Method for detecting biomarkers in extracellular vesicles through nucleic acid aptamer and membrane fusion mediated by nucleic acid aptamer
Through the nucleic acid aptamer-mediated membrane fusion method, combined with the CRISPR-Cas12a system, the rapid and accurate detection of Aβ42 protein in L1CAM-EVs is achieved, solving the problem of time-consuming and low detection accuracy of traditional methods, and achieving efficient biomarker quantification.
Patent Information
- Application Number
- CN202510269666.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-07
- Publication Date
- 2025-07-08
AI Technical Summary
Traditional extracellular vesicle (EVs) biomarker detection methods are time-consuming, expensive, and highly technically demanding, and may lead to biomarker degradation. The low internalization efficiency of existing nanoparticles or the alteration of EVs membrane permeability leads to reduced detection accuracy.
The membrane fusion method mediated by nucleic acid aptamer is used to specifically bind nucleic acid aptamer to L1CAM-EVs, and the Aβ42 protein is detected using the CRISPR-Cas12a system to achieve selective fusion of liposomes and EVs to avoid biomarker loss.
Fast, accurate and rupture-free L1CAM-EVs biomarker detection is achieved, improving the specificity and performance of the detection, and accurately quantifying Aβ42 protein.
Smart Images

Figure CN120272486A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biochemistry, and particularly relates to a nucleic acid aptamer targeting L1CAM protein, its application, and a method for detecting biomarkers contained in extracellular vesicles mediated by its membrane fusion. Background Art
[0002] Alzheimer's disease (AD) is an irreversible neurodegenerative disease that requires early diagnosis and intervention. Clinically, there is a lack of effective early diagnostic biomarkers. Blood, due to advantages such as easy sampling and repeatable detection, is an important area for AD biomarker research. However, blood biomarkers are greatly interfered by peripheral metabolism, have low concentrations, and a large diagnostic value gray zone, resulting in limited diagnostic efficacy. Recent studies have found that brain-derived extracellular vesicles (BDEVs) in blood contain a variety of signaling molecules and are more valuable for early AD diagnosis. In particular, L1CAM-positive extracellular vesicles (L1CAM-EVs), as a type of BDEVs, have gradually attracted attention because of their strong specificity and ability to effectively carry nerve markers.
[0003] However, the detection of traditional extracellular vesicle (EVs) biomarkers requires a series of complex steps, including extracellular vesicle isolation, biomarker extraction, and analysis. These processes are usually time-consuming, expensive, and require high technical skills. In addition, extracting biomarkers from EVs may lead to their degradation because the membrane protection is lost, which may affect the accuracy and reliability of diagnosis.
[0004] To overcome these challenges, alternative methods have been developed to directly deliver molecular probes into EVs for in-situ detection. This method helps to maintain the integrity of biomarkers and prevent their loss and degradation. Two main strategies for probe delivery include directly transferring the probe into EVs and membrane fusion. An example of the former is incubating a gold nanoscintillation probe with EVs for miRNA detection. However, due to the weak interaction between nanoparticles and the EVs membrane, the internalization efficiency of nanoparticles is limited. In addition, streptolysin O can be used to change the permeability of EVs so that the probe can penetrate into EVs to detect breast cancer markers. Although some progress has been made, changing the permeability of the EVs membrane may cause the leakage of contents and reduce the accuracy of EVs biomarker detection.
[0005] Different from the above methods, in recent years, more and more studies have loaded molecular probes in lipid vesicles and achieved in-situ biomarker detection by fusing with EVs. For example, using electrostatic interaction, cationic lipid vesicles encapsulating molecular probes are fused with extracellular vesicles to detect extracellular vesicle RNA. However, the shelf life of such cationic lipid vesicles is usually short, and the prepared probes must be used immediately. Therefore, it is necessary to develop a more effective, reliable, and easy-to-operate method for detecting EVs biomarkers. Summary of the Invention
[0006] One object of the present invention is to provide a nucleic acid aptamer capable of effectively detecting L1CAM-EVs biomarkers in view of the above technical problems to be solved.
[0007] Another object of the present invention is to provide the application of the nucleic acid aptamer.
[0008] Another object of the present invention is to provide a method for detecting L1CAM-EVs biomarkers.
[0009] To achieve the above invention objects, the present invention provides a nucleic acid aptamer, which is a single-stranded DNA probe containing the nucleotide sequence shown in SEQ ID NO. 2 and has a -Chol modification at the 5' end.
[0010] On the other hand, the present invention also provides the application of the nucleic acid aptamer in the preparation of reagents for detecting L1CAM-EVs biomarkers.
[0011] Preferably, the biomarker is Aβ42 protein.
[0012] On the other hand, the present invention also provides the application of the nucleic acid aptamer in the preparation of reagents for recognizing and / or binding L1CAM.
[0013] On the other hand, the present invention also provides the application of the nucleic acid aptamer in the preparation of reagents for recognizing and / or binding L1CAM-EVs.
[0014] On the other hand, the present invention also provides the application of the nucleic acid aptamer in the preparation of reagents for diagnosing Alzheimer's disease.
[0015] On the other hand, the present invention also provides a method for detecting biomarkers contained in extracellular vesicles mediated by a nucleic acid aptamer, wherein the method includes: fusing extracellular vesicles with liposomes mediated by the nucleic acid aptamer against L1CAM protein of the present invention, and transferring the CRISPR-Cas12a reaction system to L1CAM-EVs, thereby detecting biomarkers contained in L1CAM-EVs.
[0016] According to the membrane fusion detection method of the present invention, the specific steps of the method are as follows: (1)Construct a CRISPR-Cas12a reaction system: The components of the CRISPR-Cas12a reaction system include 5 μL of (FAM)-ssDNA quencher probe with a concentration of 2 μM, 2.4 μL of 10×NE Buffer r2.1, and 6 μL of dilution buffer containing 800 nM LbCas12a and 1000 nM crRNA. Subsequently, 200 nM AcrVA1 protein is added; (2)Encapsulate the CRIPSR-Cas12a reaction system with liposomes: Dissolve DOPC / DOPE / CHOL with a mass ratio of 2:1:1 in absolute ethanol with a final lipid concentration of 4 mg / mL to form a lipid mixture. Take 1 mL of the lipid mixture and perform rotary evaporation for more than 1 hour to form a dry lipid film. Add 1 mL of PBS containing the CRISPR-Cas12a reaction system, shake and rotate to detach the dry lipid film, hydrate at 40 °C for 30 minutes, then perform water bath sonication for 10 min. Then, pass through polycarbonate membranes with pore sizes of 400 nm and 100 nm respectively to make the liposome particle size uniform, remove the free CRISPR system that has not been encapsulated into liposomes, and replenish the ultrafiltered liquid to ensure the concentration of liposomes, obtaining the liposome-encapsulated CRISPR-Cas12a reaction system Lipo-CRISPR; (3)Modify the surface of liposomes with aptamers: Use 100 μL of Lipo-CRIPSR with a concentration of 1 nM, add 2 μL of aptamer with a concentration of 20 μM, and incubate at 25 °C to obtain the aptamer-modified liposome-encapsulated CRISPR-Cas12a reaction system Apt-lipo-CRISPR; (4)Extract L1CAM-EVs: Centrifuge the plasma sample at 2000×g for 20 minutes at room temperature to remove cells and debris. Transfer the required volume of clarified plasma to a new tube, add 0.5 times the volume of 1×PBS, and vortex the sample to mix well with PBS. Add 0.2 times the volume of exosome precipitation reagent to the sample, let it stand at room temperature for 10 min, then centrifuge the sample at 10000×g for 5 minutes at room temperature. Subsequently, aspirate and remove the supernatant, and resuspend with PBS.
[0017] (4)Aptamer-mediated liposome-extracellular vesicle membrane fusion: Use 100 μL of the aptamer-modified liposome-encapsulated CRISPR-Cas12a reaction system Apt-lipo-CRISPR with a concentration of 1 nM to mediate membrane fusion with 100 μL of L1CAM-EVs with a concentration of 1 nM, and detect the fluorescence change by using an enzyme-linked immunosorbent assay (ELISA) reader.
[0018] The present invention realizes the in-situ detection of Aβ42 protein in L1CAM-EVs by nucleic acid aptamer-mediated selective fusion. The nucleic acid aptamer is easily inserted into the liposome surface through the -Chol modified lipid tail. Through the co-extrusion method, the CRISPR system is combined with the liposome to report the presence of a specific target Aβ42 protein, forming an aptamer liposome containing the CRISPR sensing element (Apt-Lipo-CRISPR). The Apt-Fusion (nucleic acid aptamer fusion) strategy is similar to the natural vesicle transport process mediated by the SNARE complex (Soluble NSF Attachment Protein Receptor complex): the nucleic acid aptamer inserted into the liposome surface mimics vesicle-SNARE, while the biomarker expressed on L1CAM-EVs mimics target-SNARE. First, the nucleic acid aptamer on Apt-Lipo-CRISPR specifically recognizes the target marker overexpressed on the EV membrane. Subsequently, due to the lateral fluidity of the EV / liposome membrane interface, a series of "aptamer-target" complexes are formed at the binding site, forming a "SNARE complex". Then, the formation of the "SNARE complex" drives the fusion between the liposome and the target EV, resulting in the mixing of the contents of the two vesicles. Finally, the encapsulated CRISPR system hybridizes with the target Aβ42 protein, generating a significant fluorescence signal, which can be quantitatively analyzed by flow cytometry / microplate reader due to the enhancement of the CRISPR fluorescence signal and the increase in vesicle size. Apt-Lipo-CRISPR randomly collides with non-target EVs based on Brownian motion, but they may separate because the binding force is not sufficient to resist the impact force. In summary, the Apt-Fusion strategy provides a method for the fusion of specifically targeted EVs and the in-situ detection of single EVs protein without rupture, enabling the rapid and efficient detection of target proteins in L1CAM-EVs.
[0019] Compared with the prior art, the present invention has the following beneficial effects: (1) It provides a modified and extended nucleic acid aptamer targeting L1CAM, which can effectively avoid the interference of non-specific EVs, thus significantly improving the specificity of biomarker detection in plasma L1CAM-EVs; (2) The CRIPSR system is used for the detection of biomarkers in L1CAM-EVs, which can effectively improve the detection performance; (3) The constructed nucleic acid aptamer-mediated membrane fusion method can quickly and accurately detect the Aβ42 protein in L1CAM-EVs in plasma in-situ and precisely quantify the biomarkers in L1CAM-EVs. Description of the Drawings
[0020] Figure 1Schematic diagram of the secondary structure of the specific nucleic acid aptamer of the present invention.
[0021] Figure 2 Molecular structure model diagram of the determinant sequence of the specific nucleic acid aptamer of the present invention.
[0022] Figure 3 Molecular docking diagram of the specific nucleic acid aptamer of the present invention and L1CAM protein.
[0023] Figure 4 Affinity curves (A) and kinetic curves (B) of 7 samples with different concentrations in the SPR experiment of the present invention.
[0024] Figure 5 Schematic diagram of the membrane fusion method mediated by the specific nucleic acid aptamer of the present invention.
[0025] Figure 6 Transmission electron microscopy verification of the results of liposome-extracellular vesicle fusion mediated by the specific nucleic acid aptamer of the present invention.
[0026] Figure 7 FRET fluorescence energy resonance transfer verification of the results of liposome-extracellular vesicle fusion mediated by the specific nucleic acid aptamer of the present invention.
[0027] Figure 8 Linear standard curve constructed by the membrane fusion method mediated by the specific nucleic acid aptamer of the present invention.
[0028] Figure 9 Specific experimental results of different extracellular vesicles and their mixtures (L1CAM-EVs, PC-3, MHCC97-H, and A549). Detailed implementation manners
[0029] To better illustrate the technical objectives, technical solutions, and advantages of the present invention, the following further illustrates the present invention in conjunction with the accompanying drawings and specific embodiments. It should be understood that the following embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.
[0030] Unless otherwise specified, the reagents and instruments used in the embodiments of the present invention are reagents and instruments well known to those skilled in the art and can be obtained through commercial channels.
[0031] The blood collection source is the Department of Laboratory Medicine of Guangdong Provincial Hospital of Traditional Chinese Medicine. The remaining specimens after inspection of patients and healthy physical examination subjects are used, and the implementation of the project is approved by the Ethics Committee of Guangdong Provincial Hospital of Traditional Chinese Medicine (Ethics number: ZE2022-331-01).
[0032] 1. Modification and synthesis of L1CAM-specific nucleic acid aptamer DNA that specifically binds to the L1CAM protein with strong affinity, whose base sequence and secondary structure are as Figure 1 shown, and the secondary structure of this nucleic acid aptamer forms a stem-loop to recognize the L1CAM protein.
[0033] Table 1. Determinant sequences of nucleic acid aptamers
[0034] On the basis of maintaining the above determinant sequences (as shown in Table 1, and its molecular structure model diagram is as Figure 2 shown), in order to improve the stability of the nucleic acid aptamer, a certain number of thymidine deoxynucleotides (TTTTTTTTT) are added to its 5'-end. On this basis, the nucleic acid aptamer is synthesized. In order to enable the nucleic acid aptamer to be modified on the surface of EVs, -chol modification (5'-cholesterol modification) annealing is carried out at the 5'-end.
[0035] The complete nucleotide sequence (5' to 3') of the modified L1CAM-specific nucleic acid aptamer (Apt-12) is as follows: Chol-TTTTTTTTTAGGATAGGGGGTAGCTCGGTCGTGTTTTTGGGTTGTTTGGTGGGTCTTCTG (SEQ ID NO. 2).
[0036] The modified L1CAM-specific nucleic acid aptamer was synthesized by Shanghai Sangon Biotech Co., Ltd.
[0037] 2. Affinity test of L1CAM protein and nucleic acid aptamer 2.1 Experimental reagents (1) Preparation of a 100 μM solution of the modified L1CAM-specific nucleic acid aptamer Apt-12: Centrifuge (at a speed of 3000 r / min) the primer tube containing 2 OD of the nucleic acid aptamer Apt-12 for several seconds to make it aggregate at the bottom of the tube. Carefully open the tube cap, then add 11.8 μL of TE buffer for dilution, cover the tube cap, and vortex and mix well to fully dissolve.
[0038] In the TE buffer, the concentration of Tris-HCl is 10 mM, the concentration of EDTA is 1 mM, and the pH is 8.0.
[0039] The preparation steps of the TE buffer are as follows: Pipette 500 μL of Tris-HCl (1 M, pH = 8.0), 100 μL of EDTA (0.5 M, pH = 8.0), add ultrapure water to a constant volume of 50 mL, then sterilize by autoclaving and store at room temperature.
[0040] 1 OD 260nm=50 μg / mL double-stranded DNA = 30 μg / mL single-stranded DNA = 40 μg / mL RNA = 20 μg / mL oligonucleotide.
[0041] Internationally, it is stipulated that 1 OD of primer dry powder ≈ 33 μg (valid when T, C, G, and A each account for 25%). In this experiment, it is defaulted to calculate according to the international stipulation with 1 OD = 33 μg. Each tube contains 1 OD = 33 μg. Since a 2 OD centrifuge tube is used to dispense the primer dry powder, the mass of the L1CAM aptamer is 66 μg. The molar mass of the modified L1CAM aptamer is 18701.08. According to the formula n (amount of substance) = m (mass of substance) / M (molar mass), n = m / M = 66 μg / 18701.08 = 3.529 nmol. To achieve a target concentration of 100 μM, 3.529 nmol = 3.529×10 −9 mol, 100 μM = 100×10 −6 mol / L, V (volume) = n (amount of substance) / c (concentration), so V = n / c = 3.529×10 −9 / 100×10 −6 = 3.529×10 −5 L = 35.29 μL. Therefore, 35.29 μL of TE buffer is added to obtain a 100 μM aptamer solution.
[0042] (2)L1CAM protein (CD171): L1CAM protein, Human (HEK293, His) (MCE, catalog number HY-P74791), 1 mg / mL.
[0043] 2.2 Molecular Docking of Specific Nucleic Acid Aptamer and L1CAM Protein As Figure 3 shown, the docking of the L1CAM protein - nucleic acid aptamer Apt-12 was performed using the HDOCK software through a global docking program based on the fast Fourier transform (FFT). The rotational sampling used an angular interval of 15°, and the translational ligand search based on FFT used an interval of 1.2 Å. The results of this molecular docking showed an energy score of -300.21 kcal / mol. 2.3 SPR (Surface Plasmon Resonance) Experimental Procedure Instrument: Cytiva Biacore TM S200. Operate according to the instructions of the instrument manual.
[0044] In this experiment, the fluorescent molecule was 1 mg / mL L1CAM protein, and the ligand molecule was a 100 μM aptamer Apt-12 solution.
[0045] The experimental steps are as follows: (1) First, dilute the L1CAM protein solution to 100 μg / mL with 10 mM sodium acetate (pH 4.0 - 5.5) buffer, and then couple it to the Biacore CM5 chip. Set the flow rate to 50 μL / min and the coupling time to 10 min. The protein dissolution matrix does not affect the experimental results as long as the protein remains active.
[0046] (2) Dilute the aptamer stock solution to a 1 μM working solution, and then perform serial dilution. The aptamer can be first dissolved in PBS to a 10 μM stock solution, and then, according to the solubility, a certain concentration ratio of DMSO can be selectively added, generally with the DMSO ratio not exceeding 5%.
[0047] (3) Subsequently, prepare a calibration curve according to the concentration ratio of the organic reagent in the small molecule solution added.
[0048] (4) Set the program and perform the detection on the machine.
[0049] Buffer: 5% (v / v) acetonitrile + PBS.
[0050] 2.4 SPR experimental results To evaluate the binding affinity between the aptamer of the present invention and L1CAM protein, surface plasmon resonance (SPR) was performed. The SPR experimental results are as Figure 4 shown, which show the affinity curves (A) and kinetic curves (B) of 7 different concentration samples. The results indicate that the aptamer Apt-12 has a good affinity with L1CAM protein. The comparative experimental results show that the aptamer with only the determinant sequence (SEQ ID NO. 1) without any modification has a lower affinity with L1CAM protein than the specific aptamer Apt-12 provided by the present invention.
[0051] 3. Construction of the aptamer-mediated membrane fusion method 3.1 Detection principle of the CRISPR-Cas12a reaction system An aptamer (APT-42) with good affinity for Aβ42O protein was screened out from the literature. Subsequently, a single-stranded DNA (ACT-42) complementary to APT-42 was designed according to its sequence. The APT-42 strand and the ACT-42 strand were annealed to form a double-stranded DNA base (APT-ACT). When APT-ACT recognizes Aβ42O protein, the ACT strand is released, triggering the CRISPR-Cas12a system (Cas12a / CrRNA / AcrVA1) to promote its cleavage of the probe (ssDNA-FQ) and achieve fluorescence signal amplification. To inhibit the non-specific cleavage of Cas12a enzyme, AcrVA1 protein was introduced into the CRISPR-Cas12a system in this paper. AcrVA1 can effectively inhibit Cas12a from recognizing double-stranded DNA (APT-ACT), thus only allowing it to recognize single-stranded DNA (ACT). The specific experimental schematic diagram is shown by Figure 5 as follows.
[0052] 3.2 Construction of CRISPR-Cas12a reaction system The CRISPR-Cas12a reaction system includes the following components: 5 μL of (FAM)-ssDNA quencher probe (ssDNA FQ) (2 μM), 2.4 μL of 10×NE Buffer r2.1, 6 μL of dilution buffer (50 mM Tris-HCl, 100 mM NaCl, 10 mM MgCl3, 1 mM DTT, 0.1 mg / mL BSA) containing LbCas12a (800 nM) and crRNA (1000 nM), and 10 μL of APT-ACT (2 μM) double-stranded DNA. Subsequently, 5 μL of (200 nM) AcrVA1 protein was added. Mixing the above components can construct the CRISPR-Cas12a reaction system.
[0053] The primer sequences here are respectively:
[0054] 3.3 Liposome encapsulation of CRISPR-Cas12a reaction system Dissolve DOPC (1,2-dioleoyl-sn-glycero-3-phosphocholine) / DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine) / CHOL (cholesterol) (mass ratio 2:1:1) in absolute ethanol, with the final concentration of total lipids being 4 mg / mL. Take 1 mL of the lipid mixture and place it in a 25 mL rotary flask for rotary evaporation for more than 1 hour to form a dry lipid film. Slowly add the above CRISPR-Cas12a reaction system to 1 mL of PBS (containing the CRISPR-Cas12a reaction system), shake the rotary flask to detach the dry lipid film, hydrate it at 40 °C for 30 minutes, and then place the rotary flask in a beaker and perform ultrasonic bath for 10 min. Use a liposome extruder to make the liposome particle size uniform through polycarbonate membranes with pore sizes of 400 nm and 100 nm respectively. Use a 30 k ultrafiltration tube to remove the free CRISPR-Cas12a reaction system that has not been encapsulated into liposomes. Centrifuge at 10,000 RPM for 10 min, and make up the liquid filtered by ultrafiltration with PBS to ensure that the concentration of liposomes remains unchanged, and then dilute it to a concentration of 1 nM. Thus, the liposome-encapsulated CRISPR-Cas12a reaction system Lipo-CRISPR is obtained.
[0055] 3.4 Surface modification of liposomes with aptamers Add the modified specific aptamer Apt-12 (20 μM, 2 μL) of the present invention to Lipo-CRIPSR (1 nM, 100 μL), and incubate at 25 °C for 1 h to obtain the aptamer-modified liposome-encapsulated CRISPR-Cas12a reaction system Apt-lipo-CRISPR.
[0056] 3.5 Extraction of L1CAM-EVs Use a plasma exosome extraction kit (Invitrogen, catalog number 4484450) to extract total plasma exosomes, and use a CD171 antibody (Invitrogen, catalog number 13-1719-82) to extract L1CAM-EVs.
[0057] Subsequently, perform nanoparticle tracking analysis (NTA) to detect the concentration of the extracted L1CAM-EVs.
[0058] 3.6 Aptamer-mediated liposome-extracellular vesicle membrane fusion Use the aptamer-modified liposome-encapsulated CRISPR-Cas12a reaction system Apt-lipo-CRISPR (1 nM, 100 μL) to mediate membrane fusion with (1 nM, 100 μL) L1CAM-EVs, and detect the fluorescence change by using an enzyme-linked immunosorbent assay reader.
[0059] 4. Performance evaluation and clinical application of the membrane fusion detection method mediated by specific aptamers 4.1 Membrane fusion detection method mediated by specific nucleic acid aptamers In the present invention, molecular docking was used to verify the affinity between L1CAM protein and DNA nucleic acid aptamers, and surface plasmon resonance (SPR) was used to verify the affinity activity. In addition, according to the Apt-Fusion strategy of the present invention, nucleic acid aptamers were inserted into the surface of liposomes to simulate vesicle-SNARE, specifically recognizing biomarkers in L1CAM-EVs. The nucleic acid aptamers bind to the target to form a "SNARE complex", driving the fusion of liposomes and EVs and mixing the vesicle contents. Finally, the CRISPR system detects biomarkers (such as Aβ42 protein) and generates a fluorescence signal. By detecting the intensity of the fluorescence signal, rapid and non-disruptive in-situ detection of biomarkers can be achieved. The schematic flow diagram of the membrane fusion detection method is as Figure 5 shown.
[0060] 4.2 Characterization of the membrane fusion detection method mediated by specific nucleic acid aptamers In the present invention, a variety of characterization methods were used to verify the effectiveness and specificity of the Apt-Fusion strategy.
[0061] Transmission electron microscopy (TEM) observation showed the morphological changes of the vesicles after fusion, and the results are as Figure 6 shown. It can be seen from the figure that the liposomes and vesicles were successfully fused.
[0062] Fluorescence resonance energy transfer (FRET) was used to monitor the change in fluorescence intensity during the fusion process, and the results are as Figure 7 shown. It can be seen from the figure that in this experiment, we used DiO fluorescent dye (green fluorescence, emission peak ≈ 501 nm) to label aptamer-modified liposomes, and DiL dye (red fluorescence, emission peak ≈ 600 nm) to label L1CAM-EVs. Through real-time monitoring, it was found that during the fusion of liposomes and L1CAM-EVs, the fluorescence intensity at 500 nm increased significantly, while the fluorescence intensity at 600 nm gradually decreased. This phenomenon conforms to the typical characteristics of fluorescence resonance energy transfer (FRET), indicating that the two membrane structures are physically close due to the specific binding mediated by aptamers, resulting in an increase in the energy transfer efficiency between DiO (donor) and DiL (acceptor), thus confirming the successful fusion of aptamer-guided liposomes-L1CAM-EVs. The experimental results show that the Apt-Fusion strategy can efficiently and specifically detect Aβ42 in L1CAM-EVs.
[0063] 4.3 Performance evaluation of the membrane fusion method mediated by nucleic acid aptamers To verify the quantitative detection of the membrane fusion method mediated by nucleic acid aptamers, a standard curve was established for the extracted L1CAM-EVs, and the concentration of L1CAM-EVs ranged from 2.1×10 3particles / mL to 2.1×10 8 particles / mL. The results showed that as the concentration of L1CAM-EVs increased, the fluorescence value also increased. The change in fluorescence intensity was linearly related to the concentration of L1CAM-EVs ( Figure 8 ), and the relationship equation satisfied Y = 0.229lg [EVs] + 0.376 (R 2 = 0.9942).
[0064] To further evaluate the selectivity of the aptamer-mediated membrane fusion method, EVs derived from PC-3, MHCC97-H, and A549 cells were selected to evaluate the selectivity of the specific aptamer-mediated membrane fusion method. As Figure 9 shown, when L1CAM-EVs were present in the test sample (pure L1CAM-EVs or a mixture containing L1CAM-EVs), the fluorescence value increased, while when other cell-derived extracellular vesicles were used as analytes, the fluorescence value did not change significantly. The results indicated that the specific aptamer-mediated membrane fusion method of the present invention had high specificity for L1CAM-EVs, which might be related to the high specificity of the aptamer for L1CAM protein.
[0065] 4.4 Quantitative detection of L1CAM-EVs in human plasma using the aptamer-mediated membrane fusion method The Apt-Fusion method of the present invention was applied to quantitatively detect L1CAM-EVs in human plasma in clinical samples. Methodological studies were conducted using previously collected samples. The samples were plasma specimens from 23 Alzheimer's disease patients who visited the Guangdong Provincial Hospital of Traditional Chinese Medicine from August 2023 to April 2024. Among them, there were 13 males and 10 females; the male-female ratio was 2:1, and the average age was 77 years. All patients met the diagnostic criteria for Alzheimer's disease. Twenty-three normal elderly controls were collected from physical examination patients. Plasma was separated from fasting venous blood for all samples and stored at -80°C. This study was approved by the Ethics Committee of the Guangdong Provincial Hospital of Traditional Chinese Medicine (Ethical number: ZE2022-206).
[0066] The experimental results showed that the proportion of Aβ42 in L1CAM-EVs increased in elderly AD patients. The proportion of Aβ42 in L1CAM-EVs in the AD group was higher than that in the normal control group, P < 0.05. The differences in protein content and fluorescence intensity between the two groups were statistically significant, P < 0.05. In the AD group, the sensitivity of this method was good, and the lowest detection limit could reach 1 pg / mL. It can be seen that the method of the present invention can effectively distinguish AD patients from healthy subjects, demonstrating its potential as a clinical diagnostic tool.
[0067] The present invention discloses a nucleic acid aptamer-mediated membrane fusion technology, and provides a detection strategy for detecting biomarkers contained in L1CAM type extracellular vesicles (L1CAM-EVs). The high affinity between L1CAM protein and DNA nucleic acid aptamer was verified by molecular docking, and its affinity activity was further confirmed by surface plasmon resonance (SPR) technology. Using the CRISPR / Cas12a system as the core detection component, the CRISPR sensing element (including LbsCas12a, crRNA and FQ probe) was encapsulated in liposomes, and through the nucleic acid aptamer-mediated extracellular vesicle-liposome membrane fusion technology, the detection component was efficiently delivered into the interior of L1CAM-EVs to achieve in-situ detection of target biomarkers. The significant advantage of this method is that the detection can be completed without breaking EVs, thus effectively avoiding the loss or degradation of biomarkers. After in vitro verification and parameter optimization, this method was successfully applied to the detection of L1CAM-EVs in Alzheimer's disease (AD) patients and normal controls, and quantitative analysis of Aβ42 oligomers (Aβ42) was performed. In addition, this method has the potential to detect multiple biomarkers in intact EVs.
[0068] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.
Claims
1. An aptamer, characterized in that, The nucleic acid aptamer is a single-stranded DNA probe containing the nucleotide sequence shown in SEQ ID NO. 2 and having a -Chol modification at the 5' end.
2. Use of the nucleic acid aptamer according to claim 1 in the preparation of a reagent for detecting the L1CAM-EVs biomarker.
3. The application according to claim 2, wherein The biomarker is the Aβ42 protein.
4. Use of the nucleic acid aptamer according to claim 1 in the preparation of a reagent for recognizing and / or binding to L1CAM.
5. Use of the nucleic acid aptamer according to claim 1 in the preparation of a reagent for recognizing and / or binding to L1CAM-EVs.
6. Use of the nucleic acid aptamer according to claim 1 in the preparation of a reagent for diagnosing Alzheimer's disease.
7. A method for detecting biomarkers contained in extracellular vesicles using aptamer-mediated membrane fusion, characterized in that, The method includes: fusing extracellular vesicles mediated by the nucleic acid aptamer according to claim 1 with liposomes to deliver the CRISPR-Cas12a reaction system to L1CAM-EVs, thereby detecting the biomarker contained in L1CAM-EVs.
8. The method according to claim 7, characterized in that, The specific steps of the method are as follows: (1) Construct the CRISPR-Cas12a reaction system: The components of the CRISPR-Cas12a reaction system include 5 μL of a (FAM)-ssDNA quencher probe with a concentration of 2 μM, 2.4 μL of 10×NE Buffer r2.1, and 6 μL of a dilution buffer containing 800 nM LbCas12a and 1000 nM crRNA, and then 200 nM AcrVA1 protein is added; (2) Wrap the CRIPSR-Cas12a reaction system with liposomes: Dissolve DOPC / DOPE / CHOL with a mass ratio of 2:1:1 in absolute ethanol with a final lipid concentration of 4 mg / mL to form a lipid mixture. Take 1 mL of the lipid mixture and rotary evaporate it for more than 1 hour to form a dry lipid film. Add 1 mL of PBS containing the CRISPR-Cas12a reaction system, shake and rotate to shed the dry lipid film, hydrate at 40 °C for 30 minutes, then perform bath sonication for 10 min, and then pass through polycarbonate membranes with pore sizes of 400 nm and 100 nm respectively to make the liposome particle size uniform, remove the free CRISPR system that has not been encapsulated into liposomes, and make up the liquid filtered by ultrafiltration to ensure the concentration of liposomes, obtaining the liposome-encapsulated CRISPR-Cas12a reaction system Lipo-CRISPR; (3) Modify the nucleic acid aptamer on the liposome surface: Use 100 μL of Lipo-CRIPSR with a concentration of 1 nM, add 2 μL of the nucleic acid aptamer with a concentration of 20 μM, and incubate at 25 °C to obtain the nucleic acid aptamer-modified liposome-encapsulated CRISPR-Cas12a reaction system Apt-lipo-CRISPR; (4)Extract L1CAM-EVs: Centrifuge the plasma sample at 2000×g for 20 minutes at room temperature to remove cells and debris. Transfer the required volume of clarified plasma to a new tube, add 0.5 volume of 1× PBS, and vortex the sample to mix well with PBS. Add 0.2 volume of exosome precipitation reagent to the sample. After standing at room temperature for 10 min, centrifuge the sample at 10,000×g for 5 minutes at room temperature. Subsequently, aspirate and remove the supernatant, and resuspend with PBS. (4)Aptamer-mediated liposome-extracellular vesicle membrane fusion: Use 100 μL of Apt-lipo-CRISPR, a CRISPR-Cas12a reaction system encapsulated by liposomes modified with nucleic acid aptamers at a concentration of 1 nM, to mediate membrane fusion with 100 μL of L1CAM-EVs at a concentration of 1 nM. Detect the fluorescence change by using an enzyme-linked immunosorbent assay (ELISA) reader.
Citation Information
Patent Citations
Application research for aptamer recognition, CD171 and related functions
CN109913462A
Aptamer and use thereof for recognizing and binding to CD171
WO2019114675A1