Compositions and methods related to nucleic acid anticoagulants

Abstract

The present disclosure provides compositions and methods related to nucleic acid molecules with therapeutic aptamers. Specifically, the present disclosure provides nucleic acid molecules comprising one or more aptamers having anticoagulant activity, and corresponding nucleic acid antidotes for modulating blood coagulation in the context of diseases and surgical interventions.

Description

[0001] This application is a divisional application of a Chinese invention patent application with an application date of October 25, 2019, an invention title of "Compositions and Methods Related to Nucleic Acid Anticoagulants", and a patent application number: 201980070857.1.

[0002] Cross - reference to related applications

[0003] This application claims the priority and benefit of U.S. Provisional Patent Application No. 62 / 750,900, filed on October 26, 2018, which is hereby incorporated by reference in its entirety for all purposes.

[0004] Government support

[0005] This invention was made with government support under Grant Nos. 1559077, 1603179, and 1709010 awarded by the National Science Foundation (NSF) of the United States. The government has certain rights in this invention.

[0006] Incorporation by reference of materials submitted electronically

[0007] The following computer - readable nucleotide / amino acid sequence listing, which is submitted herewith and identified as follows, is hereby incorporated by reference in its entirety: a 10,156 - byte ASCII (text) file named "37060 - 601_ST25.txt" created on October 25, 2019. Technical field

[0008] The present disclosure provides compositions and methods related to nucleic acid molecules having therapeutic aptamers. Specifically, the present disclosure provides nucleic acid molecules comprising one or more aptamers having anticoagulant activity, and corresponding nucleic acid antidotes, for modulating blood coagulation in the context of disease and surgical interventions. Background art

[0009] The coagulation cascade involves a series of enzymatic reactions that ultimately result in the formation of a fibrin clot on the surface of a ruptured blood vessel and on cell surfaces. Anticoagulants interrupt the coagulation process by blocking key players in the cascade. Thus, modulating fibrin clot formation with anticoagulants can prevent thrombosis, i.e., the formation of blood clots in vital organs such as the heart, lungs, and brain. Life - threatening consequences of thrombosis include stroke or transient ischemic attack, heart attack, deep vein thrombosis, and pulmonary embolism.

[0010] The most commonly prescribed anticoagulant drug is Warfarin, which is a small molecule often used as a rodenticide. Warfarin is a vitamin K antagonist that inhibits the synthesis of clotting factors II, VII, IX, and X, as well as the endogenous anticoagulant proteins C and S. The body's sensitivity to vitamin K fluctuations requires strict and timely monitoring of its levels and corresponding adjustment of the dosage. Other forms of anticoagulants include heparin, factor Xa inhibitors, direct thrombin inhibitors, and fibrinolytics. For effective treatment of clotting without causing excessive anticoagulation, for example, during surgery if the dosage of the anticoagulant is too high, all current anticoagulation methods uniformly have a narrow therapeutic window. Unfortunately, there is no antidote for chemical-based anticoagulants that can further mediate the dosage and inhibit cytotoxic effects. Summary of the Invention

[0012] Embodiments of the present disclosure provide a single-stranded nucleic acid molecule that includes at least one A-form double helix structure and at least one crossover region, at least one kissing loop region, and at least one nucleic acid aptamer having anticoagulant activity.

[0013] In some embodiments, the nucleic acid molecule includes at least one tetraloop region. In some embodiments, the nucleic acid molecule is an RNA molecule or an RNA molecule that includes at least one nucleotide having a 2'-modification.

[0014] In some embodiments, the single-stranded nucleic acid molecule includes at least one tetraloop region that contains a tetranucleotide motif. In some embodiments, the single-stranded nucleic acid molecule includes one to six tetraloop regions, each of which contains a tetranucleotide motif. In some embodiments, the single-stranded nucleic acid molecule includes at least one kissing loop region, and the at least one kissing loop region is a 180° kissing loop region. In some embodiments, the single-stranded nucleic acid molecule includes a 180° kissing loop region.

[0015] In some embodiments, the single-stranded nucleic acid molecule includes one to four aptamers having anticoagulant activity. According to these embodiments, each of the one to four aptamers replaces a tetraloop region.

[0016] In some embodiments, the nucleic acid molecule is an RNA molecule having at least 80% sequence identity with SEQ ID NO: 1.SEQ 1.

[0017] In some embodiments, the anticoagulant activity of the at least one nucleic acid aptamer comprises thrombin inhibition. In some embodiments, the anticoagulant activity of the at least one nucleic acid aptamer includes inhibition of one or more of factor XIIa, factor XIIIa, factor XIa, factor IXa, factor Xa, and von Willebrand factor. In some embodiments, the at least one nucleic acid aptamer comprises an antithrombin RNA R9D-14T aptamer or a derivative thereof. In some embodiments, the at least one nucleic acid aptamer comprises an antithrombin Toggle-25t RNA aptamer or a derivative thereof.

[0018] In some embodiments, the nucleic acid molecule is an RNA molecule comprising from about 100 to about 600 nucleotides.

[0019] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule (2HO-RNA-12NN or 2HF-RNA-12NN) comprising a nucleic acid aptamer capable of binding to exosite 1 of thrombin and a nucleic acid aptamer capable of binding to exosite 2 of thrombin, wherein the nucleic acid aptamer capable of binding to exosite 1 of thrombin replaces the tetraloop region 1 of the RNA molecule, and the nucleic acid aptamer capable of binding to exosite 2 of thrombin replaces the tetraloop region 2 of the RNA molecule. In some embodiments, the RNA molecule has at least 80% sequence identity with SEQ ID NO: 2.

[0020] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule (2HO-RNA-1N2N or 2HF-RNA-1N2N) comprising a nucleic acid aptamer capable of binding to exosite 1 of thrombin and a nucleic acid aptamer capable of binding to exosite 2 of thrombin, wherein the nucleic acid aptamer capable of binding to exosite 1 of thrombin replaces the tetraloop region 1 of the RNA molecule, and the nucleic acid aptamer capable of binding to exosite 2 of thrombin replaces the tetraloop region 3 of the RNA molecule. In some embodiments, the RNA molecule has at least 80% sequence identity with SEQ ID NO: 3.

[0021] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule (2HO-RNA-2NN1 or 2HF-RNA-2NN1) comprising a nucleic acid aptamer capable of binding to exosite 2 of thrombin and a nucleic acid aptamer capable of binding to exosite 1 of thrombin, wherein the nucleic acid aptamer capable of binding to exosite 2 of thrombin replaces the tetraloop region 1 of the RNA molecule, and the nucleic acid aptamer capable of binding to exosite 1 of thrombin replaces the tetraloop region 4 of the RNA molecule. In some embodiments, the RNA molecule has at least 80% sequence identity with SEQ ID NO: 4.

[0022] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule (Fss12) comprising an aptamer capable of binding to exosite 2 of thrombin linked to one end of a single-stranded RNA linker and an aptamer capable of binding to exosite 1 of thrombin linked to the other end of the single-stranded RNA linker. In some embodiments, the RNA molecule has at least 80% sequence identity with SEQ ID NO: 5.

[0023] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule (2H-2211) comprising two aptamers capable of binding to exosite 2 of thrombin and two aptamers capable of binding to exosite 1 of thrombin, wherein the two aptamers capable of binding to exosite 2 of thrombin each replace the tetraloop regions 1 and 2 of the RNA molecule, and the two aptamers capable of binding to exosite 1 of thrombin each replace the tetraloop regions 3 and 4 of the RNA molecule. In some embodiments, the RNA molecule has at least 80% sequence identity with SEQ ID NO: 6.

[0024] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule (3H-2NN1) comprising an aptamer capable of binding to exosite 2 of thrombin, an aptamer capable of binding to exosite 1 of thrombin, and an A-type double helix structure, wherein the aptamer capable of binding to exosite 2 of thrombin replaces the tetraloop region 1 of the RNA molecule, the aptamer capable of binding to exosite 1 of thrombin replaces the tetraloop region 4 of the RNA molecule, and the A-type double helix structure separates the aptamer capable of binding to exosite 2 of thrombin from the aptamer capable of binding to exosite 1 of thrombin. In some embodiments, the RNA molecule has at least 80% sequence identity with SEQ ID NO: 7.

[0025] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule (4H-2NN1) comprising an aptamer capable of binding to exosite 2 of thrombin, an aptamer capable of binding to exosite 1 of thrombin, and two A-type double helix structures, wherein the aptamer capable of binding to exosite 2 of thrombin replaces the tetraloop region 1 of the RNA molecule, the aptamer capable of binding to exosite 1 of thrombin replaces the tetraloop region 4 of the RNA molecule, and the two A-type double helix structures separate the aptamer capable of binding to exosite 2 of thrombin from the aptamer capable of binding to exosite 1 of thrombin. In some embodiments, the RNA molecule has at least 80% sequence identity with SEQ ID NO: 8.

[0026] In some embodiments, the aptamer capable of binding to exosite 1 of thrombin is RNA R9D-14TAn aptamer or a derivative thereof. In some embodiments, the nucleic acid aptamer capable of binding to exosite 2 of thrombin is the Toggle-25t RNA aptamer or a derivative thereof.

[0027] Embodiments of the present disclosure also include DNA molecules encoding any one of the single-stranded nucleic acid molecules described herein.

[0028] Embodiments of the present disclosure also include anticoagulant compositions. According to these embodiments, the composition includes a single-stranded nucleic acid molecule and a pharmaceutically acceptable excipient, solvent, carrier, or diluent, the single-stranded nucleic acid molecule comprising at least one A-type double helix structure, at least one crossover region, at least one tetraloop region, at least one kissing loop region, and at least one nucleic acid aptamer having anticoagulant activity.

[0029] Embodiments of the present disclosure also include systems for regulating coagulation. According to these embodiments, the system includes any one of the single-stranded nucleic acid molecules described herein and at least one single-stranded nucleic acid antidote capable of binding to at least a portion of any one of the single-stranded nucleic acid molecules described herein, the at least one single-stranded nucleic acid antidote counteracting the anticoagulant activity of these single-stranded nucleic acid molecules.

[0030] In some embodiments, the at least one nucleic acid antidote is a DNA molecule, an RNA molecule, an O-methyl RNA molecule, a fluorine-modified RNA molecule, a PNA molecule, an LNA molecule, or a combination or derivative thereof. In some embodiments, the at least one nucleic acid antidote binds to at least a portion of any one of the single-stranded nucleic acid molecules described herein in an antiparallel complementary manner. In some embodiments, the at least one nucleic acid antidote binds to at least one nucleic acid aptamer of any one of the single-stranded nucleic acid molecules described herein to counteract the anticoagulant activity.

[0031] The present disclosure may specifically include the following embodiments:

[0032] 1. A single-stranded nucleic acid molecule, comprising:

[0033] At least one A-type double helix structure and at least one crossover region;

[0034] At least one kissing loop region; and

[0035] At least one nucleic acid aptamer having anticoagulant activity.

[0036] 2. The nucleic acid molecule according to Technical Solution 1, further comprising at least one tetraloop region.

[0037] 3. The nucleic acid molecule according to Technical Solution 1 or 2, wherein the nucleic acid molecule is an RNA molecule.

[0038] 4. The nucleic acid molecule according to any one of Technical Solutions 1 to 3, wherein the nucleic acid molecule is an RNA molecule comprising at least one nucleoside having a 2'-modification.

[0039] 5. The nucleic acid molecule according to Technical Solution 2, wherein the at least one tetraloop region comprises a tetranucleotide motif.

[0040] 6. The nucleic acid molecule according to any one of Technical Solutions 1 to 5, wherein the nucleic acid molecule comprises one to six tetraloop regions, each tetraloop comprising a tetranucleotide motif.

[0041] 7. The nucleic acid molecule according to any one of Technical Solutions 1 to 6, wherein the at least one kissing loop region is a 180° kissing loop region.

[0042] 8. The nucleic acid molecule according to any one of Technical Solutions 1 to 7, wherein the nucleic acid molecule comprises one to four aptamers having anticoagulant activity.

[0043] 9. The nucleic acid molecule according to Technical Solution 8, wherein each of the one to four aptamers replaces a tetraloop region.

[0044] 10. The nucleic acid molecule according to any one of Technical Solutions 1 to 9, wherein the nucleic acid molecule is an RNA molecule having at least 80% sequence identity with SEQ ID NO: 1, SEQ 1.

[0045] 11. The nucleic acid molecule according to any one of Technical Solutions 1 to 10, wherein the anticoagulant activity of the at least one nucleic acid aptamer comprises thrombin inhibition.

[0046] 12. The nucleic acid molecule according to any one of Technical Solutions 1 to 10, wherein the anticoagulant activity of the at least one nucleic acid aptamer comprises inhibition of one or more of factor XIIa, factor XIIIa, factor XIa, factor IXa, factor Xa, and von Willebrand factor.

[0047] 13. The nucleic acid molecule according to Technical Solution 11, wherein the at least one nucleic acid aptamer comprises an antithrombin RNA R9D-14T aptamer or a derivative thereof.

[0048] 14. The nucleic acid molecule according to Technical Solution 11, wherein the at least one nucleic acid aptamer comprises an antithrombin Toggle-25t RNA aptamer or a derivative thereof.

[0049] 15. The nucleic acid molecule according to any one of Technical Solutions 1 to 14, wherein the nucleic acid molecule is an RNA molecule comprising about 100 to about 600 nucleotides.

[0050] 16. The nucleic acid molecule according to any one of Technical Solutions 1 to 15, wherein the nucleic acid molecule is an RNA molecule comprising:

[0051] An aptamer capable of binding to exosite 1 of thrombin, which replaces the tetraloop region 1 of the RNA molecule; and

[0052] An aptamer capable of binding to exosite 2 of thrombin, which replaces the tetraloop region 2 of the RNA molecule.

[0053] 17. The nucleic acid molecule according to Technical Solution 16, wherein the RNA molecule has at least 80% sequence identity with SEQ ID NO: 2.

[0054] 18. The nucleic acid molecule according to any one of Technical Solutions 1 to 15, wherein the nucleic acid molecule is an RNA molecule comprising:

[0055] An aptamer capable of binding to exosite 1 of thrombin, which replaces the tetraloop region 1 of the RNA molecule; and

[0056] An aptamer capable of binding to exosite 2 of thrombin, which replaces the tetraloop region 3 of the RNA molecule.

[0057] 19. The nucleic acid molecule according to Technical Solution 18, wherein the RNA molecule has at least 80% sequence identity with SEQ ID NO: 3.

[0058] 20. The nucleic acid molecule according to any one of Technical Solutions 1 to 15, wherein the nucleic acid molecule is an RNA molecule comprising:

[0059] An aptamer capable of binding to exosite 2 of thrombin, which replaces the tetraloop region 1 of the RNA molecule; and

[0060] An aptamer capable of binding to exosite 1 of thrombin, which replaces the tetraloop region 4 of the RNA molecule.

[0061] 21. The nucleic acid molecule according to Technical Solution 20, wherein the RNA molecule has at least 80% sequence identity with SEQ ID NO: 4.

[0062] 22. The nucleic acid molecule according to any one of Technical Solutions 1 to 15, wherein the nucleic acid molecule is an RNA molecule comprising:

[0063] An aptamer capable of binding to exosite 2 of thrombin, which is connected to one end of a single-stranded RNA linker; and

[0064] An aptamer capable of binding to exosite 1 of thrombin, which is connected to the other end of the single-stranded RNA linker.

[0065] 23. The nucleic acid molecule according to claim 22, wherein the RNA molecule has at least 80% sequence identity with SEQ ID NO: 5.

[0066] 24. The nucleic acid molecule according to any one of claims 1 to 15, wherein the nucleic acid molecule is an RNA molecule comprising:

[0067] two nucleic acid aptamers capable of binding to exosite 2 of thrombin, each nucleic acid aptamer replacing the tetraloop regions 1 and 2 of the RNA molecule respectively; and

[0068] two nucleic acid aptamers capable of binding to exosite 1 of thrombin, each nucleic acid aptamer replacing the tetraloop regions 3 and 4 of the RNA molecule respectively.

[0069] 25. The nucleic acid molecule according to claim 24, wherein the RNA molecule has at least 80% sequence identity with SEQ ID NO: 6.

[0070] 26. The nucleic acid molecule according to any one of claims 1 to 15, wherein the nucleic acid molecule is an RNA molecule comprising:

[0071] a nucleic acid aptamer capable of binding to exosite 2 of thrombin, which replaces the tetraloop region 1 of the RNA molecule;

[0072] a nucleic acid aptamer capable of binding to exosite 1 of thrombin, which replaces the tetraloop region 4 of the RNA molecule; and

[0073] at least one A-type double helix structure that separates the nucleic acid aptamer capable of binding to exosite 2 of thrombin from the nucleic acid aptamer capable of binding to exosite 1 of thrombin.

[0074] 27. The nucleic acid molecule according to claim 26, wherein the RNA molecule has at least 80% sequence identity with SEQ ID NO: 7.

[0075] 28. The nucleic acid molecule according to any one of claims 1 to 15, wherein the nucleic acid molecule is an RNA molecule comprising:

[0076] a nucleic acid aptamer capable of binding to exosite 2 of thrombin, which replaces the tetraloop region 1 of the RNA molecule;

[0077] a nucleic acid aptamer capable of binding to exosite 1 of thrombin, which replaces the tetraloop region 4 of the RNA molecule; and

[0078] at least two A-type double helix structures that separate the nucleic acid aptamer capable of binding to exosite 2 of thrombin from the nucleic acid aptamer capable of binding to exosite 1 of thrombin.

[0079] 29. The nucleic acid molecule according to aspect 26, wherein the RNA molecule has at least 80% sequence identity with SEQ ID NO: 8.

[0080] 30. The nucleic acid molecule according to any one of aspects 16 to 29, wherein the nucleic acid aptamer capable of binding to exosite 1 of thrombin is an RNA R9D-14T aptamer or a derivative thereof, and wherein the nucleic acid aptamer capable of binding to exosite 2 of thrombin is a Toggle-25t RNA aptamer or a derivative thereof.

[0081] 31. A DNA molecule encoding any one of the single-stranded nucleic acid molecules according to aspects 1 to 30.

[0082] 32. An anticoagulant composition comprising:

[0083] A single-stranded nucleic acid molecule comprising at least one A-type double helix structure, at least one crossover region, at least one tetraloop region, at least one kissing loop region, and at least one nucleic acid aptamer having anticoagulant activity; and

[0084] A pharmaceutically acceptable excipient, solvent, carrier, or diluent.

[0085] 33. A system for regulating coagulation, the system comprising:

[0086] Any one of the single-stranded nucleic acid molecules according to aspects 1 to 30; and

[0087] At least one single-stranded nucleic acid antidote capable of binding to at least a part of any one of the single-stranded nucleic acid molecules according to aspects 1 to 30 to counteract the anticoagulant activity of the single-stranded nucleic acid molecules according to aspects 1 to 30.

[0088] 34. The system according to aspect 33, wherein the at least one nucleic acid antidote is a DNA molecule, an RNA molecule, an O-methyl RNA molecule, a fluorine-modified RNA molecule, a PNA molecule, an LNA molecule, or a combination or derivative thereof.

[0089] 35. The system according to aspect 33 or aspect 34, wherein the at least one nucleic acid antidote binds to at least a part of any one of the single-stranded nucleic acid molecules according to aspects 1 to 30 in an antiparallel complementary manner.

[0090] 36. The system according to any one of aspects 33 to 35, wherein the at least one nucleic acid antidote binds to at least one nucleic acid aptamer of any one of the single-stranded nucleic acid molecules according to aspects 1 to 30 to counteract the anticoagulant activity. Brief Description of the Drawings

[0091] Figure 1 Schematic illustration of the coagulation cascade and the corresponding enzymes targeted by anticoagulant drugs. Thrombin plays an important role in coagulation by catalyzing the cleavage of fibrinogen, upstream coagulation factors, and platelet receptors. The catalytic active site and two extended surfaces (referred to as exosites) of thrombin are involved in macromolecular ligand binding and can be blocked using molecules based on chemicals and biologics, thereby preventing coagulation. Control of thrombin activity in the coagulation cascade provides therapeutic, surgical, and clinical benefits.

[0092] Figure 2A To 2E include representative depictions of nucleic acid-based aptamers with anticoagulant activity. Figure 2A Include the tertiary structure of thrombin, including the positions of exosite 1 and exosite 2. Figures 2B to 2E include examples of DNA aptamers and RNA aptamers that are used as anticoagulants due to their specific inhibition of thrombin activity. RNA R9D-14T (Figure 2B) and Toggle-25t (Figure 2C) RNA aptamers bind to exosite 1 and exosite 2 of thrombin, respectively. The DNA aptamers NU172 (Figure 2D) and HD22 (Figure 2E) bind to exosite 1 and exosite 2 of thrombin, respectively.

[0093] Figure 3 Depicts the crystal structure of the Toggle-25t RNA aptamer that binds to exosite 2 of thrombin.

[0094] Figure 4 Is an illustrative image (not to scale) of an RNA origami that binds to thrombin. The RNA origami structure contains a 2-helix structure.

[0095] Figures 5A to 5B include representative images of RNA molecules with an A-type double helix structure (Figure 5A) and a 180° kissing loop (Figure 5B).

[0096] Figures 6A to 6B include representative images of a tetraloop before (Figure 6A) and after (Figure 6B) extraction from a larger structure. The red circle shows the tetraloop within the larger structure.

[0097] Figures 7A to 7B include representative images of an exosite 2 thrombin aptamer before (Figure 7A) and after (Figure 7B) extraction from a larger structure. The red circle shows the tetraloop within the larger structure.

[0098] Figures 8A - 8B include representative images of the double helix after alignment to form a crossover (Figure 8A; the top helix is helix 1 and the bottom helix is helix 2). The phosphate atoms and the backbone and the side (sugar / base) at the crossover location are identified in red and yellow, respectively. Figure 8B includes a representative side view of the RNA structure with all motifs aligned to the helix. The top left motif is the RNA thrombin aptamer.

[0099] Figure 9 is a 3D depiction of the junction structure of a 2 - helix RNA origami molecule that includes an RNA aptamer.

[0100] Figure 10 is a representative figure of an RNA origami molecule (top) transcribed from a 2D model to a text file (bottom).

[0101] Figures 11A to 11B includes a representative description of the RNA origami sequence. Figure 11A includes a representative depiction of the text file after running it through a tracing script; the red box highlights the output code that can be submitted to NUPACK which subsequently provides the RNA sequence. Figure 11B includes a representative description of the RNA sequence output by NUPACK; the NED is also provided (generally, the sequence with the lowest NED is selected for analysis).

[0102] Figures 12A - 12B includes a 3D illustration ( Figure 12A ) and a representative depiction of a 2D ribbon model ( Figure 12B ) of a 2 - helix RNA origami (2HO - RNA - NNNN) that does not have an RNA aptamer. The numbers represent four possible positions of the RNA aptamer on the RNA origami molecule. The tetraloop is indicated by a yellow box and the kissing loop is indicated by a green box.

[0103] Figures 13A - 13D include representative 2D models of four designs of RNA origami that include two aptamers. Figure 13A depicts 2HO - RNA - NNNN (SEQ ID NO: 1); Figure 13B depicts 2HO - RNA - 12NN (SEQ ID NO: 2); Figure 13C depicts 2HO - RNA - 1N2N (SEQ ID NO: 3), and Figure 13D depicts 2HO - RNA - 2NN1 (SEQ ID NO: 4).

[0104] Figures 14A - 14C include a representative 2D model of 2HO - RNA - NNNN (A) and computational simulations of the RNA fold analyzed by (B) mfold and (C) NUPACK. The tetraloop and the kissing loop are indicated by a yellow box and a green box, respectively.

[0105] Figures 15A to 15C include representative 2D models of 2HO-RNA-12NN (A) and computational simulations of RNA folding analyzed by (B) mfold and (C) NUPACK. The tetraloop and kissing loop are indicated by yellow and green boxes, respectively. The external site 1 and 2 binding RNA aptamers are represented by purple and blue rectangles, respectively.

[0106] Figures 16A to 16C include representative 2D models of 2HO-RNA-1N2N (A) and computational simulations of RNA folding analyzed by (B) mfold and (C) NUPACK. The tetraloop and kissing loop are indicated by yellow and green boxes, respectively. The external site 1 and 2 binding RNA aptamers are represented by purple and blue rectangles, respectively.

[0107] Figures 17A to 17C include representative 2D models of 2HO-RNA-2NN1 (A) and computational simulations of RNA folding analyzed by (B) mfold and (C) NUPACK. The tetraloop and kissing loop are indicated by yellow and green boxes, respectively. The external site 1 and 2 binding RNA aptamers are represented by purple and blue rectangles, respectively.

[0108] Figure 18 Include representative images characterizing DNA template amplification using a 1% agarose gel run at 150 V for 30 minutes. 1 kb ladder (lanes 1 and 5), 2H-DNA-NNNN (lane 2), 2H-DNA-12NN (lane 3), 2H-DNA-1N2N (lane 4), and 2H-DNA-2NN1 (lane 6).

[0109] Figure 19 Include representative images of the differences between transcription with and without fresh DTT. Native T7 RNA polymerase from New England Biolabs was used for transcription of unmodified RNA structures.

[0110] Figure 20 Include representative images of RNA origami run on a 6% denaturing acrylamide gel run at 20 W for 1 hour. 1 kb ladder (lane 1), 2HO-RNA-NNNN (lane 2), 2HF-RNA-NNNN (lane 3), 2HO-RNA-2NN1 (lane 4), 2HF-RNA-2NN1 (lane 5), 2HO-RNA-1N2N (lane 6), and 2HF-RNA-1N2N (lane 7).

[0111] Figure 21Representative images of RNA origamis run on a 6% denaturing acrylamide gel run for 1 hour at 20 W. 1 kb ladder (lane 1); 2HO-RNA-1N2N, 279 nucleotides (lane 2); 2HO-RNA-NNNN, 210 nucleotides (lane 3); 1 kb ladder (lane 4); 2HF-RNA-2NN1, 285 nucleotides (lane 5); 2HF-RNA-1N2N, 279 nucleotides (lane 6); 2HF-RNA-12NN, 279 nucleotides (lane 7); and 2HF-RNA-NNNN, 210 nucleotides (lane 8).

[0112] Figure 22 Representative images of RNA origamis run on a 6% native acrylamide gel run for 3 hours at 150 V. DNA marker, GeneRuler Ultra Low Range DNA Ladder (left lane) and 2HO-RNA-2NN1 (right lane).

[0113] Figure 23 Representative results of an anticoagulation assay comparing the mean clotting times of 2'-fluoro-modified free aptamers, unmodified RNA origamis (2HO-RNA), 2'-fluoro-modified RNA origamis (2HF-RNA), and DNA weave tiles (2HT-DNA) using aPTT. Error bars are standard deviation (N = 3).

[0114] Figure 24 Representative images of acrylamide gel electrophoresis results of the RNA origami-thrombin complex. Nucleic acid stained gel (left) and protein stained gel (right).

[0115] Figure 25 Representative images of acrylamide gel electrophoresis results of a specificity assay of the thrombin aptamer included in the RNA origami with four different proteins by gel electrophoresis mobility shift assay. Lane 1: DNA marker; Lane 2: 2HF-RNA-NNNN; Lanes 3 to 6: 2HF-RNA-NNNN incubated with thrombin, factor IXa, factor Xa, and BSA, respectively. The left gel is a nucleic acid stained gel, and the right gel is a protein stained gel.

[0116] Figure 26Representative images of acrylamide gel electrophoresis results of specific assays of thrombin aptamer included in RNA origami with four different proteins. Lane 1: DNA marker; Lane 2: 2HF-RNA-12NN; Lanes 3 to 6: 2HF-RNA-12NN incubated with thrombin, factor IXa, factor Xa, and BSA, respectively. The left gel is a gel stained with nucleic acid, and the right gel is a gel stained with protein.

[0117] Figure 27 Representative images of acrylamide gel electrophoresis results of specific assays of thrombin aptamer included in RNA origami with four different proteins. Lane 1: DNA marker; Lane 2: 2HF-RNA-1N2N; Lanes 3 to 6: 2HF-RNA-1N2N incubated with thrombin, factor IXa, factor Xa, and BSA, respectively. The left gel is a gel stained with nucleic acid, and the right gel is a gel stained with protein.

[0118] Figure 28 Representative images of acrylamide gel electrophoresis results of specific assays of thrombin aptamer included in RNA origami with four different proteins. Lane 1: DNA marker; Lane 2: 2HF-RNA-2NN1; Lanes 3 to 6: 2HF-RNA-2NN1 incubated with thrombin, factor IXa, factor Xa, and BSA, respectively. The left gel is a gel stained with nucleic acid, and the right gel is a protein-stained gel.

[0119] Figure 29 Representative results of the binding assay of thrombin DNA aptamer included in DNA woven sheets with thrombin. The left gel is a gel stained with nucleic acid, and the right gel is a gel stained with protein.

[0120] Figures 30A to 30B include representative results of stability assays of modified (A) and unmodified (B) RNA origami treated with 10 μg / ml ribonuclease A (RNase A). Samples were characterized by denaturing gel electrophoresis.

[0121] Figures 31A to 31B include representative results of stability assays of modified (A) and unmodified RNA origami (B) treated with high-concentration ribonuclease A (500 μg / ml). Samples were characterized by denaturing gel electrophoresis.

[0122] Figures 32A to 32B include representative results of stability tests of modified RNA origami (2HF-RNA-2NN1) stored in human plasma for 10 minutes to 24 hours. The modified RNA origami (A) was stored with human plasma at 37 °C for 4 hours. The 2HF-RNA-2NN1 origami (B) was stored in human plasma for 10 minutes to up to 24 hours. The control was 2HF-RNA-2NN1 stored in 1x buffer at 37 °C for 24 hours.

[0123] Figure 33 Include representative results of stability tests of unmodified RNA origami (2HO-RNA-2NN1) stored in human plasma at 37 °C for 10 minutes to 24 hours.

[0124] Figure 34 Include representative results of stability tests of DNA woven sheets (2HT-DNA-PNNB) stored in human plasma at 37 °C for 10 minutes to 24 hours.

[0125] Figures 35A to 35C include representative 2D models of four designs of RNA origami that includes two aptamers (Fss12; A) on a 31-nucleotide single-stranded RNA linker. Computational analysis of RNA origami folding analyzed by mfold RNA and NUPACK software (B to C). Purple and blue rectangles represent the exosite 1 and exosite 2 binding aptamers, respectively.

[0126] Figures 36A to 36C include representative 2D models of four designs of RNA origami that includes four aptamers (2H-RNA-2211; A). Computational analysis of RNA origami folding analyzed by mfold RNA and NUPACK software (B to C). Purple and blue rectangles represent the exosite 1 and exosite 2 binding aptamers, respectively, and the green rectangle indicates the kissing loop motif.

[0127] Figures 37A to 37C include representative 2D models of four designs of RNA origami that includes two aptamers and three A-type double helical structures (3H-RNA-2NN1; A). Computational analysis of RNA origami folding analyzed by mfold RNA and NUPACK software (B to C). Purple and blue rectangles represent the exosite 1 and exosite 2 binding aptamers, respectively, and the yellow and green rectangles indicate the tetraloop and kissing loop motifs, respectively.

[0128] Figures 38A to 38C include representative 2D models of four designs of RNA origami that includes two aptamers and four A-form double helical structures (4H-RNA-2NN1; A). Computational analysis of the folding of the RNA origami analyzed by mfold RNA and NUPACK software (B to C). Purple and blue rectangles represent the exosite 1 and exosite 2 binding aptamers, respectively, and yellow and green rectangles indicate the tetraloop and kissing loop motifs, respectively.

[0129] Figure 39 Include representative images characterizing DNA template amplification. Lanes 1 and 8: DNA marker; Lane 2: Fss12; Lane 3: 2H-DNA-NNNN. Lane 4: 2H-DNA-2NN1; Lane 5: 2H-DNA-2211; Lane 6: 3H-DNA-2NN1; and Lane 7: 4H-DNA-2NN1.

[0130] Figure 40 Include representative images characterizing the RNA origami by denaturing acrylamide gel electrophoresis. Lanes 1 and 8: ssRNA marker; Lane 2: 31-nucleotide-linked aptamer (Fss12); Lane 3: 2HF-RNA-NNNN; Lane 4: 2HF-RNA-2NN1; Lane 5: 2HF-RNA-2211; Lane 6: 3HF-RNA-2NN1; Lane 7: 4HF-RNA-2NN1.

[0131] Figures 41A to 41D include representative images characterizing the RNA origami with an aptamer that binds thrombin by 6% native acrylamide gel electrophoresis. The RNA origami was incubated with thrombin at 37 °C for 1 hour before characterization (A). The gels in (A) and (B) are the same gel and were run at 150 V for 3 hours. The gels in (C) and (D) are the same gel and were run at 150 V for 6 hours. Gels stained with nucleic acid, ethidium bromide (A and C). Gels stained with protein, Coomassie blue (B and D). Negative and positive values indicate the absence and presence of thrombin, respectively.

[0132] Figures 42A to 42B include representative images of a specific binding assay of two 31-nucleotide-linked aptamers (Fss12) with four different proteins by native acrylamide gel electrophoresis. Lane 1: Fss12. Lane 2: Fss12 incubated with thrombin. Lane 3: Fss12 incubated with factor IXa. Lane 4: Fss12 incubated with factor Xa; and Lane 5: Fss12 incubated with BSA. The 6% native PAGE gel was run at 150 for 3 hours. Gels stained with nucleic acid, ethidium bromide (A). Gels stained with protein, Coomassie blue (B). (A) and (B) are the same gel.

[0133] Figures 43A to 43B include representative images of the specific binding assay of 2HF-RNA-2211 with four different proteins by native acrylamide gel electrophoresis. Lane 1: 2HF-RNA-2211. Lane 2: 2HF-RNA-2211 incubated with thrombin. Lane 3: 2HF-RNA-2NN1 incubated with factor IXa. Lane 4: 2HF-RNA-2211 incubated with factor Xa; and Lane 5: 2HF-RNA-2211 incubated with BSA. A 6% native PAGE gel was run at 150 for 3 hours. Gel stained for nucleic acids, ethidium bromide (A). Gel stained for proteins, Coomassie blue (B). (A) and (B) are the same gel.

[0134] Figures 44A to 44B include representative images of the specific binding assay of 3HF-RNA-2NN1 with four different proteins by native acrylamide gel electrophoresis. Lane 1: 3HF-RNA-2NN1. Lane 2: 3HF-2NN1 incubated with thrombin. Lane 3: 3HF-RNA-2NN1 incubated with factor IXa. Lane 4: 3HF-RNA-2NN1 incubated with factor Xa; and Lane 5: 3HF-RNA-2NN1 incubated with BSA. A 6% native PAGE gel was run at 150 for 6 hours. Gel stained for nucleic acids, ethidium bromide (A). Gel stained for proteins, Coomassie blue (B). (A) and (B) are the same gel.

[0135] Figures 45A to 45B include representative images of the specific binding assay of 4HF-RNA-2NN1 with four different proteins by native acrylamide gel electrophoresis. Lane 1: 2HF-RNA-4NN1. Lane 2: 4HF-RNA-2NN1 incubated with thrombin. Lane 3: 4HF-RNA-2NN1 incubated with factor IXa. Lane 4: 2HF-RNA-4NN1 incubated with factor Xa; and Lane 5: 4HF-RNA-2NN1 incubated with BSA. A 6% native PAGE gel was run at 150 for 6 hours. Gel stained for nucleic acids, ethidium bromide (A). Gel stained for proteins, Coomassie blue (B). (A) and (B) are the same gel.

[0136] Figure 46 Include representative results of tests on the long-term storage of RNA origami. The average anticoagulant activity of freshly prepared 2HF-RNA-2NN1 samples was compared with samples stored at 4°C for up to 90 days. The results showed that after storage at 4°C, the RNA origami anticoagulant was stable for at least 3 months and was active.

[0137] Figure 47 Including representative results of testing the anticoagulant activities of free aptamers, ssRNA-linked aptamers, and RNA origamis including aptamers by aPTT assay. The final concentration of all designed anticoagulants was 500 nM except for 2HF-RNA-2211. The final concentration of 2HF-RNA-2211 was 400 nM. The results showed that the anticoagulant activities of two aptamers (Fss12) linked to ssRNA were higher than those of free aptamers and the mixture of free aptamers. Additionally, the anticoagulant activities of two aptamers included on the RNA origami (2HF-RNA-2NN1) were greater than those of the ssRNA-linked aptamer (Fss12). Further, the RNA origami (2HF-RNA-2211) including four aptamers exhibited the highest anticoagulant activity (more than twice the activity of 2HF-RNA-2NN1).

[0138] Figure 48 Including representative results of testing the concentration-dependent clotting times of the RNA origami (2HF-RNA-2NN1) including two RNA aptamers and the RNA origami (2HF-RNA-2211) including four RNA aptamers. For 2HF-RNA-2211 with a concentration of 400 nM, the clotting time reached the maximum limit (999 seconds measured using a blood coagulometer). Surprisingly, the anticoagulant activity of 2HF-RNA-2211 (4 aptamers) was more than twice the anticoagulant activity of 2HF-RNA-2NN1 (2 aptamers).

[0139] Figure 49 Including representative results of testing the anticoagulant activities of RNA origamis including two RNA aptamers (2NN1) and 2 (2HF), 3 (3HF), or 4 (4HF) helical structures. The results indicated that the 2HF, 3HF, and 4HF RNA origamis including two RNA aptamers all exhibited anticoagulant activities.

[0140] Figures 50A to 50B include representative results of the reversal of thrombin inhibition. The clotting time (A) and anticoagulant activity (B) are shown.

[0141] Figure 51 Including representative results of testing the reversal of thrombin activity by adding DNA or PNA antidotes. The anticoagulant activity of the 2HF-2NN1 origami anticoagulant was used as a control sample. The DNA or PNA antidote (9 equivalents) was incubated with the RNA origami. The inhibitory activity of the PNA antidote was higher than that of the DNA antidote. Detailed Description

[0142] Embodiments of the present disclosure provide nucleic acid-based anticoagulants that combine an RNA aptamer with an RNA origami structure that is produced as a 2'-fluorinated transcript. The novel anticoagulants disclosed herein have demonstrated activities many times higher than those of free aptamers. The single-molecule construct is advantageous as a surgical anticoagulant and has a high enough molecular weight to greatly reduce rapid renal clearance. Compared with currently used small-molecule blood thinners, the nucleic acid anticoagulants disclosed herein will have fewer serious side effects. Additionally, embodiments of the present disclosure include nucleic acid antidotes made of complementary DNA that counteract anticoagulant activity.

[0143] Nucleic acid therapeutics represent an alternative solution to current pharmaceutical anticoagulants ( Figure 2A to 2E and Figure 3 ). DNA and RNA aptamers can adopt structures that bind to specific target molecules and have been developed to bind to thrombin and interrupt the coagulation cascade. Their advantages include greater biocompatibility that minimizes side effects, a larger therapeutic window, and the availability of antidotes. The antidotes contain natural nucleic acids (DNA / RNA) or unnatural nucleic acids (such as PNA) that are complementary to the aptamer and can unfold the aptamer. This presents an advantage for clinical applications that require rapid and robust anticoagulation. However, these aptamers exhibit poor pharmacokinetics due to their small size (less than 30 kDa); they are rapidly cleared by the kidneys after circulation and thus require more concentrated doses to be effective.

[0144] Embodiments of the present disclosure include novel functional RNA origamis that can bind to thrombin and prevent coagulation ( Figure 4 ). In one embodiment, two aptamers are placed on the RNA origami to increase the binding affinity and reduce the required dose by increasing the local concentration of the RNA aptamer. The biocompatible nature of RNA and the availability of antidotes can similarly allow for precise therapy while minimizing negative side effects. Due to their higher molecular weight (e.g., over 80 kDa), RNA origamis have a longer circulation in the human body than free aptamers. The RNA origami anticoagulant compositions and systems of the present disclosure provide a viable alternative to current clinical anticoagulants by providing a more controllable solution with fewer side effects.

[0145] The section headings used in this chapter and the entire disclosure herein are for organizational purposes only and are not intended to be limiting.

[0146] 1. Definitions

[0147] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document (including definitions) shall prevail. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, the preferred methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and are not intended to be limiting.

[0148] As used herein, the terms "comprising," "including," "having," "may," "containing," and variations thereof are intended to be open transitional phrases, terms, or words that do not exclude additional acts or structural possibilities. Unless the context clearly indicates otherwise, the singular forms "a," "an," and "the" include plural references. Whether explicitly stated or not, the present disclosure also contemplates other embodiments that "comprise" the embodiments or elements presented herein, "consist of," and "consist essentially of."

[0149] For the purposes of expressing numerical ranges herein, every intermediate value having the same precision between the recited numerical range is explicitly contemplated. For example, for a range of 6 to 9, in addition to 6 and 9, the numerical values 7 and 8 are also contemplated, and for the range 6.0 to 7.0, the numerical values 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.

[0150] For the purposes of expressing numerical ranges herein, every intermediate value having the same precision between the recited numerical range is explicitly contemplated. For example, for a range of 6 to 9, in addition to 6 and 9, the numerical values 7 and 8 are also contemplated, and for the range 6.0 to 7.0, the numerical values 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.

[0151] As used herein, "correlated to" means compared to.

[0152] The term "aptamer" generally refers to an oligonucleotide of a single defined sequence or a mixture of such oligonucleotides, wherein the mixture retains the property of specifically binding to a target molecule. Thus, as used herein, "aptamer" refers to both a singular sequence and a plural sequence of oligonucleotides. The term "aptamer" generally refers to a single-stranded or double-stranded nucleic acid that is capable of binding to a protein or other molecule and thereby interfering with the function of the protein or other molecule.

[0153] The term "single-stranded" oligonucleotide generally refers to an oligonucleotide containing a series of nucleotide residues covalently linked in a single chain.

[0154] The terms "oligomer" or "oligonucleotide" include RNA or DNA sequences of more than one nucleotide in single-stranded or duplex form, and specifically include short sequences (such as dimers and trimers) in single-stranded or duplex form, which may be intermediates in the production of specific binding oligonucleotides. The "modified" forms used in the candidate pools contain at least one unnatural residue. "Oligonucleotide" or "oligomer" generally refers to: polydeoxyribonucleotides (containing 2'-deoxy-D-ribose or a modified form thereof), such as DNA; polyribonucleotides (containing D-ribose or a modified form thereof), such as RNA; and any other type of polynucleotide that is an N-glycoside or C-glycoside of a purine or pyrimidine base, or a modified purine or pyrimidine base or abasic nucleotide. "Oligonucleotide" or "oligomer" can also be used to describe synthetic polymers similar to RNA and DNA, including but not limited to oligomers of peptide nucleic acid (PNA).

[0155] An "RNA aptamer" is an aptamer that contains ribonucleotide units. "RNA aptamer" also means to encompass RNA analogs as disclosed herein.

[0156] The term "coagulation factor" generally refers to a factor that functions in either or both of the intrinsic and extrinsic coagulation cascades.

[0157] The terms "RNA analog" or "RNA derivative" or "modified RNA" generally refer to a polymeric molecule that, in addition to containing ribonucleotides as its units, contains at least one of the following: 2'-deoxy; 2'-halo (including 2'-fluoro); 2'-amino (preferably unsubstituted or mono- or di-substituted); 2'-mono-, di- or tri-halomethyl; 2'-O-alkyl; 2'-O-halo-substituted alkyl; 2'-alkyl; azido; thiophosphate; mercapto; methylphosphonate; fluorescein; rhodamine; naphthalimide; biotin; xanthine; hypoxanthine; 2,6-diaminopurine; 2-hydroxy-6-mercaptopurine and pyrimidine bases substituted at the 6-position or halogenated at the 5-position or substituted with a C 1-5 alkyl group; basic linker; 3'-deoxyadenosine and other available "chain terminators" or "non-extendable" analogs (at the 3'-end of RNA); or a label (such as 32 P, 33 P, etc.). All of the foregoing can be incorporated into RNA using standard synthetic techniques disclosed herein.

[0158] The terms "binding activity" and "binding affinity" generally refer to the tendency of a ligand molecule to bind or not bind to a target. The energetics of these interactions are important in terms of "binding activity" and "binding affinity" as they can include the definition of the concentrations of the interacting partners, the rate at which these partners can associate, and the relative concentrations of the bound and free molecules in solution.

[0159] "Sequence identity" refers to two polymer sequences (e.g., peptides, polypeptides, nucleic acids, etc.) having the same ordered combination of monomeric subunits. The term "sequence similarity" refers to the degree to which two polymer sequences (e.g., peptides, polypeptides, nucleic acids, etc.) have similar polymer sequences. For example, similar amino acids are those that share the same biophysical characteristics and can be grouped into families such as: acidic (e.g., aspartic acid, glutamic acid), basic (e.g., lysine, arginine, histidine), nonpolar (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), and uncharged polar (e.g., glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine). "Percent sequence identity" (or "percent sequence similarity") is calculated by: (1) comparing two optimally aligned sequences over a comparison window (e.g., the length of the longer sequence, the length of the shorter sequence, a specified window); (2) determining the number of positions that contain the same (or similar) monomers (e.g., the same amino acid appears in both sequences, similar amino acids appear in both sequences) to obtain the number of matching positions; (3) dividing the number of matching positions by the total number of positions in the comparison window (e.g., the length of the longer sequence, the length of the shorter sequence, a specified window); and (4) multiplying the result by 100 to obtain the percent sequence identity or percent sequence similarity. For example, if Peptide A and Peptide B are both 20 amino acids in length and the amino acids are the same at all positions except position 1, then Peptide A and Peptide B have 95% sequence identity. If the amino acids at different positions share the same biophysical characteristics (e.g., both are acidic), then Peptide A and Peptide B will have 100% sequence similarity. As another example, if Peptide C is 20 amino acids in length and Peptide D is 15 amino acids in length, and 14 of the 15 amino acids of Peptide D are the same as those in a portion of Peptide C, then Peptide C and D have 70% sequence identity, but Peptide D has 93.3% sequence identity with the optimal comparison window of Peptide C. For the purposes of calculating "percent sequence identity" (or "percent sequence similarity") herein, any gaps in the aligned sequences are considered to be mismatches at that position.

[0160] Embodiments of the present disclosure provide single-stranded nucleic acid molecules that have an A-form double helix structure and at least one crossover region, at least one kissing loop region, and at least one nucleic acid aptamer having anticoagulant activity. According to these embodiments, the single-stranded nucleic acid molecule can be a DNA molecule or an RNA molecule, or any derivative or combination thereof.

[0161] In some embodiments, the single-stranded nucleic acid molecule can be an RNA molecule that includes at least one nucleoside having a 2'-modification. In some embodiments, the single-stranded RNA origami molecule of the present disclosure can include at least one 2'-fluoro-dCTP or 2'-fluoro-dUTP or another nucleoside having a 2'-modification (such as 2'-amino or 2'-O-methyl) or a chemical modification of the backbone phosphate group (such as phosphorothioate).

[0162] In some embodiments, the single-stranded nucleic acid molecule includes at least one tetraloop region that contains a tetranucleotide motif. In some embodiments, the single-stranded nucleic acid molecule includes one to three tetraloop regions, each of which contains a tetranucleotide motif. In some embodiments, the single-stranded nucleic acid molecule includes one to four aptamers having anticoagulant activity. According to these embodiments, each of the one to four aptamers replaces one of the at least one tetraloop regions. In some embodiments, the single-stranded nucleic acid molecule does not include a tetraloop region.

[0163] In some embodiments, the single-stranded nucleic acid molecule includes at least one kissing loop region that is a 180° kissing loop region. In some embodiments, the single-stranded nucleic acid molecule includes one 180° kissing loop region. In some embodiments, the single-stranded nucleic acid molecule does not include a kissing loop region.

[0164] In some embodiments, the single-stranded nucleic acid molecule includes a single-stranded RNA linker region. In some embodiments, the nucleic acid aptamer can be linked to one or both ends of the single-stranded RNA linker region. In some embodiments, the single-stranded nucleic acid molecule does not include a kissing loop region or a tetraloop region.

[0165] In some embodiments, the single-stranded nucleic acid molecule comprises at least one helical structure (e.g., an A-form double helix structure). In some embodiments, the single-stranded nucleic acid molecule comprises at least two helical structures. In some embodiments, the single-stranded nucleic acid molecule comprises at least three helical structures. In some embodiments, the single-stranded nucleic acid molecule comprises at least four helical structures. In some embodiments, the single-stranded nucleic acid molecule comprises five or more helical structures. In some embodiments, the single-stranded nucleic acid molecule comprises at least one helical structure separating two or more nucleic acid aptamers. In some embodiments, at least one helical structure separating two or more nucleic acid aptamers comprises at least one nucleic acid aptamer. In some embodiments, at least one helical structure separating two or more nucleic acid aptamers does not comprise a nucleic acid aptamer.

[0166] In some embodiments, the nucleic acid molecule is an RNA molecule having at least 80% sequence identity with SEQ ID NO: 1. In some embodiments, the nucleic acid molecule is an RNA molecule having at least 85% sequence identity with SEQ ID NO: 1. In some embodiments, the nucleic acid molecule is an RNA molecule having at least 90% sequence identity with SEQ ID NO: 1. In some embodiments, the nucleic acid molecule is an RNA molecule having at least 95% sequence identity with SEQ ID NO: 1. In some embodiments, the nucleic acid molecule is an RNA molecule having at least 96% sequence identity with SEQ ID NO: 1. In some embodiments, the nucleic acid molecule is an RNA molecule having at least 97% sequence identity with SEQ ID NO: 1. In some embodiments, the nucleic acid molecule is an RNA molecule having at least 98% sequence identity with SEQ ID NO: 1. In some embodiments, the nucleic acid molecule is an RNA molecule having at least 99% sequence identity with SEQ ID NO: 1.

[0167] In some embodiments, the anticoagulant activity of the at least one nucleic acid aptamer includes inhibition of one or more of factor XIIa, factor XIIIa, factor XIa, factor IXa, factor Xa, and von Willebrand factor. In some embodiments, the nucleic acid aptamers that can be included in the RNA origami molecules disclosed herein include any aptamers involved in regulating blood coagulation, including but not limited to: ARC183 / HD1 (targeting FIIa); HD22 (targeting FIIa); HD1-22 (targeting FIIa); Tog25 (targeting FII); R9d14t (targeting FII / FIIa); 11F7t (targeting FXa); 16.3 (targeting FVIIa); 7S-1 / 7S-2 (targeting FVII); 9.3t (targeting FIXa); R4cXII-1 (targeting FXII / FXIIa); NU172 (targeting thrombin); REG1 (targeting FIX / FIXa); REG2 (targeting FIX / FIXa); ARC1779 (targeting von Willebrand factor); and ARC19499 (targeting TFPI).

[0168] In some embodiments, the anticoagulant activity of the at least one nucleic acid aptamer comprises thrombin inhibition. In some embodiments, the at least one nucleic acid aptamer comprises an antithrombin RNA R9D-14T aptamer or a derivative thereof. In some embodiments, the at least one nucleic acid aptamer comprises an antithrombin Toggle-25t RNA aptamer or a derivative thereof. In some embodiments, the nucleic acid aptamer capable of binding to the exosite 1 of thrombin is an RNA R9D-14T aptamer or a derivative thereof. In some embodiments, the nucleic acid aptamer capable of binding to the exosite 2 of thrombin is a Toggle-25t RNA aptamer or a derivative thereof.

[0169] In some embodiments, the nucleic acid molecule is an RNA molecule comprising from about 100 to about 1000 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising from about 100 to about 900 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising from about 100 to about 800 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising from about 100 to about 700 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising from about 100 to about 600 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising from about 100 to about 500 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising from about 100 to about 400 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising from about 100 to about 300 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising from about 150 to about 600 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising from about 150 to about 500 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising from about 150 to about 400 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising from about 150 to about 300 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising from about 200 to about 600 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising from about 225 to about 600 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising from about 250 to about 600 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising from about 200 to about 500 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising from about 200 to about 450 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising from about 200 to about 400 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising from about 200 to about 350 nucleotides.

[0170] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule comprising an aptamer capable of binding to exosite 1 of thrombin and an aptamer capable of binding to exosite 2 of thrombin, wherein the aptamer capable of binding to exosite 1 of thrombin replaces the tetraloop region 1 of the RNA molecule, and the aptamer capable of binding to exosite 2 of thrombin replaces the tetraloop region 2 of the RNA molecule (2HO-RNA-12NN or 2HF-RNA-12NN). In some embodiments, the RNA molecule has 80% sequence identity with SEQ ID NO: 2. In some embodiments, the RNA molecule has at least 85% sequence identity with SEQ ID NO: 2. In some embodiments, the RNA molecule has at least 90% sequence identity with SEQ ID NO: 2. In some embodiments, the RNA molecule has at least 95% sequence identity with SEQ ID NO: 2. In some embodiments, the RNA molecule has at least 96% sequence identity with SEQ ID NO: 2. In some embodiments, the RNA molecule has at least 97% sequence identity with SEQ ID NO: 2. In some embodiments, the RNA molecule has at least 98% sequence identity with SEQ ID NO: 2. In some embodiments, the RNA molecule has at least 99% sequence identity with SEQ ID NO: 2.

[0171] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule comprising an aptamer capable of binding to exosite 1 of thrombin and an aptamer capable of binding to exosite 2 of thrombin, wherein the aptamer capable of binding to exosite 1 of thrombin replaces the tetraloop region 1 of the RNA molecule, and the aptamer capable of binding to exosite 2 of thrombin replaces the tetraloop region 3 of the RNA molecule (2HO-RNA-1N2N or 2HF-RNA-1N2N). In some embodiments, the RNA molecule has 80% sequence identity with SEQ ID NO: 3. In some embodiments, the RNA molecule has at least 85% sequence identity with SEQ ID NO: 3. In some embodiments, the RNA molecule has at least 90% sequence identity with SEQ ID NO: 3. In some embodiments, the RNA molecule has at least 95% sequence identity with SEQ ID NO: 3. In some embodiments, the RNA molecule has at least 96% sequence identity with SEQ ID NO: 3. In some embodiments, the RNA molecule has at least 97% sequence identity with SEQ ID NO: 3. In some embodiments, the RNA molecule has at least 98% sequence identity with SEQ ID NO: 3. In some embodiments, the RNA molecule has at least 99% sequence identity with SEQ ID NO: 3.

[0172] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule comprising an aptamer capable of binding to exosite 2 of thrombin and an aptamer capable of binding to exosite 1 of thrombin, wherein the aptamer capable of binding to exosite 2 of thrombin replaces the tetraloop region 1 of the RNA molecule, and the aptamer capable of binding to exosite 1 of thrombin replaces the tetraloop region 4 of the RNA molecule (2HO-RNA-2NN1 or 2HF-RNA-2NN1). In some embodiments, the RNA molecule has 80% sequence identity with SEQ ID NO: 4. In some embodiments, the RNA molecule has at least 85% sequence identity with SEQ ID NO: 4. In some embodiments, the RNA molecule has at least 90% sequence identity with SEQ ID NO: 4. In some embodiments, the RNA molecule has at least 95% sequence identity with SEQ ID NO: 4. In some embodiments, the RNA molecule has at least 96% sequence identity with SEQ ID NO: 4. In some embodiments, the RNA molecule has at least 97% sequence identity with SEQ ID NO: 4. In some embodiments, the RNA molecule has at least 98% sequence identity with SEQ ID NO: 4. In some embodiments, the RNA molecule has at least 99% sequence identity with SEQ ID NO: 4.

[0173] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule (Fss12) comprising an aptamer capable of binding to exosite 2 of thrombin linked to one end of a single-stranded RNA linker and an aptamer capable of binding to exosite 1 of thrombin linked to the other end of the single-stranded RNA linker. In some embodiments, the RNA molecule has 80% sequence identity with SEQ ID NO: 5. In some embodiments, the RNA molecule has at least 85% sequence identity with SEQ ID NO: 5. In some embodiments, the RNA molecule has at least 90% sequence identity with SEQ ID NO: 5. In some embodiments, the RNA molecule has at least 95% sequence identity with SEQ ID NO: 5. In some embodiments, the RNA molecule has at least 96% sequence identity with SEQ ID NO: 5. In some embodiments, the RNA molecule has at least 97% sequence identity with SEQ ID NO: 5. In some embodiments, the RNA molecule has at least 98% sequence identity with SEQ ID NO: 5. In some embodiments, the RNA molecule has at least 99% sequence identity with SEQ ID NO: 5.

[0174] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule comprising two nucleic acid aptamers capable of binding to exosite 2 of thrombin and two nucleic acid aptamers capable of binding to exosite 1 of thrombin, wherein the two nucleic acid aptamers capable of binding to exosite 2 of thrombin each replace the tetraloop regions 1 and 2 of the RNA molecule, respectively, and the two nucleic acid aptamers capable of binding to exosite 1 of thrombin each replace the tetraloop regions 3 and 4 of the RNA molecule (2H-2211). In some embodiments, the RNA molecule has 80% sequence identity with SEQ ID NO: 6. In some embodiments, the RNA molecule has at least 85% sequence identity with SEQ ID NO: 6. In some embodiments, the RNA molecule has at least 90% sequence identity with SEQ ID NO: 6. In some embodiments, the RNA molecule has at least 95% sequence identity with SEQ ID NO: 6. In some embodiments, the RNA molecule has at least 96% sequence identity with SEQ ID NO: 6. In some embodiments, the RNA molecule has at least 97% sequence identity with SEQ ID NO: 6. In some embodiments, the RNA molecule has at least 98% sequence identity with SEQ ID NO: 6. In some embodiments, the RNA molecule has at least 99% sequence identity with SEQ ID NO: 6.

[0175] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule comprising an aptamer capable of binding to exosite 2 of thrombin, an aptamer capable of binding to exosite 1 of thrombin, and an A-type double helix structure, wherein the aptamer capable of binding to exosite 2 of thrombin replaces the tetraloop region 1 of the RNA molecule, the aptamer capable of binding to exosite 1 of thrombin replaces the tetraloop region 4 of the RNA molecule, and the A-type double helix structure separates the aptamer capable of binding to exosite 2 of thrombin from the aptamer capable of binding to exosite 1 of thrombin (3H-2NN1). In some embodiments, the RNA molecule has 80% sequence identity with SEQ ID NO: 7. In some embodiments, the RNA molecule has at least 85% sequence identity with SEQ ID NO: 7. In some embodiments, the RNA molecule has at least 90% sequence identity with SEQ ID NO: 7. In some embodiments, the RNA molecule has at least 95% sequence identity with SEQ ID NO: 7. In some embodiments, the RNA molecule has at least 96% sequence identity with SEQ ID NO: 7. In some embodiments, the RNA molecule has at least 97% sequence identity with SEQ ID NO: 7. In some embodiments, the RNA molecule has at least 98% sequence identity with SEQ ID NO: 7. In some embodiments, the RNA molecule has at least 99% sequence identity with SEQ ID NO: 7.

[0176] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule comprising a nucleic acid aptamer capable of binding to exosite 2 of thrombin, a nucleic acid aptamer capable of binding to exosite 1 of thrombin, and two A-form double helical structures, wherein the nucleic acid aptamer capable of binding to exosite 2 of thrombin replaces the tetraloop region 1 of the RNA molecule, the nucleic acid aptamer capable of binding to exosite 1 of thrombin replaces the tetraloop region 4 of the RNA molecule, and the two A-form double helical structures separate the nucleic acid aptamer capable of binding to exosite 2 of thrombin from the nucleic acid aptamer capable of binding to exosite 1 of thrombin (4H-2NN1). In some embodiments, the RNA molecule has 80% sequence identity with SEQ ID NO: 8. In some embodiments, the RNA molecule has at least 85% sequence identity with SEQ ID NO: 8. In some embodiments, the RNA molecule has at least 90% sequence identity with SEQ ID NO: 8. In some embodiments, the RNA molecule has at least 95% sequence identity with SEQ ID NO: 8. In some embodiments, the RNA molecule has at least 96% sequence identity with SEQ ID NO: 8. In some embodiments, the RNA molecule has at least 97% sequence identity with SEQ ID NO: 8. In some embodiments, the RNA molecule has at least 98% sequence identity with SEQ ID NO: 8. In some embodiments, the RNA molecule has at least 99% sequence identity with SEQ ID NO: 8.

[0177] Embodiments of the present disclosure also include DNA molecules encoding any one of the single-stranded nucleic acid molecules described herein. As will be recognized by those of ordinary skill in the art based on the present disclosure, the DNA molecules encoding any one of the single-stranded nucleic acid molecules described herein can be single-stranded or double-stranded and can serve as templates for generating any one of the single-stranded nucleic acid molecules described herein. The DNA template can be part of an expression plasmid or other construct for in vivo and / or in vitro biochemical reactions.

[0178] Embodiments of the present disclosure also include anticoagulant compositions. According to these embodiments, the composition comprises a single-stranded nucleic acid molecule and a pharmaceutically acceptable excipient, solvent, carrier, or diluent, the single-stranded nucleic acid molecule comprising an A-form double helical structure and at least one crossover region, at least one kissing loop region, and at least one nucleic acid aptamer having anticoagulant activity. In some embodiments, the single-stranded nucleic acid molecule further comprises at least one tetraloop region. As will be recognized by those of ordinary skill in the art based on the present disclosure, the composition can be administered to a subject or patient according to a treatment regimen to modulate blood coagulation and / or treat a disease condition in the context of a surgical procedure.

[0179] Embodiments of the present disclosure also include systems for modulating coagulation. According to these embodiments, the system includes any one of the single-stranded nucleic acid molecules described herein, and at least one single-stranded nucleic acid antidote capable of binding to at least a portion of any one of the single-stranded nucleic acid molecules described herein, the at least one single-stranded nucleic acid antidote counteracting the anticoagulant activity of these single-stranded nucleic acid molecules. As would be recognized by one of ordinary skill in the art based on the present disclosure, the system can be used to treat a subject or patient according to a treatment regimen to modulate blood coagulation and / or treat a disease condition in the context of a surgical procedure.

[0180] In some embodiments, the at least one nucleic acid antidote is a DNA molecule, an RNA molecule, an O-methyl RNA molecule, a fluorine-modified RNA molecule, a PNA molecule, an LNA molecule, or a combination or derivative thereof. In some embodiments, the at least one nucleic acid antidote binds to at least a portion of any one of the single-stranded nucleic acid molecules described herein in an antiparallel complementary manner. In some embodiments, the at least one nucleic acid antidote binds to at least one nucleic acid aptamer of any one of the single-stranded nucleic acid molecules described herein to counteract the anticoagulant activity.

[0181] Unless otherwise defined herein, scientific and technical terms used in conjunction with the present disclosure shall have the meanings commonly understood by one of ordinary skill in the art. For example, any terms and techniques used in conjunction with cell and tissue culture, molecular biology, immunology, microbiology, genetics, protein and nucleic acid chemistry, and hybridization described herein are those well known and commonly used in the art. The meaning and scope of the terms should be clear; however, if there is any potential ambiguity, the definitions provided herein shall prevail over any dictionary or extrinsic definition. Further, unless the context otherwise requires, singular terms shall include plural terms and plural terms shall include singular terms.

[0182] 2. Design and methods

[0183] Embodiments of the present disclosure include methods for designing and generating single-stranded nucleic acid molecules that contain nucleic acid aptamers having various therapeutic functions such as, but not limited to, anticoagulant activity. In some embodiments, the single-stranded nucleic acid molecules of the present disclosure include RNA molecules (RNA origami) that include nucleic acid aptamers having anticoagulant activity. According to these embodiments, the present disclosure provides general steps for designing RNA origami, which include: (i) creating a 3D model, (ii) converting to a 2D model, (iii) generating a text file design from the 2D model, and (iv) analyzing the RNA sequence.

[0184] In some embodiments of RNA origami design, the A-form of the RNA double helix (Figures 5A to 5B) is used. The geometry of the helix helps to determine where to place the double crossover. The design can use multiple motifs. For example, the use of kissing loop motifs can allow multi-helical structures to be distributed along a single-stranded path. In some embodiments, 180° kissing loops can be used. Additionally, tetraloop motifs can be used; tetraloops are small four-nucleotide motifs that cap the ends of the structure. The presence of tetraloops can serve to stabilize the overall structure of the RNA molecule.

[0185] According to the methods described herein, 3D models of RNA origami molecules can be created. For example, a 2-helix RNA origami structure can be created and include a thrombin RNA aptamer. Bioinformatics software can be used to generate files for each of the motifs, including but not limited to RNA double helices, tetraloops, 180° kissing loops, and RNA thrombin aptamers. Generally, the file corresponding to the A-form RNA double helix is generated first, as it is the basis for all other motifs. Next, the file corresponding to the 180° kissing loop (Figure 5B) is added, followed by the file corresponding to the tetraloop, which in some cases can be extracted from a larger file (Figures 6A to 6B). Finally, the files corresponding to the exosite 1 and exosite 2 RNA aptamers are added; again, in some cases, these files can be extracted from a larger source (Figures 7A to 7B).

[0186] Once all the motif files have been obtained, they can be assembled and aligned using a program such as Chimera (cgl.ucsf.edu / chimera). For example, two A-form RNA helices can be aligned, as shown in Figure 8A. Next, the nucleotides where the crossover will be located can be identified using alternative coloring pairs, which facilitates visualization of the location where the crossover is to be placed. After aligning the RNA helices, all the motifs including tetraloops, kissing loops, and RNA aptamers can be inserted into the alignment panel (Figure 8B). The next step involves converting the structure into a single-stranded structure, which can be done using various bioinformatics software (e.g., andersen-lab.dk), as Figure 9 shown.

[0187] The methods of the present disclosure also include converting the 3D model of the RNA origami molecule into a 2D model using the files and appropriate software programs described above (e.g., Assemble2 software), as Figure 10 shown. Then, the 2D model is transcribed into a text file or a similar format. To generate the nucleotide sequence of the single-stranded RNA origami molecule, appropriate software (e.g., NUPACK.org) is used, and then the 2D trial file is run through a trace script (e.g., Anderson-lab.dk). The output code of the trace script is shown inFigure 11A and the generated output RNA sequence is shown in Figure 11B .

[0188] The methods of the present disclosure also include analyzing RNA sequences generated by software (e.g., NUPACK). To experiment with the proper folding of RNA origami molecules, NUPACK and mfold are used. The sequences can be analyzed to select the best sequences that ensure proper sequence folding. For example, a sequence with proper folding is typically one with a low ΔG, a GC% of less than 65%, and a low normalized ensemble defect (NED). The fewer secondary structures a sequence has, the more likely it is to fold properly. To optimize the sequence, manual editing of the sequence can be performed, including but not limited to changing the positions of G-C base pairs to remove unwanted structures.

[0189] Embodiments of the present disclosure also include designs and methods for incorporating nucleic acid aptamers into single-stranded nucleic acid origami molecules. The nucleic acid aptamers that can be incorporated into the single-stranded RNA origami molecules of the present disclosure can be made of RNA, DNA, PNA, or any derivatives thereof. For example, as further described herein, the RNA origami molecule can include one or more nucleic acid aptamers, such as RNA aptamers that specifically bind to and modulate proteins involved in blood coagulation. In some embodiments, the RNA aptamer exhibits anticoagulant activity by inhibiting one or more coagulation proteins, including but not limited to one or more of thrombin, factor XIIa, factor XIIIa, factor XIa, factor IXa, factor Xa, and von Willebrand factor. In some embodiments, the RNA aptamer exhibits antithrombin activity that prevents blood coagulation and prevents symptoms such as thrombosis. In some embodiments, the antithrombin RNA aptamer incorporated into the single-stranded RNA origami molecule of the present disclosure is an RNA R9D-14T aptamer that binds to prothrombin and thrombin at exosite 1 (A) below) and a Toggle-25 aptamer that binds to thrombin exosite 2 (B) below).

[0190]

[0191] Other nucleic acid aptamers that can be included in the RNA origami molecules disclosed herein include any aptamer involved in regulating blood coagulation, including but not limited to: ARC183 / HD1 (targeting FIIa); HD22 (targeting FIIa); HD1-22 (targeting FIIa); Tog25 (targeting FII); R9d14t (targeting FII / FIIa); 11F7t (targeting FXa); 16.3 (targeting FVIIa); 7S-1 / 7S-2 (targeting FVII); 9.3t (targeting FIXa); R4cXII-1 (targeting FXII / FXIIa); NU172 (targeting thrombin); REG1 (targeting FIX / FIXa); REG2 (targeting FIX / FIXa); ARC1779 (targeting von Willebrand factor); and ARC19499 (targeting TFPI).

[0192] To improve and optimize anticoagulant activity, one to four aptamers are included in the RNA origami molecule at four different positions. For example, the double-helical RNA origami (2HO-RNA-XXXX) provides four possible positions for RNA aptamers, one aptamer at each of the four tetraloops, as Figures 12A to 12B shown.

[0193] In some embodiments, it was determined that the binding activity of the dual RNA aptamers included in the RNA origami molecule depends at least in part on the distance between the two aptamers and the flexibility of each aptamer at different positions on the RNA origami. According to these embodiments, four configurations of the RNA aptamer were designed by including the RNA aptamer in the RNA origami, as shown in FIGS. 13A to 13D. For naming purposes, a four-digit number is added after the specific RNA origami used, e.g., 2HO-RNA-XXXX (no aptamer; SEQ ID NO: 1). Depending on the aptamer and the placement position, X can be replaced by a number or letter corresponding to the specific aptamer. For example, the outer site 1-binding RNA aptamer and the outer site 2-binding RNA aptamer are designated "1" and "2", respectively. (The no-aptamer is defined as "N".) Thus, 2HO-RNA-1N2N refers to the outer site 1-binding aptamer placed at position 1 on the 2-helix RNA origami and the outer site 2-binding aptamer 2 tethered at position 3 on the origami. All four designs are depicted in FIGS. 13A to 13D. In subsequent experiments, the 2HO-RNA-NNNN molecule was used as a negative control.

[0194] Computational analysis of the folding of these RNA origami structures was performed using online software (mfold; see unafold.rna.albany.edu) and NUPACK (see nupack.org), as shown in FIGS. 14 to 17. Kissing loop formation was not shown in the simulations.

[0195] According to these embodiments, the length of the single-stranded RNA origami structure without aptamers is about 200 nucleotides, and when two aptamers are included in the RNA origami, its length is about 500 nucleotides. As will be recognized by those of ordinary skill in the art based on the present disclosure, single-stranded RNA molecules with or without aptamers can be synthesized chemically, enzymatically, or using cell-based techniques. For example, T7 RNA polymerase can be used to generate RNA via in vitro and in vivo transcription. In some embodiments, double-stranded DNA can be used as a template. For example, the DNA template can be engineered to contain a blueprint of the RNA origami and a T7 promoter located at the 5' end of the sequence.

[0196] In some embodiments, both modified and unmodified RNA origami structures can be generated. For example, the single-stranded RNA origami molecules of the present disclosure can include at least one nucleoside with a 2'-modification. In some embodiments, the single-stranded RNA origami molecules of the present disclosure can include at least one 2'-fluoro-dCTP or 2'-fluoro-dUTP or another nucleoside with a 2'-modification (such as 2'-amino or 2'-O-methyl) or a backbone phosphate group (such as phosphorothioate) chemical modification.

[0197] The designs and methods described above can be applied to the construction of all nucleic acid molecules described herein, including those embodied in the examples and figures. As will be recognized by those of ordinary skill in the art based on the present disclosure, the designs and methods described above can also be used, for example, to generate variations of the nucleic acid molecules described herein with respect to a desired function (such as antithrombin activity).

[0198] 3. Examples

[0199] It will be apparent to those skilled in the art that other suitable modifications and adaptations of the methods of the present disclosure described herein can be readily applied and understood, and can be implemented using suitable equivalents without departing from the scope of the present disclosure or the aspects and examples disclosed herein. The present disclosure has now been described in detail, and the present disclosure will be more clearly understood by reference to the following examples, which are only intended to illustrate some aspects and embodiments of the present disclosure and should not be considered as limiting the scope of the present disclosure. The disclosures of all journal references, U.S. patents, and published publications referred to herein are hereby incorporated by reference in their entirety.

[0200] The present disclosure has multiple aspects, which are illustrated by the following non-limiting examples.

[0201] Example 1

[0202] DNA templated from G-blocks was amplified by polymerase chain reaction (PCR). The amplified DNA sequences were used for transcription. Each sequence was double-stranded DNA, and each had a different aptamer placement, as shown in Figures 12 to 17 and Figures 35 to 39. Sequences without aptamers were used as negative controls. DNA templates were amplified from G-blocks by PCR for in vitro production. All DNA sequences were successfully amplified at high yields for transcription. Figure 18 and Figure 39 A 1% agarose gel with clearly sized bands for all amplified DNA sequences is shown. After purification, each amplification typically yielded approximately 30 to 60 ng / ul of DNA.

[0203] RNA origamis were generated from the amplified DNA. Then RNA origamis were produced by transcription. Two types of RNA origamis were produced: (i) unmodified RNA origamis and (ii) modified RNA origamis. To produce modified RNA origamis, 2'-fluoro-dCTP and -dUTP were replaced with conventional CTP and UTP, and mutant T7 RNA polymerase (Y639F) was used instead of native T7 polymerase. The difference in RNA transcribed with and without DTT can be seen in Figure 19 . Thereafter, DTT was added to each transcription reaction.

[0204] Analysis of RNA origami structures based on size. Unmodified and modified RNAs were produced. Except for 2H-12NN, all DNA sequences were transcribed into modified and unmodified RNAs. For unmodified two-helix RNAs with various aptamer placements, the RNA was labeled "2HO-RNA-XXXX", and for modified two-helix RNAs with various aptamer placements, it was labeled "2HF-RNA-XXXX". RNA aptamers that bind to outer sites 1 and 2 were labeled "1" and "2", respectively. Figure 20 Shown are the modified and unmodified RNA bands of the NNNN, 2NN1, and 1N2N sequences run through a 6% denaturing acrylamide gel at 20 W for 1 hour. Figure 21 Shown are the unmodified transcriptions of NNNN and 1N2N and the modified transcriptions of all four sequences. Compared with Figure 20 , a small amount of RNA was added to the Figure 21 gel to achieve clearer and distinguishable single bands. After heat annealing, native gels were run to characterize the folded structures. Figure 22 Shown is an example of a 6% native acrylamide gel run with a heat-annealed sample of 2HO-RNA-2NN1 and a 1 kb DNA ladder at 150 V for 3 hours.

[0205] Experiments were also conducted to characterize the nucleic acid constructs embodied in FIGS. 35 to 38. FIGS. 35A to 35C include representative 2D models of two aptamers included in a 31-nucleotide single-stranded RNA linker (Fss12; FIG. 35A). FIGS. 36A to 36C include representative 2D models of an RNA origami (2H-RNA-2211; FIG. 36A), which RNA origami includes four aptamers. FIGS. 37A to 37C include representative 2D models of an RNA origami (3H-RNA-2NN1; FIG. 37A), which RNA origami includes two aptamers and three A-form double helical structures. And FIGS. 38A to 38C include representative 2D models of an RNA origami (4H-RNA-2NN1; FIG. 38A), which RNA origami includes two aptamers and four A-form double helical structures. Computational analysis of the RNA origami folding of the above embodiments was analyzed using mfold RNA and NUPACK software. Purple and blue rectangles represent exosite 1 and exosite 2 binding aptamers, respectively, and yellow and green rectangles indicate tetraloop and kissing loop motifs, respectively.

[0206] Collectively, these results provide a wide range of variation and flexibility for constructing effective nucleic acid-based anticoagulant therapeutics. Specifically, these results also demonstrate the ability to generate both modified and unmodified RNA origami structures that bind to exosites 1 and 2 of thrombin. This is done by amplifying a DNA sequence, then transcribing and heat annealing to generate the RNA origami structure. As shown in FIGS. 12 to 17 and FIGS. 35 to 38, eight types of origami structures are generated, each having a different aptamer placement (or no aptamer as a control; see FIGS. 13A to 13D), and each is characterized by gel electrophoresis. Fluorine-modified NTPs and mutant T7 polymerase were used to create modified RNAs that are stable in plasma. In vitro production allows for the large-scale production of the structures, creating substances sufficient to cause coagulation in plasma.

[0207] Example 2

[0208] Anticoagulant activity. Coagulation in human blood is the result of a series of complex reactions among various proteins in the blood, known as the Blood Coagulation Cascade (BCC). The aptamers used herein bind to one of the proteins in the BCC, namely thrombin. By binding to thrombin, the aptamers included in the RNA origami inhibit the BCC and delay coagulation. The origami uses two different aptamers to bind to exosites 1 and 2 on the thrombin protein, thereby preventing the BCC. The relative inhibition of the BCC can be tested on a coagulometer using the aPTT assay. The coagulometer measures the time required for coagulation to occur after artificial induction with CaCl2. Using this method, the coagulation-regulating efficacy of the single-stranded nucleic acid molecules described herein can be determined.

[0209] For the anticoagulation assay, four aptamer arrangements of both DNA and RNA were tested in a Diagnostica Stago ST4 coagulometer. The resulting data collected confirmed that no anticoagulant activity of unmodified RNA origami was found in all aptamer arrangement designs, as the 2HN RNA origami showed the same clotting time as the standard buffer. These results also confirmed that unmodified RNA origami is unstable in human plasma. However, compared to unmodified RNA sheets, modified RNA origami showed remarkable activity, with clotting times between 150 and 260 seconds. Additionally, DNA aptamers present on DNA sheets were tested, which exhibited the same trend of anticoagulant activity as previously reported and had a similar magnitude of activity. The activities of all the sheets tested are provided in Figure 23 in.

[0210] The results showed that modified RNA had similar or better effects than DNA sheets, and the data fell within the standard deviation. Although to different extents, the RNA structures of 12NN, 1N2N, 2NN1( Figure 23 and 48 ) and 2211( Figure 47 and 48 ) all exhibited significant anticoagulant activity. The RNA origami sheets with RNA aptamers performed as well as their DNA counterparts, if not better. The binding observed further confirmed that modified RNA is stable in human plasma.

[0211] Example 3

[0212] Specificity assay. In the complex environment of the coagulation cascade and human plasma, there are many proteins and small molecules involved and present in blood. Therefore, specific binding of the capture molecule to its target is important. Thrombin contains two active sites called exosite 1 and 2 for activating the coagulation pathway. To inhibit the activity of thrombin, thrombin RNA aptamers were used, as further described herein. Functional RNA origami molecules containing two aptamers that bind to thrombin to inhibit the coagulation process were designed. To test the specificity of thrombin-binding RNA origami, thrombin, factor IXa, and factor Xa involved in the coagulation cascade were used together with bovine serum albumin (BSA). The binding of the RNA origami-protein complex was characterized by gel electrophoresis mobility shift assay.

[0213] The binding complex of the RNA thrombin aptamer included in the RNA origami (Th-RNA origami) with thrombin was assayed using gel electrophoresis mobility shift assays. Eight designs of the RNA origami were examined (one without the thrombin aptamer and seven containing the thrombin aptamer). The RNA origami without the thrombin aptamer (2HF-RNA-NNNN) could not bind to thrombin. All seven designs of the thrombin-containing RNA origami (2HF-RNA-12NN, 1N2N, 2NN1, Fss12, 2HF-2211, 3HF-2NN1, and 4HF-2NN1) migrated slower when incubated with thrombin than the RNA origami in the absence of thrombin ( Figure 24 and 41). In addition, the protein-stained gel showed that a smeared pattern band of the thrombin protein appeared at the same position as the RNA-thrombin complex in the nucleic acid-stained gel. These results indicate that the RNA origami with the RNA thrombin aptamer binds to thrombin.

[0214] Specificity assays of the Th-RNA origami with two proteins (factor IXa and Xa) involved in the coagulation cascade and a common protein (bovine serum albumin, BSA) were performed. To assay for specificity, the RNA origami was incubated with the proteins at 37 °C for one hour and characterized by native acrylamide gel electrophoresis. The non-aptamer present on the RNA origami (2HF-RNA-NNNN) could not bind to all four proteins ( Figure 25 ). All seven designs of the RNA origami with the RNA thrombin aptamer (2HF-RNA-12NN, 1N2N, 2NN1, Fss12, 2HF-2211, 3HF-2NN1, and 4HF-2NN1) showed specific binding to thrombin, as shown in the results Figures 26 to 28 and Figures 42 to 45.

[0215] In addition, the specific binding of the thrombin DNA aptamer placed on the DNA woven sheet to the thrombin protein was also assayed. A 2-helix-DNA woven sheet (2HT) was used. For the DNA sheet, two aptamers called "Apt-P" and "Apt-B" were extended on each design that binds to exosites 1 and 2 of thrombin. The DNA sheet called "NNNN" did not contain any aptamers. For the 2HT-DNA-BPNN construct, aptamers B and P were extended from positions 1 and 2 on the DNA woven sheet ( Figure 29 ). These results showed that no thrombin bound to 2HT-DNA-NNNN was observed.

[0216] The binding of 2HF-RNA and 2HT-DNA containing two and four aptamers, respectively, to thrombin was evaluated using gel electrophoretic mobility shift assays. These results demonstrated that both the RNA origami and DNA weave sheets with aptamers specifically bound to thrombin. Additionally, no non-specific binding of the RNA origami to non-specific targets (factor IXa, Xa, and BSA) was found ( Figures 26 to 28 and 42 to 45).

[0217] As further described herein, the nucleic acid constructs shown in FIGS. 35 to 38 demonstrate that effective anticoagulant activity can be achieved using single-stranded RNA linked to aptamers that do not have these motifs (FIGS. 35A to 35C) as compared to using a double-stranded RNA origami platform with one or more of the tetraloop or kissing loop motifs. Effective anticoagulant activity can also be achieved using an RNA origami platform with four aptamers but no tetraloop (FIGS. 36A to 36C). Additionally, effective anticoagulant activity can be achieved using an RNA origami platform with two aptamers and 2, 3, or 4 helical structures separating the aptamers.

[0218] Example 4

[0219] Stability assays. RNA is a functional biomolecule that plays a key role in cellular biology such as gene regulation. RNA is stable under cellular physiological conditions but generally has a short half-life in human plasma (see the figures below). For the therapeutic use of functional RNA, the stability of RNA is one of the major challenges. 2'-modification of ribose has been widely used to improve the stability of RNA under nuclease conditions such as human plasma. It has been previously reported that 2'-fluoro- and 2'-amino-modified nucleosides incorporated into ribozymes are resistant to ribonuclease degradation. Importantly, 2'-fluoro-dCTP and 2'-fluoro-dUTP do not affect the catalytic activity of ribozymes. Therefore, 2'-fluoro-CTP and -UTP were selected as building blocks for in vitro generation of RNA origami.

[0220]

[0221] As shown above: (A) natural nucleotide, cytidine-5'-triphosphate (CTP) and (B to D) modified nucleotides: (B) 2'-fluoro-2'-deoxycytidine-5'-triphosphate (2'F-dCTP), (C) 2'-amino-2'-deoxycytidine-5'-triphosphate (2'-amino-dCTP), and (D) 2'-O-methylcytidine-5'-triphosphate (2'-O-methyl-CTP). Cytosine, ribose, triphosphate, and 2'-modification are represented by green, blue, orange, and yellow rectangles, respectively.

[0222] To test the stability of RNA origami in ribonuclease A, unmodified and modified RNA origami were incubated with ribonuclease A (10 and 500 μg / ml) at 37 °C for 10 minutes to up to 24 hours. The integrity of the RNA origami was characterized using denaturing gel electrophoresis (Figures 30 - 31). As the results show, in the ribonuclease-containing solution, the unmodified RNA origami degraded within 10 minutes (Figure 30B). In 10 μg / ml ribonuclease, the 2'-fluoro-CTP and -UTP modified RNA origami were stable for at least 6 hours (Figure 30A). At high concentration of ribonuclease A (500 μg / ml), the modified RNA origami was stable for 30 minutes, as shown in Figure 31A.

[0223] For therapeutic applications, the stability of anticoagulants in human plasma is important. Human plasma contains various components such as deoxyribonuclease (DNase) and ribonuclease that degrade DNA and RNA structures. Here, the resistance of RNA origami and DNA sheets in pooled human plasma was tested. Denaturing gel electrophoresis was used to characterize the integrity of the nucleic acid nanostructures. The RNA origami and DNA sheets were incubated with human plasma at various time points from 10 minutes to up to 24 hours. In human plasma, the 2'-fluoro-modified RNA origami was stable for 24 hours, as shown in Figures 32A to 32B. The intensity of the RNA at the top band shown in Figure 32A indicates that a certain amount of RNA origami still binds to thrombin in human plasma. The unmodified RNA origami degraded within less than 10 minutes ( Figure 33 ). In human plasma, the DNA woven sheets were stable for 6 hours ( Figure 34 ). These results show that in human plasma, the 2'-fluoro-modified RNA origami is more stable than the DNA sheets.

[0224] Native RNA origami was degraded by ribonuclease within less than 10 minutes. To utilize functional RNA origami for therapeutic applications, the stability of RNA origami is important. These results show that in ribonuclease A, the 2'-fluoro-modified RNA origami is stable for at least 6 hours. Additionally, in human plasma, the modified RNA origami was stable for 24 hours, which is more stable than the DNA sheets. The stability of the 2'-fluoro-modified RNA origami in human plasma for 24 hours indicates that RNA origami is a promising biomolecule for use in therapeutic applications.

[0225] The storage stability of the nucleic acid aptamer constructs of the present disclosure was also tested, as Figure 46As shown. In one embodiment, the storage buffer used includes 20 mM HEPES (pH 7.4), 150 mM NaCl, and 2 mM CaCl2. As will be recognized by those of ordinary skill in the art based on the present disclosure, depending on the context of storing the aptamer construct, the components of this storage buffer can vary by up to ±25%. For example, as Figure 46 shown, the average anticoagulant activity of freshly prepared 2HF-RNA-2NN1 samples was compared to samples stored at 4 °C for up to 90 days. The results showed that after storage at 4 °C, the RNA origami anticoagulant was stable for at least 3 months and was active.

[0226] According to these embodiments, the nucleic acid aptamer constructs of the present disclosure can be stored in the temperature range from room temperature to -20 °C without significant loss of anticoagulant activity. In some embodiments, prior to long-term storage, the nucleic acid aptamer constructs of the present disclosure can be directly dissolved in the storage buffer and / or lyophilized in water (e.g., ultrapure water). In some embodiments, the nucleic acid aptamer constructs of the present disclosure are first dissolved in the storage buffer or in water, and then lyophilized and stored. Prior to use, the nucleic acid aptamer constructs can be reconstituted and allowed to fold properly for a period of time (e.g., 30 minutes). In other embodiments, prior to lyophilization, the nucleic acid aptamer constructs of the present disclosure can be allowed to fold properly in the storage buffer. Prior to use, water or buffer can be added to dissolve the lyophilized construct, which will generally be functional and ready for use.

[0227] Example 5

[0228] Reversal of thrombin inhibition. Control of the coagulation cascade provides benefits for surgical and disease applications. Chemically based anticoagulants have been developed and are often used, but due to their narrow therapeutic window (the narrow concentration difference between the therapeutic dose and the toxic dose), continuous monitoring of patients is required to prevent dangerous side effects such as hemorrhage and bleeding. An alternative solution is nucleic acid-based anticoagulants, which never cause hemorrhage and can be terminated by available antidotes.

[0229] An antidote for an aptamer-based anticoagulant can be a short strand of single-stranded nucleic acid (DNA and PNA) having a nucleotide sequence complementary to the aptamer sequence. Previous studies have shown that the thrombin activity can be reversibly inhibited and reactivated by adding an ssDNA antidote. This can also be demonstrated with DNA aptamers on a DNA chip. RNA origami with RNA aptamers provides high anticoagulant activity compared to free aptamers (as shown herein). Reversal of thrombin inhibition can be challenging because it is necessary to disrupt the tight thrombin binding and stable folding of the aptamer. Here, the restoration of clotting activity is examined by adding an antidote that is a complementary counterpart of the exosite-1 and -2 binding aptamers. This antidote mechanism for regulating the clotting cascade can provide great benefits during medical procedures and disease treatment.

[0230] As shown in FIGS. 50A to 50B, an antidote made of DNA of two aptamers designed for 2HF-RNA-2NN1 was designed. After incubating the RNA origami with plasma and other reagents for an aPTT assay, the antidote was added, and the whole sample was further incubated for 5 minutes.

[0231] The data shows that reversal of activity is possible upon addition of the antidote, as the antidote assay shows that the average clotting time is approximately 85 seconds, at which time 80% is restored (20% of thrombin is still inhibited). The incomplete reversal may be due to the poor effect of the antidote on strand invasion of one of the two aptamers or due to the concentration difference of the antidote required to counteract thrombin binding. Additionally, as Figure 51 shown, a peptide nucleic acid (PNA) antidote for 2HF-RNA-2NN1 is also effective and significantly more effective than the DNA-based counterpart.

[0232] It has been shown that 2HF-RNA-2NN1 origami can also effectively inhibit and delay clotting at concentrations as low as 0.5 μM. However, another benefit of RNA origami and RNA aptamer design is the ease of implementing an antidote to the aptamer, thus allowing a surgeon, for example, to terminate anticoagulation. Using an ssDNA antidote, the activity of thrombin can be restored by about 80%, or using a PNA antidote, at least 80% is restored, as shown.

[0233] 4. Materials and Methods

[0234] The G-Block sequences were amplified. The reaction buffer, forward and reverse primers, dNTP, DNA polymerase, and nuclease-free water were added to the PCR tube at the concentrations shown in Table 1. The DNA polymerase was added last, and the sample was pipetted to mix.

[0235] Table 1: G-block PCR concentrations and volumes.

[0236] Final concentration Reaction buffer (x) 1 Forward primer (μM) 0.5 Reverse primer (μM) 0.5 dNTP (mM) 0.2 DNA template (μl / 50μl) 2 DNA polymerase (units / μl) 0.02 Nuclease - free water To desired volume

[0238] Place the sample in a thermal cycler and perform PCR using the Figure 52 procedure shown.

[0239] After PCR, a small volume (about 2 - 5 μl) of the amplified DNA sample is used for testing in a 1% agarose gel. The DNA is run at 150 V for 30 minutes next to a 1 kb ladder (Promega). The gel is then observed under ultraviolet light (ProteinSimple instrument). If appropriate band sizes are observed, then the remaining DNA sample is used for in - solution purification using a GFX DNA purification kit (GE Healthcare). Approximately 1 μl of the purified solution is used for analysis using a Nanodrop 3000c spectrophotometer (ThermoFisher Scientific). Record the concentration for further use and retain the DNA and label it (2H - XXXX) for subsequent transcription.

[0240] Then perform unmodified transcription. Mix all the contents (excluding RNA T7 polymerase) found in Table 2 below in a PCR tube. It should be noted that the DTT used is mixed in the laboratory to ensure freshness. Finally, add RNA T7 polymerase and pipette the sample to mix. Synthesize the sample on ice to try to slow down enzymes (such as ribonucleases) that have a negative impact on RNA. After adding all the components and mixing them, place the sample in a thermal cycler and incubate at 37 °C for 4 to 16 hours and then hold at 4 °C.

[0241] Table 2: Unmodified transcription contents and concentrations.

[0242] Final concentration Transcription NEB buffer (x) 1 Fresh DTT (mM) 5 NTP (mM each) 2.5 DNA template (ng) 120 RNA T7 polymerase (μl / 50μl) 2.5 Nuclease - free water To desired volume

[0243] For fluorinated - modified transcription, follow the procedure as above but use the contents found in Table 3 below:

[0244] Table 3: Fluorinated - modified transcription contents and concentrations.

[0245]

[0246]

[0247] After transcription, a small volume of the sample (about 5 μl) was used for observation in a 6% acrylamide denaturing gel. The sample was run next to the nucleic acid maker at 20 W for 1 hour. The gel was then observed under ultraviolet light to check for the appropriate length. If the sequence length was appropriate and the desired bands were present, the sample was then purified using the Monarch RNA Clean-Up kit. Approximately 31 μl of elution buffer was used for purification, and 1 μl of the sample was used for analysis using a Nanodrop 3000c. The optical density (A260) was recorded, and the molar concentration of the sample was calculated according to Beer's law.

[0248] The sample was then heat-annealed by heating at 95 °C for 5 minutes, followed by cooling at -20 °C for 3 minutes. Then 5X DNA sheet buffer was added, and the sample was heated to 37 °C for 30 minutes. The sample was diluted to the desired volume using 1X DNA sheet buffer for further use.

[0249] The APTT clotting assay evaluated the clotting time of pooled human plasma with DNA / RNA sheets having anticoagulant aptamers. Both approximately 16.67 μL of 5 μM RNA and DNA sheet samples were assayed in 50 μL of pooled human plasma, 50 μL of aPTT reagent, and 50 μl of CaCl2 solution.

[0250] For the specificity assay, the heat-annealed RNA origami or DNA woven sheet (5 pmol) was dissolved in 1X annealing buffer and incubated with the protein (25 pmol) at 37 °C for 1 hour. The sample was assayed by 6% acrylamide gel electrophoresis at 150 V for 3 hours in 1X TBE as the running buffer. The gel was stained with ethidium bromide for nucleic acid staining and visualized under ultraviolet light. Then, the gel was further stained with Coomassie blue for protein staining and imaged with a ProteinSimple instrument.

[0251] For RNA origami folding, unmodified and modified RNA origamis were dissolved in nuclease-free water, heated at 95 °C for 5 minutes, and rapidly cooled at -20 °C for 3 minutes. Then, the samples were mixed with 5X annealing buffer to reach a concentration in 1X buffer and annealed at 37 °C for 30 minutes. Finally, 1x buffer was added to the folded RNA origami to reach the desired concentration. The folded RNA origami (1 μl, 5 μM) was mixed with ribonuclease A (1 μl each of 10 and 500 μg / ml) or human plasma (3 μl) and incubated at 37 °C for various time courses from 10 minutes to 24 hours. The integrity of the RNA origami was characterized by denaturing gel electrophoresis. For denaturing gel electrophoresis, the gel was pre-run at 20 W for 15 minutes and the samples were run at 20 W for 1 hour. Finally, the gel was stained with ethidium bromide for nucleic acid staining. The nucleic acid bands were visualized under ultraviolet light on a ProteinSimple instrument.

[0252] For the antidote assay, clotting assays were run in activated partial thromboplastin time (APTT) determinations using a STA-R 4 Hemostasis Analyzer (Diagnostica Stago). Approximately 50 μL of pooled human plasma (George King Bio-Medical) was added to each cuvette, mixed with 50 μL of aPTT reagent (TriniClot), and incubated at 37 °C for 5 minutes. Then 13.67 μL of a 6.09 μM RNA origami sample or buffer was added and incubated at 37 °C for an additional 5 minutes. Five minutes later, 3.00 μL of DNA or PNA antidote was added and incubated at 37 °C for an additional 5 minutes. To activate clotting, 50 μL of CaCl2 solution was added. The final concentration of the RNA sample was 0.5 μM. The clotting time was then measured with the machine and recorded.

[0253] 5. Sequences

[0254] The present disclosure provides the following nucleic acids, as recited herein.

[0255] RNA-NNNN (SEQ ID NO: 1)

[0256] GGGAGAUCGAGCGACUUCCGACUUCGGUCGGGAGUCGGGCUAGUCAUCUUCGGAUGAUUAGCCGCUGGUGAAGCCUCCACGCCAGCCUCGGUCUCCCGCAGUAGGAUCGGACUGAAGGAGGCACGGUCCCAGCCGAAGUGUCUUGCUUCGGCAAGGCACUUUGGCUGCUAGACUGGCUGGCUUCGGCCAGCUAGUUUAGGAUUCUAUUGC

[0257] RNA-12NN (SEQ ID NO: 2)

[0258] GGGAGAUCGAGCGACUUCCGACUUCGGUCGGGAGUCGGGCUAGUCAUCGGGAACAAAGCUGAAGUACUUACCCGAUGAUUAGCCGCUGGUGAAGCCUCCACGCCAGCCUCGGUCUCCCGCAGUAGGAUCGGACUGAAGGAGGCACGGUCCCAGCCGAAGUGUCUGGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCCAGGCACUUUGGCUGCUAGACUGGCUGGCUUCGGCCAGCUAGUUUAGGAUUCUAUUGC

[0259] RNA-1N2N (SEQ ID NO: 3)

[0260] GGGAGAUCGAGCGACUUCCGACGGGAACAAAGCUGAAGUACUUACCCGUCGGGAGUCGGGCUAGUCAUCUUCGGAUGAUUAGCCGCUGGUGAAGCCUCCACGCCAGCCUCGGUCUCCCGCAGUAGGAUCGGACUGAAGGAGGCACGGUCCCAGCCGAAGUGUCUGGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCCAGGCACUUUGGCUGCUAGACUGGCUGGCUUCGGCCAGCUAGUUUAGGAUUCUAUUGC

[0261] RNA-2NN1 (SEQ ID NO: 4)

[0262] GGGAGAUCGAGCGACUUCCGACUUCGGUCGGGAGUCGGGCUAGUCAUCUUCGGAUGAUUAGCCGCUGGUGAAGCCUCCACGCCAGCCUCGGUCUCCCGCAGUAGGAUCGGACUGAAGGAGGCACGGUCCCAGCCGAAGUGUCUUGCGGGAACAAAGCUGAAGUACUUACCCGCAAGGCACUUUGGCUGCUAGACUGGCUGGCGGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCCGCCAGCUAGUUUAGGAUUCUAUUGC

[0263] Fss12 (SEQ ID NO: 5)

[0264] GGGAACAAAGCUGAAGUACUUACCCACCUUACCACUCCACCUCACUCACCUAUUACGGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC

[0265] 2H-2211 (SEQ ID NO: 6)

[0266] GGGAGAUCGAGCGACUUCCGACUCUGGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCCAGAGUCGGGAGUCGGGCUAGUCAUCAGGCACGGGAACAAAGCUGAAGUACUUACCCGUGCCUGAUGAUUAGCCGCUGGUGAAGCCUCCACGCCAGCCUCGGUCUCCCGCAGUAGGAUCGGACUGAAGGAGGCACGGUCCCAGCCGAAGUGUCUUGCGGGAACAAAGCUGAAGUACUUACCCGCAAGGCACUUUGGCUGCUAGACUGGCUGGCGGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCCGCCAGCUAGUUUAGGAUUCUAUUGC

[0267] 3H-2NN1 (SEQ ID NO: 7)

[0268] GGAAAUGAUGCCGAGUUGACGCUUCGGCGUCAGCUCGCCCUGUGGCCUAGUUCGCUAGGUCACAGACAUCUUGGCGUUCGCGCCAGGAUGUCUCGCCCAAUUCCGUAGGGCGAGGGUAGCCAAAUCCAGAGGCUAGCAUUAUUUCCGAUCUAGGAUCGCGUUGAGAACUGGAUACUCAACAGCGGUAAACGGAAAACCGCUCAGCCGAAGUGUCUUGCGGGAACAAAGCUGAAGUACUUACCCGCAAGGCACUUUGGCUGGCCACGCGUCGUAUUCGUACGGCGCGUGCUAGACUGGCUGGCGGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCCGCCAGCUAGUUUAGGAUUCUAGAUC

[0269] 4H-2NN1 (SEQ ID NO: 8)

[0270] GGAAAUGAUGCCGAGUUGACGCUUCGGCGUCAGCUCGCCCUGUGGCCUAGUUCGCUAGGUCACAGCCGACCAUUGCGUUUCGACGCAGUGGUCACAUCUUGGCGUUCGCGCCAGGAUGUCUCGCCCAAUUCCGUAGGGCGAGGGGACCCAAAUCCCUAGGGUCGGUAGCCAAAUCCAGAGGCUAGCAUUAUUUCCGAUCUAGGAUCGCGUUGAGAACUGGAUACUCAACCGUGGCAUAAAGGGAUAAUGCCAAGCGGUAAACGGAAAACCGCUCAGCCGAAGUGUCUUGCGGGAACAAAGCUGAAGUACUUACCCGCAAGGCACUUUGGCUGCGUGGCGUUACAGUUCGCUGUGACGCCAGCCACGCGUCGUAUUCGUACGGCGCGUGCUAGACUGGCUGGCGGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCCGCCAGCUAGUUUAGGAUUCUAGAUC

[0271] The Gblock sequence is provided below (the T7 promoter is in bold).

[0272] 2H-DNA block-NNNN (SEQ ID NO: 9)

[0273] CACTTTCAGCCCTCTTATCCTCGGCGGATCCTTCTAATACGACTCACTATAGGGAGATCGAGCGACTTCCGACTTCGGTCGGGAGTCGGGCTAGTCATCTTCGGATGATTAGCCGCTGGTGAAGCCTCCACGCCAGCCTCGGTCTCCCGCAGTAGGATCGGACTGAAGGAGGCACGGTCCCAGCCGAAGTGTCTTGCTTCGGCAAGGCACTTTGGCTGCTAGACTGGCTGGCTTCGGCCAGCTAGTTTAGGATTCTATTGC

[0274] 2H-DNA block-12NN (SEQ ID NO: 10)

[0275] CACTTTCAGCCCTCTTATCCTCGGCGGATCCTTCTAATACGACTCACTATAGGGAGATCGAGCGACTTCCGACTTCGGTCGGGAGTCGGGCTAGTCATCGGGAACAAAGCTGAAGTACTTACCCGATGATTAGCCGCTGGTGAAGCCTCCACGCCAGCCTCGGTCTCCCGCAGTAGGATCGGACTGAAGGAGGCACGGTCCCAGCCGAAGTGTCTGGCGGTCGATCACACAGTTCAAACGTAATAAGCCAATGTACGAGGCAGACGACTCGCCAGGCACTTTGGCTGCTAGACTGGCTGGCTTCGGCCAGCTAGTTTAGGATTCTATTGC

[0276] 2H-DNA block-1N2N (SEQ ID NO: 11)

[0277] CACTTTCAGCCCTCTTATCCTCGGCGGATCCTTCTAATACGACTCACTATAGGGAGATCGAGCGACTTCCGACGGGAACAAAGCTGAAGTACTTACCCGTCGGGAGTCGGGCTAGTCATCTTCGGATGATTAGCCGCTGGTGAAGCCTCCACGCCAGCCTCGGTCTCCCGCAGTAGGATCGGACTGAAGGAGGCACGGTCCCAGCCGAAGTGTCTGGCGGTCGATCACACAGTTCAAACGTAATAAGCCAATGTACGAGGCAGACGACTCGCCAGGCACTTTGGCTGCTAGACTGGCTGGCTTCGGCCAGCTAGTTTAGGATTCTATTGC

[0278] 2H-DNAGblock-2NN1(SEQ ID NO:12)

[0279] CACTTTCAGCCCTCTTATCCTCGGCGGATCCTTCTAATACGACTCACTATAGGGAGATCGAGCGACTTCCGACTTCGGTCGGGAGTCGGGCTAGTCATCTTCGGATGATTAGCCGCTGGTGAAGCCTCCACGCCAGCCTCGGTCTCCCGCAGTAGGATCGGACTGAAGGAGGCACGGTCCCAGCCGAAGTGTCTTGCGGGAACAAAGCTGAAGTACTTACCCGCAAGGCACTTTGGCTGCTAGACTGGCTGGCGGCGGTCGATCACACAGTTCAAACGTAATAAGCCAATGTACGAGGCAGACGACTCGCCGCCAGCTAGTTTAGGATTCTATTGC

[0280] DNAGblock-Fss12(SEQ ID NO:13)

[0281] CACTTTCAGCCCTCTTATCCTCGGCGGATCCTTCTAATACGACTCACTATAGGGAACAAAGCTGAAGTACTTACCCACCTTACCACTCCACCTCACTCACCTATTACGGCGGTCGATCACACAGTTCAAACGTAATAAGCCAATGTACGAGGCAGACGACTCGCC

[0282] 2H-DNA block-2211 (SEQ ID NO: 14)

[0283] CACTTTCAGCCCTCTTATCCTCGGCGGATCCTTCTAATACGACTCACTATAGGGAGATCGAGCGACTTCCGACTCTGGCGGTCGATCACACAGTTCAAACGTAATAAGCCAATGTACGAGGCAGACGACTCGCCAGAGTCGGGAGTCGGGCTAGTCATCAGGCACGGGAACAAAGCTGAAGTACTTACCCGTGCCTGATGATTAGCCGCTGGTGAAGCCTCCACGCCAGCCTCGGTCTCCCGCAGTAGGATCGGACTGAAGGAGGCACGGTCCCAGCCGAAGTGTCTTGCGGGAACAAAGCTGAAGTACTTACCCGCAAGGCACTTTGGCTGCTAGACTGGCTGGCGGCGGTCGATCACACAGTTCAAACGTAATAAGCCAATGTACGAGGCAGACGACTCGCCGCCAGCTAGTTTAGGATTCTATTGC

[0284] 3H-DNA block-2NN1 (SEQ ID NO: 15)

[0285] CGGCCAGTGAATTCGAGCTCGGTACCCGGGAGATCTCACTTTCAGCCCTCTTATCCTCGGCCGATCCTTCTAATACGACTCACTATAGGAAATGATGCCGAGTTGACGCTTCGGCGTCAGCTCGCCCTGTGGCCTAGTTCGCTAGGTCACAGACATCTTGGCGTTCGCGCCAGGATGTCTCGCCCAATTCCGTAGGGCGAGGGTAGCCAAATCCAGAGGCTAGCATTATTTCCGATCTAGGATCGCGTTGAGAACTGGATACTCAACAGCGGTAAACGGAAAACCGCTCAGCCGAAGTGTCTTGCGGGAACAAAGCTGAAGTACTTACCCGCAAGGCACTTTGGCTGGCCACGCGTCGTATTCGTACGGCGCGTGCTAGACTGGCTGGCGGCGGTCGATCACACAGTTCAAACGTAATAAGCCAATGTACGAGGCAGACGACTCGCCGCCAGCTAGTTTAGGATTCTAGATC

[0286] 4H-DNAGblock-2NN1 (SEQ ID NO: 16)

[0287] CGGCCAGTGAATTCGAGCTCGGTACCCGGGAGATCTCACTTTCAGCCCTCTTATCCTCGGCCGATCCTTCTAATACGACTCACTATAGGAAATGATGCCGAGTTGACGCTTCGGCGTCAGCTCGCCCTGTGGCCTAGTTCGCTAGGTCACAGCCGACCATTGCGTTTCGACGCAGTGGTCACATCTTGGCGTTCGCGCCAGGATGTCTCGCCCAATTCCGTAGGGCGAGGGGACCCAAATCCCTAGGGTCGGTAGCCAAATCCAGAGGCTAGCATTATTTCCGATCTAGGATCGCGTTGAGAACTGGATACTCAACCGTGGCATAAAGGGATAATGCCAAGCGGTAAACGGAAAACCGCTCAGCCGAAGTGTCTTGCGGGAACAAAGCTGAAGTACTTACCCGCAAGGCACTTTGGCTGCGTGGCGTTACAGTTCGCTGTGACGCCAGCCACGCGTCGTATTCGTACGGCGCGTGCTAGACTGGCTGGCGGCGGTCGATCACACAGTTCAAACGTAATAAGCCAATGTACGAGGCAGACGACTCGCCGCCAGCTAGTTTAGGATTCTAGATC

[0288] The following provides DNA and PNA antidote sequences.

[0289] Anti_Ex1_A06 (SEQ ID NO: 17)

[0290] GTCTGCCTCGTACATTGGCT

[0291] Anti_Ex2_Full (SEQ ID NO: 18)

[0292] GGGTAAGTACTTCAGCTTTGTTCCC

[0293] Anti_Ex1_PNA_A06 (SEQ ID NO: 19)

[0294] GTCTGCCTCGTACATTGGCT

[0295] Anti_Ex2_PNA_19nt (SEQ ID NO: 20)

[0296] GTACTTCAGCTTTGTTCCC

[0297] It will be apparent to those skilled in the art that other suitable modifications

[0298] It should be understood that the foregoing detailed description and the appended examples are illustrative only and should not be considered as limiting the scope of the present disclosure, which is defined only by the appended claims and their equivalents.

[0299] Various changes and modifications to the disclosed embodiments will be apparent to those skilled in the art. Such changes and modifications, including but not limited to those related to the chemical structures, substituents, derivatives, intermediates, syntheses, compositions, formulations or methods of use of the present disclosure, can be made without departing from the spirit and scope of the present disclosure.

Claims

1. A single-stranded nucleic acid molecule comprising: at least one A-type double helix structure and at least one crossover region; at least one kissing loop region; and at least one nucleic acid aptamer having anticoagulant activity.

2. The nucleic acid molecule according to claim 1, further comprising at least one tetraloop region.

3. The nucleic acid molecule according to claim 1 or 2, wherein the nucleic acid molecule is an RNA molecule.

4. The nucleic acid molecule according to any one of claims 1 to 3, wherein the nucleic acid molecule is an RNA molecule comprising at least one nucleoside having a 2'-modification.

5. The nucleic acid molecule according to claim 2, wherein the at least one tetraloop region comprises a tetranucleotide motif.

6. The nucleic acid molecule according to any one of claims 1 to 5, wherein the nucleic acid molecule comprises one to six tetraloop regions, each tetraloop comprising a tetranucleotide motif.

7. The nucleic acid molecule according to any one of claims 1 to 6, wherein the at least one kissing loop region is a 180° kissing loop region.

8. The nucleic acid molecule according to any one of claims 1 to 7, wherein the nucleic acid molecule comprises one to four aptamers having anticoagulant activity.

9. The nucleic acid molecule according to claim 8, wherein each of the one to four aptamers replaces a tetraloop region.

10. The nucleic acid molecule according to any one of claims 1 to 9, wherein the nucleic acid molecule is an RNA molecule having at least 80% sequence identity with SEQ ID NO: 1.SEQ 1.

Images