

[0391] Table 3.

[0392]

[0393]

[0394] Example 2. Transformation of Bacillus licheniformis strains AN865 and JA4468 to integrate the rpoA SD mutation

[0395] The purpose of this experiment was to generate the desired rpoA mutants of Bacillus licheniformis strains. First, to transfer plasmid DNA, the Bacillus subtilis donor strain PP3724-pMDT411-rpoA was conjugated with the Bacillus licheniformis recipient strains AN865 or JA4468. The conjugants were spread onto TY plus erythromycin agar plates and incubated at 34 °C for 1-2 days. The correct conjugants of Bacillus licheniformis were selected by erythromycin resistance and the D-alanine auxotrophic phenotype. Next, the erythromycin-resistant Bacillus licheniformis strain was conjugated with PP3724-pMDT417. The conjugants were spread onto TY plus erythromycin and tetracycline agar plates and incubated at 34 °C for 2-3 days. The correct conjugants of Bacillus licheniformis were selected by double resistance to erythromycin and tetracycline.

[0396] The colonies on the double selection plates were then transferred to LB - liquid medium with tetracycline and erythromycin and cultured overnight at 34°C. To isolate single colonies from the liquid culture, the culture broth was serially diluted and spread on TY plus erythromycin and tetracycline agar plates and incubated at 34°C for 2 - 3 days. The presence of the desired rpoA mutations on the single colony genomes was then screened by genomic PCR and Sanger sequencing. We identified the desired rpoA mutants from AN865 and JA4468, hereinafter referred to as AN865 - rpoA - 5 and JA4468 - rpoA - 3 - 3, respectively. The plasmid DNA used for genome editing was removed by culturing these strains overnight at 50°C in LB - liquid medium. Finally, double - sensitive clones to erythromycin and tetracycline were selected and stored in glycerol.

[0397] Example 3. Increased amylase productivity after introduction of rpoA SD mutations

[0398] The aim of this experiment was to test whether the introduced rpoA mutations affected the amylase productivity of Bacillus licheniformis strain AN865 in shake flasks (SF). First, 100 μl of the frozen stock cultures of AN865 (wild - type rpoA) and AN865 - rpoA - 5 (mutant rpoA) were added to 100 ml of PRK - 50 medium in 500 ml SF. The SF was incubated overnight at 37°C with a SF shaker at 220 rpm. Then, 10 ml of the culture broth was inoculated into 100 ml of 10R - av - 30CG medium in 500 ml SF. The SF was incubated at 37°C at 220 rpm for 3 days. Finally, the amylase activity in the culture broth was measured as described in the [Enzymatic assay] section. The relative amylase activities are shown in Table 4.

[0399] Table 4.

[0400] Strain rpoA SD sequence *Relative amylase activity at the 72nd hour AN865 Wild type 1.00 AN865-rpoA-5 Mutated 1.12

[0401] * The average amylase activity from 3 replicates of each strain was calculated. The average amylase productivity of AN865 (wild - type SD) was normalized to 1.00.

[0402] The above data indicate that the rpoA SD mutations significantly increased the productivity of amylase expression in Bacillus licheniformis strain AN865 by 12%.

[0403] Example 4. Increased protease expression after introduction of rpoA SD mutations

[0404] The purpose of this experiment was to test whether the introduced rpoA mutation affects the protease productivity of Bacillus licheniformis strain JA4468 in a laboratory stirred fermenter, the procedure of which is described in the Methods section. Finally, protease activity in the culture broth was measured as described in the [Enzymatic Assay] section. The relative protease activities are shown in Table 5.

[0405] Table 5.

[0406] Strain rpoA SD sequence *Relative protease activity at the 120th hour JA4468 Wild type 1.00 JA4468-rpoA-3-3 Mutated 1.12

[0407] * Calculate the average protease activity from 2 replicates of JA4468 (wild-type SD) or a single batch of JA4468-rpoA-3-3 (mutant rpoA SD). Normalize the average protease yield of JA4468 to 1.00.

[0408] The above data indicate that the rpoA SD mutation significantly increased the productivity of protease expression in Bacillus licheniformis strain JA4468 by 12%. Together with Example 3, the rpoA SD mutation was shown to have a positive effect on the recombinant production of different protein products in Bacillus licheniformis strains.

[0409] Example 5. Reduced biomass formation after introduction of the rpoA SD mutation

[0410] The purpose of this experiment was to observe the effect of the rpoA SD mutation not only on enzyme productivity but also on cell growth during fermentation. The amylase strains AN865 and AN865-rpoA-5 and the protease strains JA4468 and JA4468-rpoA-3-3 were cultured in 100 ml of LB-liquid medium in 500 ml of SF. The culture was carried out overnight at 37 °C with 220 rpm. After 24 hours of fermentation, 5 ul of the culture broth was mixed with 195 ul of deionized water for dilution, and then the OD650 value was measured by a photometer. The results are summarized in Table 6.

[0411] Table 6.

[0412]

[0413]

[0414] The above data indicate that the rpoA SD mutation significantly decreased the cell density (by 18%) at the end of fermentation. Similar effects were also observed in the fermentations carried out in Examples 3 and 4. Reduced biomass after fermentation is a very beneficial feature for bioproduction because the reduction of biomass will lower the product purification and formulation costs.

[0415] Example 6: The rpoA SD mutation leads to increased rifampicin sensitivity

[0416] The purpose of this experiment is to study the effect of rpoA SD mutations at the molecular level. Since the SD (Shine-Dalgarno) region functions as a ribosome-binding sequence, rpoA SD mutations may alter the translation level of RpoA protein in cells. Bacterial RNA polymerase consists of 2xα (encoded by the rpoA gene), β, β', and ω subunits. The RNA polymerase complex is inhibited by the antibiotic rifampicin (Reference: EA Campbell et al., "Structural mechanism for rifampicin inhibition of bacterial rna polymerase", Cell, 2001). We hypothesized that if the cellular RpoA protein level in rpoA SD mutants is lower than that in the wild-type strain, then the rpoA SD mutants would be more sensitive to rifampicin.

[0417] To test this hypothesis, protease strains listed in Table 7 were spread on agar plates containing rifampicin (Rif) to observe the sensitivity of each strain to Rif. In TY-based agar plates, the JA4468 strain showed a decrease in survival rate as the Rif dose increased. However, BN02 with a known rpoB (encoding the β subunit) mutation (A478D) that confers Rif resistance did not show any decrease in survival rate. This indicates that this Rif sensitivity assay is reasonable. Then, protease strains with or without rpoA SD mutations (halo-9 and BN01, respectively) were assayed. As shown in Table 7, compared with BN01, halo-9 with the rpoA SD mutation showed a lower survival rate, indicating that halo-9 is more sensitive to Rif. Therefore, it can be concluded that the identified rpoA SD mutation reduces RNAP activity in host cells, for example, by reducing rpoA expression.

[0418] Table 7.

[0419]

[0420]

[0421] Example 7: Construction of plasmid DNA for GFP expression tethered with various SD sequences

[0422] The purpose of this experiment was to confirm that the SD mutation leads to a decrease in RpoA expression and thus a decrease in RNAP activity. To this end, plasmid DNA was prepared to study the effect of different SD sequences on GFP expression. As shown in Example 6, the rpoA SD mutation should reduce the level of RpoA protein expression. To further study this quantitatively, a series of GFP expression plasmid DNAs were prepared.

[0423] Plasmid DNA pEB-prsA (a derivative of pMDT411) has a prsA overexpression cassette driven by a triple promoter with an RBS in the form of multiple SD sequences. To prepare a simple expression cassette to compare the effects of SD sequences, the single amyL promoter (PamyL4199) was chosen instead of the triple promoter. Then, PamyL4199 and various RBSs with GFP CDS (including amyL SD, wild-type rpoA with wild-type SD, wild-type rpoA with mutant SD or no SD) were cloned into the pEB-prsA backbone by PoE PCR, resulting in pTNA634 to 637, respectively. As described in Example 1, these constructs were transformed into the Bacillus subtilis host PP3724. The oligonucleotide DNAs used for cloning are listed in Table 8. The SD sequences used in this study are summarized in Table 9, annotated as ribosome binding sites (RBSs).

[0424] Table 8.

[0425]

[0426] Table 9.

[0427]

[0428] *Mutated nucleotides in rpoA SD (RBS) are in uppercase.

[0429] Example 8: rpoA SD mutation leads to a decrease in GFP expression

[0430] The purpose of this experiment was to compare the in vivo GFP expression levels between the wild-type rpoA SD sequence and the mutant rpoA SD sequence. Single colonies of the PP3724 transformants of pTNA634 to 637 were cultured in LB liquid medium supplemented with 100 μg / ml D-Ala and 5 μg / ml erythromycin. After culturing overnight at 32 °C, the culture broth was collected to measure OD650 and GFP intensity as described in the assay section. The results are summarized in Table 10.

[0431] Table 10.

[0432]

[0433] The GFP intensity and OD650 shown in Table 10 are the averages of two biological replicates.

[0434] As shown in Table 10, the transformants of pTNA634 to 637 showed different levels of GFP expression, while the transformants of the negative control (pEB-prsA) did not show any GFP expression. Since the measured GFP intensity (a) should be affected by the cell mass in the culture medium, the GFP intensity was normalized by OD650 (GFP / OD650 (b) , hereinafter referred to as normalized GFP expression). pTNA635 was used as a reference to calculate the relative value of the normalized GFP expression (see the rightmost column of Table 10). pTNA635 encodes a GFP cassette with a wild-type rpoA SD. As can be seen from Table 10, relative to the GFP expression of pTNA635, pTNA636 (mutated rpoA SD) resulted in an 85% reduction in GFP expression. This is completely consistent with what was seen in the Example 6 Rif sensitivity experiment. In summary, these examples show that the rpoA SD mutation results in a reduction in RpoA expression of approximately 80% - 90%. In addition, we have demonstrated that the rpoA SD mutation results in an increase in recombinant protein yield (Examples 3 - 4) and a decrease in biomass formation (Example 5).

[0435] Therefore, the reduction in rpoA expression is directly related to the observed reduction in biomass and increase in product yield.

[0436] The invention described and claimed herein is not limited to the scope of the specific aspects disclosed herein, as these aspects are intended to be illustrative of several aspects of the invention. Any equivalent aspects are intended to be within the scope of the invention. Indeed, various modifications of the invention, in addition to those shown and described herein, will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In case of conflict, the present disclosure, including definitions, will control.

[0437] The invention is further defined by the following numbered paragraphs:

[0438] 1. A mutant cell that contains in its genome a first heterologous promoter operably linked to a first polynucleotide encoding a polypeptide of interest, and one or more second polynucleotides encoding one or more RNA polymerase (Rpo) subunit polypeptides, wherein the expression of the one or more Rpo subunit polypeptides is reduced or eliminated compared to a non-mutated isogenic cell or parental cell in other respects.

[0439] 2. The mutant cell according to paragraph 1, wherein

[0440] a) the second polynucleotide is operably linked to a second heterologous promoter,

[0441] b) The second polynucleotide is operably linked to a mutated Shine-Dalgarno sequence derived from a parental Shine-Dalgarno sequence,

[0442] c) The second polynucleotide comprises one or more nucleic acid insertions, deletions or substitutions,

[0443] d) The expression of the second polynucleotide is reduced by a CRISPR inhibition construct, and / or

[0444] e) The expression of the second polynucleotide is reduced by RNA interference.

[0445] 3. The cell according to any one of the preceding paragraphs, wherein when cultured under the same conditions, the expression of one or more Rpo subunit polypeptides is reduced by at least 10%, such as at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90% or at least 95% compared to the expression of one or more Rpo subunit polypeptides in the parental cell.

[0446] 4. The cell according to any one of paragraphs 1-3, wherein the second polynucleotide is native to the cell.

[0447] 5. The cell according to any one of the preceding paragraphs, wherein the second heterologous promoter is heterologous to the second polynucleotide.

[0448] 6. The cell according to any one of the preceding paragraphs, wherein when cultured under the same conditions, the second heterologous promoter results in a reduction in the expression of the Rpo subunit polypeptide encoded by the second polynucleotide compared to the expression of the Rpo subunit polypeptide controlled by the native promoter of the second polynucleotide in the parental cell.

[0449] 7. The cell according to any one of the preceding paragraphs, wherein the parental Shine-Dalgarno sequence has at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the polynucleotide sequence of AAGGAGG or to SEQ ID NO:58.

[0450] 8. The cell according to any one of the preceding paragraphs, wherein the cell comprises at least two second polynucleotides, such as at least three or at least four second polynucleotides, each second polynucleotide encoding an RNA polymerase subunit polypeptide.

[0451] 9. The cell according to any one of the preceding paragraphs, wherein the one or more RNA polymerase subunit polypeptides are one or more bacterial RNA polymerase subunit polypeptides selected from the list of subunit β (beta), subunit α (alpha), and subunit ω (omega).

[0452] 10. The cell according to any one of the preceding paragraphs, wherein the one or more second polynucleotides encode one or more bacterial RNA polymerase subunit α (alpha) RpoA.

[0453] 11. The cell according to any one of the preceding paragraphs, wherein the one or more second polynucleotides encode one or more bacterial RNA polymerase subunit β (beta) RpoB.

[0454] 12. The cell according to any one of the preceding paragraphs, wherein the one or more second polynucleotides encode one or more bacterial RNA polymerase subunit β' (beta') RpoB'.

[0455] 13. The cell according to any one of the preceding paragraphs, wherein the one or more second polynucleotides encode one or more bacterial RNA polymerase subunit ω (omega) RpoZ.

[0456] 14. The cell according to any one of the preceding paragraphs, wherein one or more primary second polynucleotides encode one or more bacterial RNA polymerase subunit α (alpha) RpoA, and one or more secondary second polynucleotides encode one or more bacterial RNA polymerase subunit β (beta) RpoB and / or (β') RpoB'.

[0457] 15. The cell according to any one of the preceding paragraphs, wherein one or more primary second polynucleotides encode one or more bacterial RNA polymerase subunit α (alpha) RpoA, and one or more secondary second polynucleotides encode one or more bacterial RNA polymerase subunit ω (omega) RpoZ.

[0458] 16. The cell according to any one of the preceding paragraphs, wherein one or more primary second polynucleotides encode one or more bacterial RNA polymerase subunit β (beta) RpoB, and one or more secondary second polynucleotides encode one or more bacterial RNA polymerase subunit ω (omega) RpoZ.

[0459] 17. The cell according to any one of the preceding paragraphs, wherein one or more primary second polynucleotides encode one or more bacterial RNA polymerase subunit β' (beta') RpoB', and one or more secondary second polynucleotides encode one or more bacterial RNA polymerase subunit ω (omega) RpoZ.

[0460] 18. A cell according to any one of the preceding paragraphs, wherein one or more first secondary polynucleotides encode one or more bacterial RNA polymerase subunit alpha (α) RpoA, one or more second secondary polynucleotides encode one or more bacterial RNA polymerase subunit beta (β) RpoB and / or (β') RpoB', and one or more third secondary polynucleotides encode one or more bacterial RNA polymerase subunit omega (ω) RpoZ.

[0461] 19. A cell according to any one of the preceding paragraphs, wherein the second polynucleotide, such as the first, second or third secondary polynucleotide, encodes an RpoA polypeptide comprising or consisting of an amino acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO:2.

[0462] 20. A cell according to any one of the preceding paragraphs, wherein the second polynucleotide, such as the first, second or third secondary polynucleotide, encodes an RpoA polypeptide and comprises or consists of a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleic acid sequence of SEQ ID NO:1.

[0463] 21. A cell according to any one of the preceding paragraphs, wherein the second polynucleotide, such as the first, second or third secondary polynucleotide, encodes an RpoB polypeptide comprising or consisting of an amino acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO:11.

[0464] 22. A cell according to any one of the preceding paragraphs, wherein the second polynucleotide, such as the primary, secondary or tertiary second polynucleotide, encodes an RpoB polypeptide and comprises or consists of: a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the nucleic acid sequence of SEQ ID NO:10.

[0465] 23. A cell according to any one of the preceding paragraphs, wherein the second polynucleotide, such as the primary, secondary or tertiary second polynucleotide, encodes an RpoB' polypeptide comprising or consisting of: an amino acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO:40.

[0466] 24. A cell according to any one of the preceding paragraphs, wherein the second polynucleotide, such as the primary, secondary or tertiary second polynucleotide, encodes an RpoB' polypeptide and comprises or consists of: a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the nucleic acid sequence of SEQ ID NO:39.

[0467] 25. A cell according to any one of the preceding paragraphs, wherein the second polynucleotide, such as the primary, secondary or tertiary second polynucleotide, encodes an RpoZ polypeptide comprising or consisting of: an amino acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO:13.

[0468] 26. A cell according to any one of the preceding paragraphs, wherein the second polynucleotide, such as the primary, secondary, or tertiary second polynucleotide, encodes an RpoZ polypeptide and comprises or consists of the following: a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the nucleic acid sequence of SEQ ID NO:12.

[0469] 27. A cell according to any one of the preceding paragraphs, wherein the second polynucleotide is heterologous to the cell.

[0470] 28. A cell according to any one of the preceding paragraphs, wherein the first polynucleotide is operably linked to one or more first promoters directing the production of the polypeptide of interest, preferably, the first promoter is heterologous to the first polynucleotide.

[0471] 29. A cell according to any one of the preceding paragraphs, wherein the first heterologous promoter comprises or consists of the following: a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the nucleic acid sequence of SEQ ID NO:38.

[0472] 30. A cell according to any one of the preceding paragraphs, wherein the cell comprises in its genome at least two copies of the first polynucleotide, such as at least three, at least four, or at least five, or at least six or more copies.

[0473] 31. A cell according to any one of the preceding paragraphs, wherein the one or more RNA polymerase subunit polypeptides are one or more archaeal RNA polymerase subunit polypeptides selected from the following list: Rpo1, Rpo2, Rpo3, Rpo11, Rpo4, Rpo5, Rpo6, Rpo8, Rpo10, Rpo12, Rpo7, or Rpo13.

[0474] 32. A cell according to any one of the preceding paragraphs, wherein the one or more RNA polymerase subunit polypeptides are subunit polypeptides of eukaryotic RNA polymerase I, RNA polymerase II, and / or RNA polymerase III.

[0475] 33. A cell according to any of the preceding paragraphs, wherein the one or more RNA polymerase subunit polypeptides are one or more eukaryotic RNA polymerase I subunit polypeptides selected from the list: RPA190, RPBA135, RPAC40 (AC40), RPAC19 (AC19), RPB6, RPB5, RPB8, RPB10, RPB12, RPA14, RPA43, RPA12, RPA49, and RPA34.5.

[0476] 34. A cell according to any of the preceding paragraphs, wherein the one or more RNA polymerase subunit polypeptides are one or more eukaryotic RNA polymerase subunit polypeptides selected from the list: RPAC40 (AC40), RPAC19 (AC19), RPO3, RPO11, RPB3, and RPB11.

[0477] 35. A cell according to any of the preceding paragraphs, wherein the second polynucleotide encodes an RPAC40 (AC40) polypeptide and comprises or consists of a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the nucleic acid sequence of SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18.

[0478] 36. A cell according to any of the preceding paragraphs, wherein the one or more RNA polymerase subunit polypeptides are one or more eukaryotic RNA polymerase I subunit polypeptides selected from the list: RPA190, RPBA135, RPAC40 (AC40), RPAC19 (AC19), RPB6, RPB5, RPB8, RPB10, RPB12, RPA14, RPA43, RPA12, RPA49, and RPA34.5.

[0479] 37. A cell according to any of the preceding paragraphs, wherein the second polynucleotide encodes an RPAC40 (AC40) polypeptide comprising or consisting of an amino acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:15, SEQ ID NO:17, or SEQ ID NO:19.

[0480] 38. A cell according to any one of the preceding paragraphs, wherein the second polynucleotide encodes an RPAC19 (AC19) polypeptide and comprises or consists of: a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleic acid sequence of SEQ ID NO:20, SEQ ID NO:22 or SEQ ID NO:24.

[0481] 39. A cell according to any one of the preceding paragraphs, wherein the second polynucleotide encodes an RPAC19 (AC19) polypeptide comprising or consisting of: an amino acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO:21, SEQ ID NO:23 or SEQ ID NO:25.

[0482] 40. A cell according to any one of the preceding paragraphs, wherein the one or more RNA polymerase subunit polypeptides are one or more eukaryotic RNA polymerase II subunit polypeptides selected from the list consisting of: RPB1, RPB2, RPB3, RPB11, RPB6, RPB5, RPB8, RPB10, RPB12, RPB4, RPB7, RPB9, TFIIFα and TFIIFβ.

[0483] 41. A cell according to any one of the preceding paragraphs, wherein the second polynucleotide encodes an RPB3 polypeptide and comprises or consists of: a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleic acid sequence of SEQ ID NO:26, SEQ ID NO:28 or SEQ ID NO:30.

[0484] 42. A cell according to any of the preceding paragraphs, wherein the second polynucleotide encodes an RPB3 polypeptide comprising or consisting of an amino acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO:27, SEQ ID NO:29 or SEQ ID NO:31.

[0485] 43. A cell according to any of the preceding paragraphs, wherein the second polynucleotide encodes an RPB11 polypeptide and comprises or consists of a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleic acid sequence of SEQ ID NO:32, SEQ ID NO:34 or SEQ ID NO:36.

[0486] 44. A cell according to any of the preceding paragraphs, wherein the second polynucleotide encodes an RPB11 polypeptide comprising or consisting of an amino acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO:33, SEQ ID NO:35 or SEQ ID NO:37.

[0487] 45. A cell according to any of the preceding paragraphs, wherein the one or more RNA polymerase subunit polypeptides are one or more eukaryotic RNA polymerase III subunit polypeptides selected from the list consisting of: RPC160, RPC128, RPAC40 (AC40), RPAC19 (AC19), RPB6, RPB5, RPB8, RPB10, RPB12, RPC17, RPC25, RPC11, RPC53, RPC37, RPC82, RPC34 and RPC31.

[0488] 46. A cell according to any of the preceding paragraphs, wherein the one or more RNA polymerase subunit polypeptides are one or more yeast RNA polymerase subunit polypeptides selected from the following list: Rpb5 (ABC27), Rpb6 (ABC23 or Rpo26), Rpb8 (ABC14.5), Rpb10 (ABC10β), and Rpb12 (ABC10α).

[0489] 47. A cell according to any of the preceding paragraphs, wherein the one or more RNA polymerase subunit polypeptides comprise an N-terminal extension and / or a C-terminal extension of 1 to 10 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids, preferably, and an extension of 1 to 6 amino acid residues in the N-terminus and / or 1 to 6 amino acid residues in the C-terminus, such as 1-5, or 1-4, or 1-3, or 1-2 amino acids, and wherein the extended polypeptide has RNA polymerase activity.

[0490] 48. A cell according to any of the preceding paragraphs, wherein the cell is a eukaryotic cell.

[0491] 49. A cell according to any of the preceding paragraphs, wherein the cell is a mammalian cell.

[0492] 50. A cell according to any of the preceding paragraphs, wherein the cell is a prokaryotic cell.

[0493] 51. A cell according to any of the preceding paragraphs, which is a yeast recombinant host cell, for example, a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell, such as Kluyveromyces lactis, Candida utilis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Kluyveromyces marxianus, Lodderomyces elongisporus, Ogataea polymorpha, or Yarrowia lipolytica cell.

[0494] 52. A cell according to any one of the preceding paragraphs, which is a filamentous fungal recombinant host cell, such as, for example, an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filobasidium, Fusarium, Humicola, Monographella, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, or Trichoderma cell, in particular, an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis variispora, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus, Coriolus hirsutus, Fusarium bacilliforme, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium lignicola, Fusarium oxysporum, Fusarium proliferatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Talaromyces emersonii, Thielavia terrestris, Trametes cingulata, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell.

[0495] 53. A cell according to any one of the preceding paragraphs, wherein the cell is an Aspergillus cell.

[0496] 54. A cell according to any one of the preceding paragraphs, wherein the cell is an Aspergillus niger cell.

[0497] 55. A cell according to any one of the preceding paragraphs, wherein the cell is an Aspergillus oryzae cell.

[0498] 56. A cell according to any one of the preceding paragraphs, wherein the cell is a Trichoderma cell.

[0499] 57. A cell according to any one of the preceding paragraphs, wherein the cell is a Trichoderma reesei cell.

[0500] 58. A cell according to any one of the preceding paragraphs, which is a prokaryotic recombinant host cell, for example, a Gram-positive cell selected from the group consisting of: Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus or Streptomyces cells, or a Gram-negative bacterium selected from the group consisting of: Campylobacter, Escherichia coli, Flavobacterium, Fusobacterium, Helicobacter, Pelobacter, Neisseria, Pseudomonas, Salmonella, and Ureaplasma cells, such as Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis, Bacillus thuringiensis, Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus agalactiae and Streptococcus zooepidemicus subsp., Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus, and Streptomyces lividans cells.

[0501] 59. A cell according to any one of the preceding paragraphs, wherein the cell is a Bacillus cell.

[0502] 60. A cell according to any one of the preceding paragraphs, wherein the cell is a Bacillus licheniformis cell.

[0503] 61. A cell according to any one of the preceding paragraphs, wherein the cell is a Bacillus subtilis cell.

[0504] 62. A cell according to any one of the preceding paragraphs, which is isolated.

[0505] 63. A cell according to any one of the preceding paragraphs, which is purified.

[0506] 64. A cell according to any one of the preceding paragraphs, wherein relative to the transcription of the second polynucleotide when operably linked to its native or endogenous promoter, the second heterologous promoter operably linked to the second polynucleotide results in a decrease in the transcription of the second polynucleotide.

[0507] 65. A cell according to any one of the preceding paragraphs, wherein relative to the transcription of the second polynucleotide when operably linked to its native or endogenous Shine-Dalgarno sequence, the mutant Shine-Dalgarno sequence operably linked to the second polynucleotide results in a decrease in the transcription of the second polynucleotide.

[0508] 66. A cell according to any one of the preceding paragraphs, wherein the polypeptide of interest comprises an enzyme; preferably, the enzyme is selected from the group consisting of: hydrolase, isomerase, ligase, lyase, oxidoreductase or transferase; more preferably an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, alpha-galactosidase, beta-galactosidase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, nuclease, oxidase, pectinolytic enzyme, peroxidase, phosphodiesterase, phytase, polyphenol oxidase, proteolytic enzyme, ribonuclease, transglutaminase, xylanase, and beta-xylosidase; even more preferably, the one or more polypeptides of interest comprise amylase or protease.

[0509] 67. A cell according to any one of the preceding paragraphs, wherein the polypeptide of interest comprises a therapeutic polypeptide selected from the group consisting of: antibody, antibody fragment, antibody-based drug, Fc fusion protein, anticoagulant, blood factor, bone morphogenetic protein, engineered protein scaffold, enzyme, growth factor, coagulation factor, hormone, interferon (such as interferon alpha-2b), interleukin, lactoferrin, alpha-lactalbumin, beta-lactalbumin, ovomucoid, ovalbumin, cytokine, obestatin, human galactosidase (such as human alpha-galactosidase A), vaccine, protein vaccine and thrombolytic agent.

[0510] 68. A cell according to any one of the preceding paragraphs, wherein the polypeptide of interest comprises a nanobody (Nb), preferably, the nanobody consists of a single variable light chain (VL).

[0511] 69. A cell according to any one of the preceding paragraphs, wherein the first polynucleotide encodes a polypeptide having amylase activity and comprises or consists of: a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the nucleic acid sequence of SEQ ID NO:6.

[0512] 70. A cell according to any one of the preceding paragraphs, wherein the polypeptide of interest is an amylase, such as a mature polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO:7 or an amylase consisting of the mature polypeptide.

[0513] 71. A cell according to any one of the preceding paragraphs, wherein the first polynucleotide encodes a polypeptide having protease activity and comprises or consists of: a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleic acid sequence of SEQ ID NO:8.

[0514] 72. A cell according to any one of the preceding paragraphs, wherein the polypeptide of interest is a protease, such as a mature polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO:9 or a protease consisting of the mature polypeptide.

[0515] 73. A cell according to any one of the preceding paragraphs, wherein the mutated Shine - Dalgarno sequence comprises at least one nucleic acid substitution, insertion and / or deletion at one or more of the following nucleotide positions:

[0516] - corresponding to positions 1 to 7 of the nucleic acid sequence "AAGGAGG", or the nucleic acid sequence at positions 1 - 7 of SEQ ID NO:3,

[0517] - corresponding to positions 1 - 8 of the nucleic acid sequence "GAGGGGTG",

[0518] - corresponding to positions 1 - 7 of the nucleic acid sequence "AAGGGAG", or

[0519] - corresponding to positions 1 - 8 of the nucleic acid sequence "GGAGGTTG".

[0520] 74. A cell according to any one of the preceding paragraphs, wherein the mutated Shine-Dalgarno sequence comprises at least one nucleic acid substitution, insertion, and / or deletion at a position corresponding to position 3 of the parental SD sequence having the nucleic acid sequence "AAGGAGG", or at a position of the nucleic acid sequence at positions 1-7 of SEQ ID NO:3.

[0521] 75. A cell according to any one of the preceding paragraphs, wherein the mutated Shine-Dalgarno sequence comprises the following nucleic acid substitutions at a position corresponding to position 3 of the parental SD sequence having the nucleic acid sequence "AAGGAGG": adenine (A), G3A; cytosine (C), G3C; or thymine (T), G3T.

[0522] 76. A cell according to any one of the preceding paragraphs, wherein the mutated Shine-Dalgarno sequence comprises the following nucleic acid substitution at a position corresponding to position 3 of the parental SD sequence having the nucleic acid sequence "AAGGAGG": adenine (A), G3A.

[0523] 77. A cell according to any one of the preceding paragraphs, wherein the mutated Shine-Dalgarno sequence comprises or consists of a nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the nucleic acid sequence of "AAAGAGG" or to the nucleic acid sequence at positions 1-7 of SEQ ID NO:4.

[0524] 78. A cell according to any one of the preceding paragraphs, wherein the mutated Shine-Dalgarno sequence comprises or consists of the nucleic acid sequence of "AAAGAGG" or the nucleic acid sequence at positions 1-7 of SEQ ID NO:4.

[0525] 79. A cell according to any one of the preceding paragraphs, wherein the second polynucleotide is operably linked to a mutated Shine-Dalgarno sequence so as to form a coding nucleic acid sequence that comprises or consists of: a coding nucleic acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the nucleic acid sequence of "AAGGAGG" or "AAAGAGG", or with the nucleic acid sequence at positions 1-7 of SEQ ID NO:3 or 4, or with the nucleic acid sequence of "GAGGGGTG", "AAGGGAG" or "GGAGGTTG".

[0526] 80. A cell according to any one of the preceding paragraphs, wherein the mutated Shine-Dalgarno sequence comprises the following nucleic acid substitutions at the position corresponding to position 5 of SEQ ID NO:58: adenine (A), G5A; cytosine (C), G5C; or thymine (T), G5T.

[0527] 81. A cell according to any one of the preceding paragraphs, wherein when cultured under the same conditions, transcription and / or translation of the second polynucleotide is reduced compared to a parental cell that does not comprise either: a) a heterologous promoter operably linked to the second polynucleotide, or b) a mutated Shine-Dalgarno sequence operably linked to the second polynucleotide, the parental cell being isogenic to the mutant cell in other respects.

[0528] 82. A cell according to any one of the preceding paragraphs, wherein the transcription and / or translation of the second polynucleotide (RNAP subunit) is reduced by at least 1%, such as at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% relative to the transcription and / or translation of the RNAP subunit of the parental cell.

[0529] 83. A cell according to any one of the preceding paragraphs, wherein the transcription and / or translation of the second polynucleotide (RNAP subunit) is reduced relative to the transcription and / or translation of the parental cell after culturing for at least 24 hours, such as at least 48 hours, at least 72 hours, at least 96 hours, at least 120 hours or at least 144 hours.

[0530] 84. A cell according to any one of the preceding paragraphs, wherein the yield of the polypeptide of interest is increased compared to the parental cell when cultured under the same conditions.

[0531] 85. A cell according to any one of the preceding paragraphs, wherein the yield of the polypeptide of interest is increased by at least 1%, such as at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34% or at least 35% relative to the yield of the parental cell, preferably the yield of the polypeptide of interest is increased by at least 12% relative to the yield of the parental cell.

[0532] 86. A cell according to any one of the preceding paragraphs, wherein the yield of the polypeptide of interest is increased relative to the yield of the parental cell after culturing for at least 24 hours, such as at least 48 hours, at least 72 hours, at least 96 hours, at least 120 hours or at least 144 hours.

[0533] 87. A cell according to any one of the preceding paragraphs, wherein during the culturing of the cell, when cultured under the same conditions, the biomass is reduced relative to the biomass during the culturing of the parental cell.

[0534] 88. A cell according to any one of the preceding paragraphs, wherein the biomass is reduced by at least 1%, such as at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34% or at least 35% relative to the biomass of the parental cell, preferably the biomass is reduced by at least 18% relative to the biomass of the parental cell.

[0535] 89. A cell according to any one of the preceding paragraphs, wherein the biomass is reduced relative to the biomass of the parental cell after culturing for at least 24 hours, such as at least 48 hours, at least 72 hours, at least 96 hours, at least 120 hours or at least 144 hours.

[0536] 90. A cell according to any one of the preceding paragraphs, wherein the culturing is a fed-batch, batch or continuous culturing method, preferably a fed-batch culturing method.

[0537] 91. A method for producing one or more polypeptides of interest, the method comprising:

[0538] a) providing a cell according to any one of the preceding paragraphs,

[0539] b) culturing the cell under conditions conducive to the expression of the one or more polypeptides of interest; and

[0540] c) optionally recovering the one or more polypeptides of interest.

[0541] 92. A nucleic acid construct comprising a second heterologous promoter and / or a mutated Shine-Dalgarno sequence operably linked to a second polynucleotide according to any one of the preceding embodiments.

[0542] 93. The nucleic acid construct according to paragraph 92, wherein the nucleic acid construct is isolated.

[0543] 94. The nucleic acid construct according to any one of paragraphs 92-93, wherein the nucleic acid construct is purified.

[0544] 95. An expression vector comprising the nucleic acid construct according to paragraphs 92-94.

Claims

1. A mutant cell that contains in its genome a first heterologous promoter operably linked to a first polynucleotide encoding a polypeptide of interest, and one or more second polynucleotides encoding one or more RNA polymerase (Rpo) subunit polypeptides, wherein the expression of the one or more Rpo subunit polypeptides is reduced or eliminated compared to an isogenic cell or parental cell that is otherwise non-mutated.

2. The mutant cell according to claim 1, wherein: a) the second polynucleotide is operably linked to a second heterologous promoter, b) the second polynucleotide is operably linked to a mutated Shine-Dalgarno sequence derived from the parental Shine-Dalgarno sequence, c) the second polynucleotide contains one or more nucleic acid insertions, deletions or substitutions, d) the expression of the second polynucleotide is reduced by a CRISPR inhibition construct, and / or e) the expression of the second polynucleotide is reduced by RNA interference.

3. The mutant cell according to any one of claims 1-2, wherein the parental Shine-Dalgarno sequence has at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the polynucleotide sequence of AAGGAGG or SEQ ID NO:

58.

4. The mutant cell according to any one of claims 1-3, wherein the second polynucleotide is native to the cell.

5. The mutant cell according to any one of claims 1-4, wherein the second polynucleotide encodes an Rpo subunit polypeptide, and the Rpo subunit polypeptide comprises or consists of the following: An amino acid sequence having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of SEQ ID NO:2, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37 or SEQ ID NO:

40.

6. The mutant cell according to any one of the foregoing claims, wherein the cell contains in its genome at least two copies of the first polynucleotide, such as three, four, or five, or six or more copies.

7. The mutant cell according to any one of claims 1 to 6, wherein the cell is a prokaryotic cell, for example, a Gram-positive cell selected from the group consisting of: Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus or Streptomyces cells, or a Gram-negative bacterium selected from the group consisting of: Campylobacter, Escherichia coli, Flavobacterium, Fusobacterium, Helicobacter, Pelobacter, Neisseria, Pseudomonas, Salmonella, and Ureaplasma cells, such as Bacillus alcalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis, Bacillus thuringiensis, Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis, and Streptococcus zooepidemicus, Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus, and Streptomyces lividans cells.

8. The mutant cell according to any one of the preceding claims, wherein the mutated Shine-Dalgarno sequence contains the following nucleic acid substitutions at a position corresponding to position 3 of the parental Shine-Dalgarno sequence having the nucleic acid sequence "AAGGAGG": adenine (A), G3A; cytosine (C), G3C; or thymine (T), G3T, or contains the following nucleic acid substitutions at a position corresponding to position 5 of SEQ ID NO:58: adenine (A), G5A; cytosine (C), G5C; or thymine (T), G5T.

9. The mutant cell according to any one of the preceding claims, wherein when cultured under the same conditions, the expression of one or more Rpo subunit polypeptides is reduced by at least 10%, for example at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90% or at least 95% compared to the expression of one or more Rpo subunit polypeptides of the parental cell.

10. The mutant cell according to any one of the preceding claims, wherein when cultured under the same conditions, the yield of the target polypeptide is increased compared to the yield of the parental cell.

11. The mutant cell according to any one of the preceding claims, wherein when cultured under the same conditions, the biomass formation during the culture of the mutant cell is reduced relative to the biomass formation during the culture of the parental cell.

12. The mutant cell according to any one of the preceding claims, wherein the polypeptide of interest comprises an enzyme; preferably, the enzyme is selected from the group consisting of: hydrolase, isomerase, ligase, lyase, oxidoreductase or transferase; more preferably an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, α-galactosidase, β-galactosidase, α-glucosidase, β-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, nuclease, oxidase, pectinolytic enzyme, peroxidase, phosphodiesterase, phytase, polyphenol oxidase, proteolytic enzyme, ribonuclease, transglutaminase, xylanase, and β-xylosidase; even more preferably, the one or more polypeptides of interest comprise amylase or protease.

13. The mutant cell according to any one of the preceding claims, wherein the polypeptide of interest is amylase, such as an amylase comprising a mature polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO:7 or consisting of the mature polypeptide.

14. The mutant cell according to any one of claims 1-12, wherein the polypeptide of interest is protease, such as a protease comprising a mature polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO:9 or consisting of the mature polypeptide.

15. A method for producing one or more polypeptides of interest, the method comprising: a) providing a mutant cell according to any one of claims 1 to 14, b) culturing the cells under conditions conducive to the expression of the one or more polypeptides of interest; and c) optionally recovering the one or more polypeptides of interest.

Images