CrRNA, CRISPR / Cas reagent and application thereof

Abstract

The invention belongs to the technical field of gene editing, and particularly relates to a crRNA and CRISPR / Cas reagent and application thereof, and the crRNA and CRISPR / Cas reagent is suitable for RNA editing of a Qianzebra fish rasd1 gene. The crRNA has a sequence as shown in SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3. The crRNA provided by the invention can be used for accurately identifying the rasd1 gene locus of the zebrafish in a targeting manner, so that zlwacas13a is more accurate when knocking down the rasd1 gene of the zebrafish.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene editing, and particularly relates to a plurality of crRNAs, a lwacas13a reagent and their applications for a gene, and the crRNAs and zlwacas13a reagent are applicable to RNA editing of the zebrafish rasd1 gene. Background Art

[0002] The zebrafish rasd1 gene is located on chromosome 12, the CDS region is about 798 bp, encoding 266 amino acids, and the protein is about 138 kDa, with 76% homology to the human RASD1 protein. Currently, there is no relevant report on the annotation and functional verification of the zebrafish rasd1 gene. This gene encodes a member of the Ras superfamily of small GTPases and is induced by dexamethasone. The encoded protein is an activator of G protein signaling and acts as a direct nucleotide exchange factor for GI-deprotein. This protein interacts with the neuronal nitric oxide adaptor protein CAPON, as well as a nuclear adaptor protein FE65, which interacts with the amyloid precursor protein of Alzheimer's disease.

[0003] Zebrafish is an animal model widely used in the fields of environmental toxicology, gene function research and drug screening. Its advantages lie in having conserved physiological and metabolic functions, including the pancreas, liver and adipose tissue, making it an ideal model for studying metabolic diseases. On the zebrafish model, researchers can dynamically observe phenotypes such as glucose homeostasis regulation, inflammation, and neuroregulation of metabolic dysfunction, so as to better understand the pathogenesis of human metabolic diseases and the mechanism of drug action. In addition, zebrafish has the advantages of small size, low cost, fast reproduction and fast growth, making it an ideal model for preclinical drug screening. By using the zebrafish model for drug screening, drug evaluation and prediction of clinical effects can be carried out more quickly and accurately. Therefore, the zebrafish model has important application value in the field of drug research and development. In short, zebrafish is a good animal model suitable for various research fields. Its physiological and metabolic functions, as well as advantages such as fast growth and reproduction, make it an ideal model for drug screening and disease research. Currently, there is no myocardial hypertrophy model generated by knocking down the zebrafish rasd1 gene using the CRISPR / zlwacas13a gene editing technology. Based on this, the present invention proposes a crRNA, a CRISPR / Cas reagent and their applications. Summary of the Invention

[0004] Aiming at the above problems, one of the purposes of the present invention is to provide a plurality of crRNAs, which can target the zebrafish rasd1 gene, and use the CRISPR / Cas / zlwacas13a gene editing technology to knock down the zebrafish rasd1 gene.

[0005] To achieve the above object, the present invention may adopt the following technical solutions:

[0006] On the one hand, the present invention provides a crRNA, comprising a sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3.

[0007] Specifically, the above-mentioned crRNAs respectively correspond to different sites of the zebrafish rasd1 gene, and the targeting site is located on the first exon of the zebrafish rasd1 gene. First, a targeting site is selected in the GTPase SAR1 family domain to more effectively affect the structural conformation of G protein in the knockdown model; when using crRNA for zebrafish rasd1 editing, multi-targeting sites can be preferably knocked down simultaneously.

[0008] On the other hand, the present invention provides a CRISPR / Cas reagent. It should be noted that zlwacas13a is the mRNA form of cas13a.

[0009] The CRISPR / Cas reagent includes one or more crRNAs among the crRNA comprising the sequence shown in SEQ ID NO.1, the crRNA comprising the sequence shown in SEQ ID NO.2, and the crRNA comprising the sequence shown in SEQ ID NO.3; and / or zlwaCas13a.

[0010] Wherein, the sequence of zlwaCas13a is as shown in SEQ ID NO.4, specifically:

[0011]

[0012] Furthermore, the amino acid sequence of zwacas13a is shown in SEQ ID NO.5, specifically:

[0013]

[0014] Furthermore, the method of zlwacas13a can be as follows: (1) Preparation of the DNA template of zlwacas13a: Linearize pcdna3.1-t7-zlwacas13a with BamHI. (2) Recover the enzymatic digestion product to obtain the target DNA fragment, which is the DNA template of zlwacas13a. Verify whether the molecular weight of the template meets the expectation through agarose gel electrophoresis. (3) Obtain zlwacas13a through in vitro transcription.

[0015] On the other hand, the present invention provides a transcription template of the above-mentioned crRNA. The transcription template of the crRNA shown in SEQ ID NO.6 is amplified by the following primer pair: the upstream primer includes the sequence shown in SEQ ID NO.7, and the downstream primer includes the sequence shown in SEQ ID NO.8; or the transcription template of the crRNA shown in SEQ ID NO.9 is amplified by the following primer pair: the upstream primer includes the sequence shown in SEQ ID NO.7, and the downstream primer includes the sequence shown in SEQ ID NO.10; or the transcription template of the crRNA shown in SEQ ID NO.11 is amplified by the following primer pair: the upstream primer includes the sequence shown in SEQ ID NO.7, and the downstream primer includes the sequence shown in SEQ ID NO.12.

[0016] Among them, the sequence shown in SEQ ID NO.6 is:

[0017] TAATACGACTCACTATAGGATTTAGACUACCCCAAAAACGAAGGGGACTAAAACAGTATCCAAAATATCCAGCTGAT;

[0018] The sequence shown in SEQ ID NO.9 is:

[0019] TAATACGACTCACTATAGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAACCCGTTCAGAAAGCGCGACACGAT;

[0020] The sequence shown in SEQ ID NO.11 is:

[0021] TAATACGACTCACTATAGGATTTAGACUACCCCAAAAACGAAGGGGACTAAAACGAAGTATCCAAAATATCCAGCTG.

[0022] The sequences shown in SEQ ID NO.6, SEQ ID NO.9 and SEQ ID NO.11 above are amplification primers with target sequences.

[0023] Specifically, the method for preparing the transcription template of the above-mentioned crRNA may include: (1) Design and construct the upstream primer of crRNA: The T7 promoter sequence is connected to a 36-nt forward repeat sequence containing the crRNA fixed primer, and the downstream primer: a 22-nt to 25-nt target site recognition sequence is connected to a 17-nt reverse repeat sequence. (2) Prepare the DNA template of crRNA by self-ligating the upstream and downstream primers, and recover the PCR product of the amplification product to obtain the transcription template of the above-mentioned crRNA; it should be understood that the above-mentioned obtained transcription template of crRNA can be obtained by in vitro transcription to obtain the above-mentioned crRNA (also called rasd1-crRNA); it should be noted that about 2 to 3 arbitrary bases can be added upstream of the T7 promoter when designing the upstream primer in step (1), which can improve the transcription efficiency.

[0024] Specifically, when the above-mentioned crRNA or the above-mentioned zLWaCas13a is used, the crRNA and zLWaCas13a mRNA can be mixed into an RNA-Mix and introduced into zebrafish fertilized eggs. The final concentration of crRNA is 200 ng / μL, and the final concentration of zLWaCas13a mRNA is 200 ng / μL. The volume of the liquid introduced into each zebrafish fertilized egg is 1 nL.

[0025] The application of crRNA or CRISPR / Cas reagent in cultivating zebrafish, and the cultivated zebrafish is a zebrafish with low expression of RASD1 protein.

[0026] The beneficial effects of the present invention are as follows:

[0027] (1) The crRNA provided by the present invention can accurately target and recognize the zebrafish rasd1 gene locus, making zLWaCas13a more accurate when knocking down the zebrafish rasd1 gene;

[0028] (2) The Cas13 technology provided by the present invention can effectively knockdown the zebrafish rasd1 gene, reduce the expression of the rasd1 gene, and obtain zebrafish with phenotypes related to the zebrafish gene rasd1 protein deficiency syndrome. Description of the Drawings

[0029] To more clearly illustrate the technical solutions of the embodiments of the present application, the accompanying drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following accompanying drawings only show some embodiments of the present application and should not be regarded as limiting the scope. For those of ordinary skill in the art, without creative efforts, other relevant accompanying drawings can also be obtained based on these drawings.

[0030] Figure 1 It is a zebrafish rasd1 gene knockdown model. The relative expression level of the rasd1 gene decreased at 2 dpf, with 18s as the internal reference gene (n = 3, *P < 0.05);

[0031] Figure 2 It is a zebrafish rasd1 gene knockdown model, showing abnormal heart development at 2 dpf;

[0032] Figure 3 It is a zebrafish rasd1 gene knockdown model, and the qPCR of myocardial hypertrophy index at 2 dpf, (n = 3, *P < 0.05). Specific embodiments

[0033] The technical solutions of the present invention will be described clearly and completely below. Obviously, the described embodiments are some embodiments of the present invention, rather than all embodiments. For those not specified in the embodiments, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. For reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0034] Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope protected by the present invention.

[0035] In the following embodiments, the zebrafish cmlc2 strain involved is provided by Nantong University; the plasmid pcDNA3.1-t7-zlwacas13a plasmid.

[0036] In the following embodiments, the main reagents are as follows: AxyPrep PCR Clean-up Kit (AXYGEN, #AP-PCR-250), AxyPrep Plasmid DNA Mini-prep Kit (AXYGEN, #AP-MN-P-250), mMESSAGE mMACHINE T7 Transcription Kit (Invitrogen, #AM1344), Poly(A) Tailing Kit (Invitrogen, #AM1350); 2×Rapid Taq Master Mix (vazyme, #P222-01).

[0037] In the following examples, the main instruments are as follows: real-time fluorescence quantitative PCR amplifier (brand: ABI, model: StepOnePlus), ultra-micro spectrophotometer (brand: ThermoFisherScintific, model: NanodropONE), high-speed sample lysis bench homogenizer (brand: MP, model: FastPrep-245G), vertical needle puller (brand: NARISHIGE, model: PC-100), microinjection system (brand: WorldPrecisionlnstruments, model: NanojectIII), stereomicroscope (brand: Nikon, model: SMZ745T).

[0038] Example 1: Construction of the CRISPR / zlwacas13a system

[0039] (1) Select the rasd1-crRNA targeting site on the zebrafish rasd1 gene and analyze and confirm the specificity of the rasd1-crRNA targeting site.

[0040] Obtain the protein coding sequence of the zebrafish rasd1 gene from the NCBI database; input the DNA sequence of the rasd1 gene on the cas13design (https: / / cas13design.nygenome.org / ) website and design the targeting site, set the genomic information as zebrafish, and select the automatically generated targeting site sequences, and the sequences include the sequences shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3.

[0041] Among them,

[0042] SEQ ID NO.1 is AGTATCCAAAATATCCAGCTGAT;

[0043] SEQ ID NO.2 is CCGTTCAGAAAGCGCGACACGAT;

[0044] SEQ ID NO.3 is GAAGTATCCAAAATATCCAGCTG.

[0045] By BLAST alignment of the sequences, the results show that the 3 rasd1-crRNA targeting sequences are all specific sequences of the rasd1 gene and are located in the first exon of rasd1 respectively;

[0046] (2) Preparation of rasd-crRNA

[0047] 1) Design and construct the upstream primer of crRNA: The T7 promoter sequence is ligated to a 36-nt forward repeat sequence containing the crRNA fixed primer, and the sequence is as shown; downstream primer: a 22-25-nt target site recognition sequence is ligated to a 17-nt reverse repeat sequence, and the sequence is as shown:

[0048] The sequence of the upstream universal primer shown in SEQ ID NO.7 is:

[0049] TAATACGACTCACTATAGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAACC

[0050] Downstream primer

[0051] The sequence shown in SEQ ID NO.8 is: (crRNA1-R)

[0052] ATCAGCTGGATATTTTGGATACTGTTTTAGTCCCCTTCGT

[0053] The sequence shown in SEQ ID NO.10 is: (crRNA2-R)

[0054] ATCGTGTCGCGCTTTCTGAACGGGTTTTAGTCCCCTTCGT

[0055] The sequence shown in SEQ ID NO.12 is: (crRNA3-R)

[0056] CAGCTGGATATTTTGGATACTTCGTTTTAGTCCCCTTCGT

[0057] 2) Prepare the DNA template of crRNA by self-ligation of the upstream and downstream primers. The reaction system is as follows:

[0058] 2×Mastermix (Novizan) 40 μl, 38 μl of ultrapure water, 1 μl of forward and reverse primers (100 μM).

[0059] 3) Perform PCR reaction according to the above reaction system and use agarose gel electrophoresis to verify the molecular weight of the amplified band, and obtain an electrophoretic band of about 75 bp; recover the PCR product of the amplified product; use InvitroTranscription T7 Kit for in vitro transcription to obtain rasd1-crRNA. The reaction system is shown: The reaction system for in vitro transcription is as follows (20.0 μL):

[0060] 4 μL of 10× Transcription Buffer, 2 μL of 10 mM ATP, 2 μL of 10 mM CTP, 2 μL of 10 mM GTP, 2 μL of 10 mM UTP, 4 μL of T7 RNA polymerase mix, 24 μL of template DNA. After mixing the system, react at 37 °C for 2 h; add 1.5 μL of DNase I (Ambion, USA), incubate in a water bath at 37 °C for 15 min to remove the template.

[0061] Then add 160 μL of DEPC water to expand the volume to 200 μL. At the same time, add 20 μL of nuclease-free 3 M sodium acetate (pH 5.2) and 3 volumes of absolute ethanol (domestic analytical grade), precipitate overnight at -80 °C. Centrifuge at 12,000 g at 4 °C for 20 min. After removing the supernatant, add nuclease-free 75% ethanol, centrifuge at 12,000 g at 4 °C for 20 min. After removing the supernatant, air-dry the precipitate in a fume hood, and then resuspend it in 20 μL of nuclease-free ultrapure water and store it at -80 °C in the refrigerator for later use.

[0062] Use a Nano Drop ultra-micro spectrophotometer to detect the concentration and purity of the in vitro transcribed RNA. The detection results are as follows

[0063] rasd1-crRNA1: 1501 ng / ul OD: 1.98

[0064] rasd1-crRNA2: 1311 ng / ul OD: 1.95

[0065] rasd1-crRNA3: 1386 ng / ul OD: 1.90

[0066] 4) Obtain zlwacas13a Mran as described above

[0067] Use mMESSAGE T7 Kit (Ambion) for transcription.

[0068] The reaction system for in vitro transcription is as follows (20.0 μL):

[0069] 10.0 μL of 2× NTP / CAP

[0070] 2.0 μL of 10× T7 Reaction Buffer

[0071] 1.0 μg taken from 2.1

[0072] 2.0 μL of T7 Enzyme Mix

[0073] Up to 20.0 μL of Nuclease-free water

[0074] The reaction conditions were: water bath at 37 °C for 2 h.

[0075] After in vitro transcription was completed, 1 μL of TURBO DNase I was added, and the water bath was continued at 37 °C for 15 min to remove the DNA template.

[0076] The above-mentioned zlwacas13amRAN product was tailed at the 3' end using the Poly(A) Tailing Kit, and the reaction system

[0077] 20.0 μl of T7 reaction composition

[0078] 20.0 μl of 5×E-PAP Buffer

[0079] 10.0 μl of 25 mM MnCl2

[0080] 10.0 μl of ATP Solution

[0081] 4.0 μl of E-PAP

[0082] 36.0 μl of Nuclease-free water

[0083] The reaction conditions were: water bath at 37 °C for 45 min.

[0084] 10 μl of Lithium Chloride Precipitation Solution was added and left at -80 °C overnight.

[0085] Centrifuge at 4 °C, 12,000 g for 10 min.

[0086] Carefully discard the supernatant, add 1000 μL of 75% ethanol (prepared with DEPC water). Vortex thoroughly to wash, and flick the bottom of the tube to suspend the precipitate.

[0087] Centrifuge at 4 °C, 12000 g for 10 min, discard the supernatant, taking care not to lose the RNA precipitate.

[0088] Repeat the above steps once.

[0089] Dry in the fume hood for 1 min. Add 20 μL of RNase-free water to dissolve the RNA. After complete dissolution, take a small amount for detection, and store the remaining solution at -80 °C.

[0090] Use a Nano Drop ultra-micro spectrophotometer to detect the concentration and purity of the mRNA obtained by in vitro transcription. The detection results are as follows

[0091] zlwacas13a mRNA: 3020 ng / ul OD: 2.11

[0092] (4) Mix rasd1-crRNA and zlwacas13a mRNA to form RNA-Mix.

[0093] Example 2 Construction and Verification of Zebrafish rasd1 Gene Knockdown Model

[0094] (1) Model construction

[0095] Inject the above RNA-Mix into the fertilized eggs of zebrafish at the single-cell stage by microinjection. The final concentration of rasd1-crRNA is 200 ng / μL, and the final concentration of zlwacas13a mRNA is 200 ng / μL. The volume of the liquid injected into each zebrafish fertilized egg is lnL;

[0096] (2) Identify whether the expression of the rasd1 gene is reduced in the knockdown animal model and whether there is a disease model.

[0097] 1) Take 20 zebrafish at 2 dpf with successful injection, add them to 1 mL of TRIzol reagent and transfer the mixture to a 1.5 mL EP tube. Homogenize twice at a rate of 5 m / s using FastPrep-24, and place the sample on dry ice for 5 min between the two homogenizations; Extract RNA according to the standard TRIzol extraction protocol described in the ThermoFisher Scientific manual; Before performing the qPCR experiment, detect the concentration and purity of RNA using a ultra-micro spectrophotometer;

[0098] 2) Use the following sequences as primer pairs, Rasd1 F: 5′-CCTCGGGTCCACCAAAGT-3′; R: 5′-GTTCCCTGAAGTATCCAAAA-3′; Amplify approximately 150 bp of the upstream and downstream sequences of the rasd1-crRNA target site, and detect the relative expression level of the srasd1 gene by real-time fluorescence quantitative PCR; The results are as Figure 1 shown. When zlwacas13a mRNA and rasd1-crRNA are co-injected into zebrafish, the relative expression level of the rasd1 gene decreases and there is a significant difference;

[0099] 3) Observe the development of zebrafish at 48 hpf with successful injection under a stereomicroscope and observe the heart; The results are as Figure 2 and Figure 3 shown. When zlwacas13a mRNA and rasd1-crRNA are co-injected into zebrafish, the ventricular volume of zebrafish is smaller than that of the control group (asFigure 2 as shown), and significant differences were found after statistical analysis of the data (such as Figure 3 shown).

[0100] Finally, it should be noted that the above embodiments are only used to illustrate the present invention and do not limit the technical solutions described in the present invention; those of ordinary skill in the art should understand that the present invention can still be modified or equivalently replaced; and all technical solutions and their improvements that do not depart from the spirit and scope of the present invention should be covered by the scope of the claims of the present invention.

Claims

1. A crRNA, characterized in that it comprises a sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.

3.

2. A CRISPR / Cas reagent, characterized in that, It comprises one or more of the crRNAs including the sequence shown in SEQ ID NO.1, the crRNA including the sequence shown in SEQ ID NO.2, and the crRNA including the sequence shown in SEQ ID NO.3; and / or zlwaCas13a.

3. The CRISPR / Cas reagent according to claim 2, characterized in that, The sequence of the zlwaCas13a is shown in SEQ ID NO.

4.

4. The CRISPR / Cas reagent according to claim 2, characterized in that, The amino acid sequence of the zlwaCas13a is shown in SEQ ID NO.

5.

5. A transcription template of the crRNA as described in claim 1, characterized in that, The transcription template of the crRNA including the sequence shown in SEQ ID NO.6 is amplified by the following primer pair: the upstream primer comprises the sequence shown in SEQ ID NO.7, and the downstream primer comprises the sequence shown in SEQ ID NO.8; or the transcription template of the crRNA including the sequence shown in SEQ ID NO.9 is amplified by the following primer pair: the upstream primer comprises the sequence shown in SEQ ID NO.7, and the downstream primer comprises the sequence shown in SEQ ID NO.10; or the transcription template of the crRNA including the sequence shown in SEQ ID NO.11 is amplified by the following primer pair: the upstream primer comprises the sequence shown in SEQ ID NO.7, and the downstream primer comprises the sequence shown in SEQ ID NO.

12.

6. The crRNA according to claim 1, wherein The targeting site of the crRNA is the first exon of the zebrafish rasd1 gene.

7. Use of the crRNA according to claim 1 or the CRISPR / Cas reagent according to claim 2 or 3 in culturing zebrafish.

8. The application according to claim 6, characterized in that The cultured zebrafish is a zebrafish with low expression of RASD1 protein.

Images