Application of miRNA marker in diagnosis and identification of tuberculosis
By detecting the combination of miR-93-5p, miR-200c-3p, miR-140-5p and miR-17-5p in serum, the problem of low accuracy in early diagnosis of tuberculosis was solved, and a high sensitivity and high specificity of tuberculosis diagnosis was achieved, reducing the risk of missed diagnosis.
Patent Information
- Application Number
- CN202510416442.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-03
- Publication Date
- 2025-07-08
AI Technical Summary
In the prior art, the early diagnosis of pulmonary tuberculosis is not high, the sensitivity and specificity of existing miRNA markers are insufficient, and the stability of peripheral blood detection is poor, resulting in a high risk of missed diagnosis.
The combination of four miRNA markers, miR-93-5p, miR-200c-3p, miR-140-5p and miR-17-5p, is used to detect the expression of these miRNAs in serum through fluorescent dyes, probes or chip technology, and combine fluorescence quantitative PCR technology to achieve early diagnosis of tuberculosis.
It improves the accuracy of early diagnosis of tuberculosis, with AUC value as high as 0.996, sensitivity 100%, specificity 93.3%, simple and easy to perform, non-invasive testing, reducing the risk of missed diagnosis.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] The present invention relates to the field of pharmaceutical technology, and particularly relates to the application of miRNA markers in the diagnosis and differentiation of tuberculosis. Background Art
[0002] Tuberculosis is an infectious disease under key control by the WHO. The diagnosis of pulmonary tuberculosis (PTB) is very important for treatment and preventing continuous transmission. When PTB occurs, PTB patients can act as active sources of infection to disseminate pathogenic bacteria, continuously expanding the number of infected people. Therefore, the differential diagnosis of PTB is particularly important.
[0003] MicroRNA (abbreviated as miRNA) is a non-coding single-stranded RNA molecule about 18-22 nt in length, which participates in the regulation of post-transcriptional gene expression. It mainly realizes the degradation or translation inhibition of target gene mRNA by complementary pairing and binding of its own "seed sequence" with the 3'UTR region of target gene mRNA.
[0004] Currently, there are already miRNA tuberculosis detection kit products. For example, the prior art CN115505635A relates to a miRNA marker and a kit for the diagnosis and differentiation of tuberculosis. The miRNA is any one or any combination of the following 3 miRNAs, and the names and sequences are shown as follows: miR-342-3p, which is the sequence of SEQ ID NO:1; miR-199a-3p, which is the sequence of SEQ ID NO:2; miR-199b-3p, which is the sequence of SEQ ID NO:3. This invention discovers that the expression composition of peripheral blood miR-342-3p and miR-199a / b-3p serves as an important diagnostic marker, providing a new direction for the hematological diagnosis of tuberculosis at the molecular level. However, the clinical specimen database of this patent only has 7 specimens, and the sample size is relatively small. In addition, the sensitivity of its miRNA combination is 88.30%, the specificity is 89.23%, and the prediction accuracy rate is 86.70%, and its accuracy is still relatively low. In addition, its detection object is peripheral blood plasma, and the cells in it are active and are prone to metabolic changes, cell rupture, etc. in vitro, resulting in unstable detection indicators. Summary of the Invention
[0005] The purpose of the present invention is to provide the application of miRNA markers in the diagnosis and differentiation of tuberculosis, aiming to solve the problem of low accuracy in the early diagnosis of pulmonary tuberculosis in the prior art.
[0006] To achieve the above purpose, the technical solution adopted in this application is as follows:
[0007] Use of a miRNA marker in the preparation of a reagent for diagnosing and differentiating tuberculosis, wherein the miRNA marker is 2 to 4 of the following 4 miRNAs: miR-93-5p, miR-200c-3p, miR-140-5p, miR-17-5p;
[0008] Among them, the sequence of miR-93-5p is as shown in SEQ ID NO.1; the sequence of miR-200c-3p is as shown in SEQ ID NO.2; the sequence of miR-140-5p is as shown in SEQ ID NO.3; the sequence of miR-17-5p is as shown in SEQ ID NO.4.
[0009] SEQ ID NO.1: CAAAGUGCUGUUCGUGCAGGUAG.
[0010] SEQ ID NO.2: UAAUACUGCCGGGUAAUGAUGGA.
[0011] SEQ ID NO.3: CAGUGGUUUUACCCUAUGGUAG.
[0012] SEQ ID NO.4: CAAAGUGCUUACAGUGCAGGUAG.
[0013] In one preferred embodiment, the miRNA marker is a combination of miR-200c-3p and miR-17-5p.
[0014] In one preferred embodiment, the miRNA marker is a combination of miR-200c-3p, miR-140-5p and miR-17-5p, a combination of miR-93-5p, miR-140-5p and miR-17-5p or a combination of miR-93-5p, miR-200c-3p and miR-17-5p.
[0015] In one preferred embodiment, the miRNA marker is a combination of miR-93-5p, miR-200c-3p, miR-140-5p and miR-17-5p.
[0016] Based on the same inventive concept, the present invention also claims the use of the reagent for detecting the miRNA marker in the preparation of a reagent for diagnosing and differentiating tuberculosis, wherein the miRNA marker is one or more of the following 4 miRNAs: miR-93-5p, miR-200c-3p, miR-140-5p, miR-17-5p.
[0017] In one preferred embodiment, the reagent for detecting miRNA markers includes primers, fluorescent dyes, probes or chips.
[0018] In one preferred embodiment, the primers for detecting miR-93-5p are: F: CCTCAAAGTGCTGTTCGTG (SEQ ID NO.12); R: AACGCTTCACGAATTTGCGT (SEQ ID NO.10).
[0019] In one preferred embodiment, the primers for detecting miR-200c-3p are: F: TCGCTAATACTGCCGGGTAAT (SEQ ID NO.16); R: AACGCTTCACGAATTTGCGT (SEQ ID NO.10).
[0020] In one preferred embodiment, the primers for detecting miR-140-5p are: F: TCGCTCAGTGGTTTTACCCTA (SEQ ID NO.18); R: AACGCTTCACGAATTTGCGT (SEQ ID NO.10).
[0021] In one preferred embodiment, the primers for detecting miR-17-5p are: F: GCCCAAAGTGCTTACAGTGC (SEQ ID NO.20); R: AACGCTTCACGAATTTGCGT (SEQ ID NO.10).
[0022] Based on the same inventive concept, the present invention also claims the application of the kit for detecting miRNA markers in preparing reagents for diagnosing and differentiating tuberculosis, wherein the miRNA markers are 2 to 4 of the following 4 miRNAs: miR-93-5p, miR-200c-3p, miR-140-5p, miR-17-5p; and the kit includes primers, fluorescent dyes, probes or chips for detecting miRNA markers.
[0023] In one preferred embodiment, the kit includes primers for detecting miRNA markers.
[0024] In one preferred embodiment, the kit includes primers for miR-200c-3p and miR-17-5p.
[0025] In one preferred embodiment, if the expression level of miR-200c-3p is not less than 2.312896 and the expression level of miR-17-5p is not less than 1.3586245, it is determined as a tuberculosis patient.
[0026] In one preferred embodiment, the kit includes primers as shown in SEQ ID NO.16 and SEQ ID NO.10, SEQ ID NO.20 and SEQ ID NO.10.
[0027] In one preferred embodiment, the kit includes primers for miR-200c-3p, miR-140-5p and miR-17-5p.
[0028] In one preferred embodiment, if the expression level of miR-200c-3p is not less than 2.312896, the expression level of miR-140-5p is not less than 0.744581 and the expression level of miR-17-5p is not less than 1.3586245, it is determined as a tuberculosis patient.
[0029] In one preferred embodiment, the kit includes primers as shown in SEQ ID NO.16 and SEQ ID NO.10, SEQ ID NO.18 and SEQ ID NO.10, SEQ ID NO.20 and SEQ ID NO.10.
[0030] In one preferred embodiment, the kit includes primers for miR-93-5p, miR-140-5p and miR-17-5p.
[0031] In one preferred embodiment, if the expression level of miR-93-5p is not less than 1.3123015, the expression level of miR-140-5p is not less than 0.744581 and the expression level of miR-17-5p is not less than 1.3586245, it is determined as a tuberculosis patient.
[0032] In one preferred embodiment, the kit includes primers as shown in SEQ ID NO.12 and SEQ ID NO.10, SEQ ID NO.18 and SEQ ID NO.10, SEQ ID NO.20 and SEQ ID NO.10.
[0033] In one preferred embodiment, the kit includes primers for miR-93-5p, miR-200c-3p and miR-17-5p.
[0034] In one preferred embodiment, if the expression level of miR-93-5p is not less than 1.3123015, the expression level of miR-200c-3p is not less than 2.312896 and the expression level of miR-17-5p is not less than 1.3586245, it is determined as a tuberculosis patient.
[0035] In one preferred embodiment, the kit includes primers as shown in SEQ ID NO.12 and SEQ ID NO.10, SEQ ID NO.16 and SEQ ID NO.10, SEQ ID NO.20 and SEQ ID NO.10.
[0036] In one preferred embodiment, the kit includes primers for miR-93-5p, miR-200c-3p, miR-140-5p and miR-17-5p.
[0037] In one preferred embodiment, if the expression level of miR-93-5p is not less than 1.3123015, the expression level of miR-200c-3p is not less than 2.312896, and the expression level of miR-140-5p is not less than 0.744581, it is determined that the patient has tuberculosis.
[0038] In one preferred embodiment, the kit includes primers as shown in SEQ ID NO.10 and SEQ ID NO.12, SEQ ID NO.16 and SEQ ID NO.10, SEQ ID NO.18 and SEQ ID NO.10, SEQ ID NO.20 and SEQ ID NO.10.
[0039] In one preferred embodiment, if the expression level of miR-93-5p is not less than 1.3123015, the expression level of miR-200c-3p is not less than 2.312896, the expression level of miR-140-5p is not less than 0.744581, and the expression level of miR-17-5p is not less than 1.3586245, it is determined that the patient has tuberculosis.
[0040] In one preferred embodiment, the kit further includes a serum RNA extraction solution, a reverse transcription reaction solution, a fluorescence quantitative PCR reaction solution and internal reference primers.
[0041] In one preferred embodiment, the internal reference is U6.
[0042] In one preferred embodiment, the internal reference primers are as follows: F: CTCGCTTCGGCAGCACA (SEQ ID NO.30) R: AACGCTTCACGAATTTGCGT (SEQ ID NO.10).
[0043] The present invention unexpectedly discovers that the expression combination of miR-93-5p, miR-200c-3p, miR-140-5p, and miR-17-5p in serum serves as an important diagnostic marker, providing a new direction for tuberculosis hematological diagnosis at the molecular level, and having important theoretical value and potential application value. When the present invention is used in the early diagnosis of tuberculosis, the AUC value is as high as 0.996, the sensitivity is as high as 100%, and the specificity is as high as 93.3% (95% CI = 0.9810 to 1.0000), thus efficiently achieving the early diagnosis and differentiation of tuberculosis.
[0044] The diagnostic marker of the present invention has high sensitivity and specificity, can keenly capture the subtle changes in the early stage of the disease, its sensitivity significantly exceeds the existing known markers, and greatly reduces the risk of missed diagnosis. The detection method of the present invention is simple and easy to operate, without complex operation procedures and high equipment costs, the detection time is short, and the medical efficiency is effectively improved. At the same time, the marker of the present invention is a non-invasive biomarker, only requiring the acquisition of a blood sample from the patient to isolate serum, causing little trauma to the patient, the serum components are relatively pure, and it is not easily interfered by other components during certain biochemical tests and immunoassays, and can provide more accurate detection results. Brief Description of the Drawings
[0045] Figure 1 It is the flow chart of library construction and sequencing of the present invention;
[0046] Figure 2 It is the schematic diagram of library construction of the present invention;
[0047] Figure 3 It is the bar chart of RT-qPCR verification of candidate miRNAs;
[0048] Figure 4 It is the scatter plot of the relative expression of 7 miRNAs in the serum of tuberculosis patients;
[0049] Figure 5 It is the receiver operating characteristic (ROC) curve of 4 differential miRNAs;
[0050] Figure 6 It is the ROC analysis of 2-miRNA-Panel;
[0051] Figure 7 It is the ROC analysis of 3miRNA-Panel;
[0052] Figure 8 It is the ROC analysis of 4-miRNA-Panel. Detailed Embodiments
[0053] In order to make the technical problems, technical solutions, and beneficial effects to be solved by this application clearer and more understandable, the following further elaborates on this application in combination with embodiments. It should be understood that the specific embodiments described herein are only used to explain this application and are not used to limit this application.
[0054] In the embodiments of this application, the terms "predicted value" and "threshold value" refer to the mathematical scores calculated by the SVM algorithm; the "predicted value" is the mathematical score calculated after inputting the miRNA data of the subject sample into the SVM model, with a range of 0 to 1; the "threshold value" refers to the calculation method for evaluating the classification ability of the model. In the embodiments of this application, the Youden index is used to calculate the threshold value. When the "predicted value" of the sample is greater than the "threshold value", the model determines that anti-tuberculosis treatment has been completed; when the "predicted value" of the sample is less than the "threshold value", the model determines that anti-tuberculosis treatment still needs to continue.
[0055] The term "differential expression" used in this application means that the expression level of a specific miRNA in the target sample is changed compared with that in the control sample, with statistical significance; the control sample is the sample of active pulmonary tuberculosis patients, which can be up-regulated (i.e., the miRNA Ct value decreases in the target sample) or down-regulated (i.e., the miRNA Ct value increases in the target sample). In other words, the miRNA is activated to a higher or lower level in the target sample than in the control sample.
[0056] The Ct value of this application reflects the degree to which a specific miRNA sequence is transcribed from its genomic locus.
[0057] Example 1
[0058] First, according to RT-qPCR, 4 miRNAs were preliminarily screened in the serum of tuberculosis patients: miR-93-5p, miR-200c-3p, miR-140-5p, and miR-17-5p.
[0059] The application of the above 4 markers in the early diagnosis of tuberculosis includes the following steps:
[0060] 1. Mycobacterium-infected cultured macrophages (set up an infected group and an uninfected group), collect exosomes in the culture supernatant, and extract exosomal sRNA for sequencing analysis.
[0061] 2. Screen out the differentially expressed sRNA for verification;
[0062] 2.1. Perform RT-qPCR verification on the exosomes of Mycobacterium-infected macrophages;
[0063] 2.2. Perform RT-qPCR verification on the sera of tuberculosis patients and healthy control testers.
[0064] 3. Determine 4 serum differentially expressed miRNAs (miR-93-5p, miR-200c-3p, miR-140-5p, miR-17-5p) in tuberculosis patients based on the above analysis results, and evaluate their potential in the diagnosis of tuberculosis.
[0065] 4. Further perform receiver operating characteristic (ROC) curve analysis on the screened miRNAs; finally, use multivariate logistic regression analysis in the ROC curve to determine the optimal combination of 4 miRNAs for the diagnosis of pulmonary tuberculosis.
[0066] The specific process is as follows:
[0067] 1. Cell and Mycobacterium (M. avium) culture
[0068] THP-1 cell culture: Use RPMI1640 medium (Gibco; Thermo Fisher Scientific, Inc) containing 10% fetal bovine serum, 1% penicillin and streptomycin, place it in an incubator with 5% CO2 at 37°C, and induce THP-1 cells with phorbol myristate acetate (PMA) for 48 h to obtain THP-1 macrophages for subsequent experiments. The induction method refers to the literature (The culture method refers to Shah PT, Tufail M, Wu C, Xing L. THP-1 cell line model for tuberculosis: A platform for in vitro macrophage manipulation. Tuberculosis (Edinb). 2022 Sep;136:102243. doi: 10.1016 / j.tube.2022.102243. Epub 2022 Aug 8. PMID: 35963145.).
[0069] Mycobacterium culture: Culture it in Middle Brook 7H9 medium (LA7220; Beijing Sola Biotechnology Co., Ltd) containing 0.05% Tween-80 and 10% oleic acid-albumin-glucose-catalase (OADC) under constant temperature conditions at 37°C.
[0070] 2. Exosome extraction
[0071] Use a kit (Runji Biotechnology Cell Culture Supernatant Kit, Cat#EXORNA20B-1) for exosome extraction and RNA isolation. The specific experimental steps are as follows:
[0072] 1) Sample pretreatment: For the cryopreserved THP1 macrophage culture supernatant, thaw it at room temperature or in a 25°C water bath, and place the completely melted sample on ice; for the fresh THP1 macrophage culture supernatant, collect the sample and place it on ice, then centrifuge at 3,000×g for 10 min at 4°C to remove cells or cell debris. After centrifugation, aspirate the supernatant into a new tube.
[0073] 2) Exosome binding: Aspirate 10 ml of the above-treated cell culture supernatant into a 15-ml centrifuge tube, add 1.0 ml of binding buffer C, and mix by inverting.
[0074] 3) Exosome extraction: Aspirate 400 μl of binding resin C into the 15-ml centrifuge tube in step 2, mix by inverting at room temperature for 15 min, then centrifuge at 1,500×g for 2 min at room temperature. Gently remove the centrifuge tube from the centrifuge, remove the excess supernatant but retain 400 μl of supernatant, then gently resuspend the resin and transfer it all to purification column A. Let it stand for 2 min, then centrifuge at 2,000×g for 2 min at room temperature. Discard the filtrate and place purification column A back into the collection tube.
[0075] 4) Exosome washing: Take 500 μl of washing buffer C and add it to purification column A. Let it stand for 3 min, then centrifuge at 3,000×g for 2 min at room temperature. Discard the filtrate and repeat the washing once.
[0076] 5) Exosome elution: Transfer purification column A to a low-binding protein 2-ml centrifuge tube, add 400 μl of elution buffer C, let it stand for 5 min, then centrifuge at 300×g for 2 min at room temperature. Re-add the centrifuged solution through the column, let it stand for 2 min, and finally centrifuge at 3,000×g for 2 min. The liquid in the centrifuge tube is the extracted exosome solution.
[0077] 3. Exosome RNA isolation
[0078] 1) Exosome RNA release: Measure the extracted exosome solution, add an equal volume of lysis buffer A, vortex for 30 sec, and let it stand at room temperature for 5 min to completely separate the nucleic acid-protein complexes. Centrifuge at 12,000×g for 10 min at room temperature, take the supernatant, and transfer it to a new 1.5-ml RNase-free centrifuge tube.
[0079] Add 100 μl of lysis buffer B, shake vigorously for 30 sec, let it stand at room temperature for 5 min, and centrifuge at 12,000×g for 15 min. The sample will be divided into three layers: a yellow organic phase, an intermediate layer, and a colorless aqueous phase. RNA is mainly in the aqueous phase. Transfer the aqueous phase to a new 1.5-ml RNase-free centrifuge tube for the next step.
[0080] Measure the transfer solution (aqueous phase), slowly add 1.5 times the volume of pre-cooled absolute ethanol (e.g., add 750 μl of absolute ethanol to 500 μl of the transfer solution), mix well, and let stand at room temperature for 5 min to obtain a solution and precipitate.
[0081] Transfer the obtained solution and precipitate together into adsorption column B. The volume loaded onto the column each time should not exceed 700 μl. It can be completed in multiple batches. Let stand at room temperature for 2 min, centrifuge at 8,000×g for 30 sec, discard the filtrate, and place adsorption column B back into the collection tube.
[0082] 2) Washing of exosomal RNA: Add 500 μl of washing buffer A to adsorption column B, let stand at room temperature for 2 min, centrifuge at 8,000×g for 30 sec, pour out the filtrate in the collection tube, place the adsorption column into the collection tube, and repeat the washing once. Centrifuge adsorption column B at 12,000×g for another 2 min to remove the residual liquid. Open the lid of the RNA adsorption column and let stand at room temperature for 5 - 10 min to thoroughly dry the residual washing buffer in the adsorption material.
[0083] 3) Elution of exosomal RNA: Transfer adsorption column B into a new 1.5 ml centrifuge tube, suspend and add 50 - 100 μl of elution buffer A dropwise to the middle position of the adsorption column, let stand at room temperature for 2 min, centrifuge at 12,000×g for 2 min. Add the solution obtained by centrifugation back into the adsorption column, let stand at room temperature for 2 min, centrifuge at 12,000×g for 2 min. Finally, the liquid in the centrifuge tube is the extracted exosomal RNA, which can be directly applied to downstream experiments or stored at -80 °C.
[0084] 4. Exosomal sRNA sequencing (sent to Novogene for sequencing analysis)
[0085] The flow chart of library construction and sequencing is as Figure 1 shown. Specifically, it includes the following steps:
[0086] 4.1 Total RNA sample detection
[0087] Use a high-sensitivity Agilent 2100 pic600 to accurately detect the total amount and fragment distribution of RNA in exosome-like samples.
[0088] 4.2 Library construction
[0089] After the sample detection is qualified, use the Small RNA Sample Pre Kit to construct a library. Utilize the special structures at the 3' and 5' ends of Small RNA (a complete phosphate group at the 5' end and a hydroxyl group at the 3' end), start with total RNA as the sample, directly add adapters to both ends of Small RNA, and then reverse transcribe to synthesize cDNA. Subsequently, through PCR amplification, PAGE gel electrophoresis is used to separate the target DNA fragments, and the cDNA library is obtained by cutting and recovering the gel. The schematic diagram of the construction principle is asFigure 2 as shown
[0090] 4.3 Library inspection
[0091] After the library construction is completed, first use Qubit 2.0 for preliminary quantification, dilute the library to 1 ng / ul, and then use the high-sensitivity Agilent 2100 to detect the insert size of the library. After the insert size meets the expectations, use the Q-PCR method to accurately quantify the effective concentration of the library (the effective concentration of the library > 2 nM) to ensure the library quality.
[0092] 4.4 Sequencing on the machine
[0093] After the library inspection is qualified, pool different libraries according to the requirements of the effective concentration and the target output data volume and then perform Illumina SE50 sequencing. The method of sequencing by synthesis is adopted. Add DNA polymerase, adapter primers and 4 types of dNTPs with base-specific fluorescent labels (similar to the Sanger sequencing method) to the reaction system at the same time. The 3'-OH of these dNTPs is protected chemically, so only one dNTP can be added each time. After the dNTP is added to the synthesized strand, all unused free dNTPs and DNA polymerase will be washed away. Then, add the buffer required to excite the fluorescence, excite the fluorescence signal with a laser, and record the fluorescence signal with optical equipment. Finally, use a computer to analyze and convert the optical signal into sequencing bases. After the fluorescence signal recording is completed in this way, add chemical reagents to quench the fluorescence signal and remove the dNTP 3'-OH protecting group to enable the next round of sequencing reaction. The characteristic of adding only one dNTP each time in Illumina's sequencing technology can well solve the problem of accurately measuring the length of homopolymers.
[0094] 4.5 Screening of differential sRNA
[0095] Common differential expression analysis methods include DESeq, DESeq2, edgeR, limma, etc. These tools are based on different statistical models and algorithms and can be selected according to the data characteristics and research needs. For example, DESeq2 is suitable for experimental designs with biological replicates and can effectively handle problems such as data discreteness and unequal variances. Set thresholds for differential expression such as the fold change (FoldChange) and significance levels (such as P-value, FDR, etc.) to screen for differentially expressed miRNAs. Usually, FoldChange > 2 and P-value < 0.05 or FDR < 0.05 are considered to be miRNAs with significant differential expression, but the specific thresholds can be appropriately adjusted according to the research purpose and data situation. Input the expression data into the selected analysis tool and perform differential expression analysis according to the set thresholds to obtain a list of differentially expressed miRNAs and their related statistical information. Here, we selected miRNAs with an average fold change ≥ 1.5 or ≤ 0.50 and P-value < 0.01 in exosomal miRNA-seq for further analysis.
[0096] The results are as follows: The up- or down-regulation relationships of miRNA expression levels in exosomes are shown in Table 1.
[0097] Table 1 Information and expression levels of 9 differentially expressed miRNAs
[0098]
[0099] The mature sequences were obtained from miRBase. In RNA-seq data analysis, the sequencing reads were aligned and counted, and then after normalization, methods such as TPM (transcripts per million transcripts) were used for normalization to eliminate the effects of experimental errors and differences between samples and obtain an accurate numerical representation for calculating the fold change. The fold change values of different miRNAs compared to the control group were obtained. Among them, miRNAs with a fold change value ≥ 1.5 and P-value < 0.01 in miRNA-seq were determined to be up-regulated miRNAs; miRNAs with a fold change value ≤ 0.50 and P-value < 0.01 were determined to be down-regulated miRNAs.
[0100] 5. Isolation and extraction of serum miRNAs
[0101] Use Runji Biotechnology Serum / Plasma miRNA Isolation Kit (Cat#SPmiR50A-1). The specific experimental steps are as follows:
[0102] (1) RNA release and isolation:
[0103] 1) Sample pretreatment: Take 200 μl of serum sample from -80°C and thaw it at room temperature on ice, centrifuge at 12,000×g for 20 min to remove cell debris.
[0104] 2) Pipette 200 μl of the supernatant from step 1) into a 2.0 ml centrifuge tube. Add an equal volume (200 μl) of lysis buffer A, vortex for 30 s, and incubate at room temperature for 5 min to completely separate the nucleic acid-protein complexes.
[0105] 3) Centrifuge at 12,000 × g for 10 min at room temperature. Transfer the supernatant to a new RNase-free centrifuge tube.
[0106] 4) Add 100 μl of lysis buffer B, cap the tube, and vortex vigorously for 15 s. Incubate at room temperature for 5 min. Centrifuge at 12,000 × g for 15 min at room temperature. The sample will separate into three layers. RNA is mainly in the colorless aqueous phase. Transfer the aqueous phase to a new tube.
[0107] 5) Measure the transferred liquid and slowly add an amount of absolute ethanol equal to 1 / 3 of the volume of the transferred liquid. Mix well.
[0108] (2) Removal of long RNAs: Transfer the obtained solution and precipitate together into adsorption column I. Incubate at room temperature for 2 min and centrifuge at 12,000 × g for 30 s at room temperature. Discard the adsorption column after centrifugation and retain the filtrate.
[0109] (3) miRNA adsorption: Measure the filtrate and slowly add an amount of absolute ethanol equal to 2 / 3 of the volume of the filtrate. Mix well. Precipitation may occur at this time. Transfer the obtained solution and precipitate together into adsorption column II. Incubate at room temperature for 2 min and centrifuge at 12,000 × g for 30 s at room temperature. Discard the effluent after centrifugation and retain the adsorption column.
[0110] (4) miRNA washing: Add 500 μl of washing buffer A to the adsorption column and centrifuge at 12,000 × g for 30 s. Discard the waste liquid in the collection tube. Place the adsorption column at room temperature for several minutes to thoroughly dry the residual washing solution in the adsorption material.
[0111] (5) miRNA elution: Transfer the adsorption column to a 1.5 ml centrifuge tube. Pipette 50 - 200 μl of elution buffer A onto the middle of the adsorption column in a suspended manner. Incubate at room temperature for 2 - 5 min and centrifuge at 12,000 × g for 2 min. Collect the solution in the centrifuge tube. The volume of the elution buffer should not be less than 50 μl, as a too small volume will affect the recovery efficiency. To increase the RNA yield, the solution obtained by centrifugation can be added back to the adsorption column, incubated at room temperature for 2 min, and centrifuged at 12,000 × g for 2 min. The pH of the elution buffer has a great impact on the elution efficiency. If water is used as the elution buffer, the pH value should be ensured to be in the range of 7.0 - 8.5. A pH value lower than 7.0 will reduce the elution efficiency, and the RNA product should preferably be used immediately or stored at -80 °C to prevent RNA degradation.
[0112] 6. Detect the quality of the RNA obtained above
[0113] (1) Concentration and total amount of RNA: The concentration was accurately quantified by Qubit;
[0114] (2) Purity of RNA: The ratios of OD260 / 280 and 260 / 230 were detected by Nanodrop;
[0115] (3) Integrity of RNA: The degradation degree of RNA was detected by agarose gel electrophoresis and Agilent 2100 Bioanalyzer; The total amount of RNA samples was between 1 - 100 ng, and the ratio of 260 / 280 was between 1.8 - 2.0.
[0116] 7. Reverse transcription
[0117] According to the protocol of Vazyme manufacturer, cDNA was synthesized using the miRNA First Strand cDNA Synthesis Kit. The reverse transcription reaction was carried out using the T100TM Thermal Cycler Detection System, and the reaction system was as follows:
[0118] Table 2 miRNA cDNA First Strand Synthesis
[0119]
[0120] After gently mixing, the following reverse transcription reaction was carried out. The reverse transcription reaction program is shown in Table 3:
[0121] Table 3 Reaction Program Settings
[0122]
[0123] Template cDNA was obtained.
[0124] 8. Quantitative PCR (qPCR)
[0125] According to the protocol of Vazyme manufacturer, the levels of miRNA and U6 small nuclear RNA (U6 snRNA) were detected using miRNA Universal SYBR qPCR Master Mix. The qPCR reaction system is shown in Table 4, and the PCR program parameter settings are shown in Table 5. The relative expression levels were calculated using the 2 -ΔΔCt method. The test results were normalized with nuclear U6 snRNA. -ΔΔCq The relative expression levels were calculated using the 2 -ΔΔCt method. The test results were normalized with nuclear U6 snRNA.
[0126] Table 4 qPCR Reaction System
[0127]
[0128] Table 5 qPCR Program Parameter Settings
[0129]
[0130] Primer design: The qPCR amplification primers for miRNAs were designed according to the stem-loop method and synthesized by Dingguo Biotech Co., Ltd. The specific primer sequences are shown in Table 6. The reverse primer R in all primer pairs is common and is: AACGCTTCACGAATTTGCGT (SEQ ID NO.10)
[0131] Table 6 RT-qPCR primers for miRNAs
[0132]
[0133]
[0134] RT is the primer used in Table 2, and F and the common R are the primer pairs used in Table 4.
[0135] The RT-qPCR verification results of sRNAs in infected cell-derived exosomes are as Figure 3 shown. The results showed that 9 candidate miRNAs (Table 6) were verified by quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis (U6 as an external control). The expressions of miR-93-5p, miR-199b-5p, miR-200c-3p, miR-140-5p, and miR-17-5p were up-regulated with significant differences; the expressions of miR-1268a and miR-760 were down-regulated with significant differences, and the qRT-PCR results of these 7 miRNAs were consistent with the differential results of exosomal RNA-seq; in addition, the expression differences of miR-499a-5p and miR-1291 were not significant, which were inconsistent with the sequencing results ( Figure 3 ).
[0136] The above 7 differential miRNAs (miR-93-5p, miR-199b-5p, miR-200c-3p, miR-140-5p, miR-17-5p, miR-1268a, and miR-760) were analyzed in the sera of tuberculosis patients by the same RT-qPCR method, and the results were as follows:
[0137] There were 5 miRNAs with up-regulated differential expressions between pulmonary tuberculosis patients and the healthy control group: miR-93-5p (p < 0.001), miR-200c-3p (p = 0.009), miR-140-5p (p = 0.003), miR-17-5p (p < 0.001), miR-760 (p = 0.005), with significant differences; while the expression abundances of miR-199b-5p and miR-1268a in the sera of pulmonary tuberculosis patients had no significant differences compared with those of the healthy control group; there were no miRNAs with down-regulated differential expressions ( Figure 4 ).
[0138] Based on the comprehensive results of extracellular vesicle sequencing and RT-qPCR analysis in serum, the intersecting miRNAs of the two were selected for further analysis: miR-93-5p, miR-200c-3p, miR-140-5p, miR-17-5p.
[0139] Example 2
[0140] Receiver operating characteristic (ROC) analysis of 4 miRNAs
[0141] Receiver operating characteristic (ROC) analysis was performed on 4 differentially expressed miRNAs (miR-93-5p, miR-200c-3p, miR-140-5p, miR-17-5p) in the serum of tuberculosis patients to evaluate their sensitivity and specificity.
[0142] 1 ROC analysis of single serum miRNA
[0143] The ROC curves constructed by simply comparing the relative concentrations of 4 miRNAs in pulmonary tuberculosis patients and healthy controls are as Figure 5 shown, and the following AUCs were obtained: miR-93-5p, 0.857 (p < 0.001, 95% CI = 0.7196 to 0.9947), miR-200c-3p, 0.777 (p < 0.009, 95% CI = 0.5996 to 0.9560), miR-140-5p, 0.813 (p < 0.003, 95% CI = 0.6625 to 0.9642), miR-17-5p, 0.835 (p < 0.001, 95% CI = 0.7219 to 0.9937) ( Figure 5 ). For continuous data, a threshold needs to be set to classify the results as positive or negative, and then the sensitivity and specificity at different thresholds are calculated. The thresholds for the 4 miRNAs are: miR-93-5p (expression level 1.3123015), miR-200c-3p (expression level 2.312896), miR-140-5p (expression level 0.744581), miR-17-5p (expression level 1.3586245). For example, if the expression level of miR-93-5p is higher than 1.3123015, it is determined as positive, and if it is lower than 1.3123015, it is determined as negative.
[0144] Using the threshold, we obtained the following sensitivity and specificity values: the sensitivity and specificity values of miR-93-5p were 86.70% and 73.30% respectively; the sensitivity and specificity values of miR-200c-3p were 60.00% and 100.00% respectively; the sensitivity and specificity values of miR-140-5p were 100.00% and 46.70% respectively; the sensitivity and specificity values of miR-17-5p were 86.70% and 73.30% respectively. The results showed that the sensitivity of single serum miRNA in diagnosing pulmonary tuberculosis was low and the specificity was poor.
[0145] 2ROC and Logistic Regression Analysis
[0146] 2.1 Analysis of 2-miRNA groups: By freely combining single serum miRNAs, 6 groups of 2-miRNA-Panel can be formed (Table 7):
[0147] Table 7 2-miRNA Combinations
[0148]
[0149] According to the 6 miRNAs with differential expression in the serum of tuberculosis patients, the receiver operating characteristic curve (ROC) analysis was performed, and the results are as Figure 6 shown.
[0150] The results showed that after the free combination of 2-miRNAs, the AUC of the combination of miR-93-5p and miR-200c-3p was 0.849, the sensitivity was 86.7%, and the specificity was 80%; the AUC of the combination of miR-93-5p and miR-140-5p was 0.889, the sensitivity was 86.7%, and the specificity was 80%; the AUC of the combination of miR-93-5p and miR-17-5p was 0.987, the sensitivity was 100.0%, and the specificity was 86.7%; the AUC of the combination of miR-200c-3p and miR-140-5p was 0.884, the sensitivity was 73.3%, and the specificity was 93.3%; the AUC of the combination of miR-200c-3p and miR-17-5p was 0.991, the sensitivity was 93.3%, and the specificity was 100%; the AUC of the combination of miR-140-5p and miR-17-5p was 0.969, the sensitivity was 100.0%, and the specificity was 86.7%.
[0151] Table 8 Accuracy of 2-miRNA Combinations
[0152] Combination Accuracy miR-93-5p, miR-200c-3p 73.3% miR-93-5p, miR-140-5p 76.7% miR-93-5p, miR-17-5p 93.3% miR-200c-3p, miR-140-5p 76.7% miR-200c-3p, miR-17-5p 90% miR-140-5p, miR-17-5p 86.7%
[0153] That is, the AUC values of three combinations: (miR-93-5p and miR-17-5p), (miR-200c-3p and miR-17-5p), and (miR-140-5p and miR-17-5p) all reached above 0.95 and had good sensitivity and specificity, and the sensitivity and specificity of (miR-200c-3p and miR-17-5p) both exceeded 93.3%.
[0154] 2.2 Analysis of 3-miRNA groups: Four groups of 3-miRNA-Panels can be formed by freely combining single serum miRNAs (Table 9):
[0155] Table 9 3-miRNA combinations
[0156]
[0157]
[0158] According to the differentially expressed 3 miRNA pairs in the sera of tuberculosis patients, receiver operating characteristic (ROC) curves were analyzed, and the results are as Figure 7 shown.
[0159] The results showed that in the 3-miRNA group, the AUC of the combination of miR-93-5p, miR-200c-3p, and miR-140-5p was 0.907, the sensitivity was 93.3%, and the specificity was 80%; the AUC of the combination of miR-93-5p, miR-200c-3p, and miR-17-5p was 0.991, the sensitivity was 93.3%, and the specificity was 100%; the AUC of the combination of miR-93-5p, miR-140-5p, and miR-17-5p was 0.991, the sensitivity was 93.3%, and the specificity was 100.0%; the AUC of the combination of miR-200c-3p, miR-140-5p, and miR-17-5p was 0.991, the sensitivity was 100.0%, and the specificity was 93.3%.
[0160] Table 10 Accuracy of 3-miRNA combinations
[0161] Combination Accuracy miR-93-5p, miR-200c-3p, miR-140-5p 76.7% miR-93-5p, miR-200c-3p, miR-17-5p 93.3% miR-93-5p, miR-140-5p,, miR-17-5p 93.3% miR-200c-3p, miR-140-5p,, miR-17-5p 90.0%
[0162] It can be seen that after the free combination of 3-miRNAs, the AUC values of all 4 groups exceed 0.90. Among them, the AUC values of 3 groups, namely (miR-93-5p, miR-200c-3p, miR-17-5p), (miR-200c-3p, miR-140-5p, miR-17-5p), and (miR-93-5p, miR-140-5p, miR-17-5p), all reach above 0.95 and have good sensitivity and specificity, with both sensitivity and specificity exceeding 93.3%.
[0163] 2.3 Analysis of 4-miRNA combination (miR-93-5p, miR-200c-3p, miR-140-5p, miR-17-5p). Receiver operating characteristic (ROC) curves were analyzed based on the 4 differentially expressed miRNAs in the sera of tuberculosis patients. The results are as Figure 8 shown. It can be seen that the AUC values of all 4 groups reach 0.99, with a sensitivity of 100% and a specificity of 93.3%, enabling good discrimination between healthy individuals and tuberculosis patients. Meanwhile, the accuracy of the 4-miRNA combination is 93.30%.
[0164] Example 3
[0165] Using the same method, the same analysis was performed on the reported miRNAs in pulmonary tuberculosis patients and healthy controls, and ROC curves were plotted to analyze their sensitivity and specificity. The results are shown in Table 11.
[0166] Table 11 ROC analysis of reported miRNAs as tuberculosis diagnostic markers
[0167]
[0168]
[0169] The miRNAs (miR-93-5p, miR-200c-3p, miR-140-5p, miR-17-5p) screened by the present invention can be used as a novel miRNA combination for the diagnosis of tuberculosis, with an AUC value of 0.996, a sensitivity of 100%, and a specificity of 93.3% (95% CI = 0.9810 to 1.0000), which is higher than the sensitivity and specificity of miRNA diagnosis reported in existing literature.
[0170] The above are only the preferred embodiments of the present application and are not intended to limit the present application. Any modifications, equivalent replacements, and improvements made within the spirit and principles of the present application shall be included within the protection scope of the present application.
Claims
1. Use of a miRNA marker in the preparation of a reagent for diagnosing and differentiating tuberculosis, characterized in that, The miRNA marker is 2 to 4 of the following 4 miRNAs: miR-93-5p, miR-200c-3p, miR-140-5p, miR-17-5p; Among them, the sequence of miR-93-5p is as shown in SEQ ID NO.1; the sequence of miR-200c-3p is as shown in SEQ ID NO.2; the sequence of miR-140-5p is as shown in SEQ ID NO.3; the sequence of miR-17-5p is as shown in SEQ ID NO.
4.
2. The application according to claim 1, characterized in that, The miRNA marker is a combination of miR-200c-3p and miR-17-5p.
3. The application according to claim 1, characterized in that, The miRNA marker is a combination of miR-200c-3p, miR-140-5p and miR-17-5p, a combination of miR-93-5p, miR-140-5p and miR-17-5p, or a combination of miR-93-5p, miR-200c-3p and miR-17-5p.
4. The application according to claim 1, wherein The miRNA marker is a combination of miR-93-5p, miR-200c-3p, miR-140-5p and miR-17-5p.
5. Use of a reagent for detecting miRNA markers in the preparation of a reagent for diagnosing and differentiating tuberculosis, characterized in that, The miRNA marker is 2 to 4 of the following 4 miRNAs: miR-93-5p, miR-200c-3p, miR-140-5p, miR-17-5p.
6. The application according to claim 5, wherein The reagent for detecting the miRNA marker includes primers, fluorescent dyes, probes or chips.
7. The application according to claim 5, characterized in that, The primers for detecting miR-93-5p are: F: CCTCAAAGTGCTGTTCGTG (SEQ ID NO.12); R: AACGCTTCACGAATTTGCGT (SEQ ID NO.10); The primers for detecting miR-200c-3p are: F: TCGCTAATACTGCCGGGTAAT (SEQ ID NO.16); R: AACGCTTCACGAATTTGCGT (SEQ ID NO.10); The primers for detecting miR-140-5p are: F: TCGCTCAGTGGTTTTACCCTA (SEQ ID NO.18); R: AACGCTTCACGAATTTGCGT (SEQ ID NO.10); The primers for detecting miR-17-5p are: F: GCCCAAAGTGCTTACAGTGC (SEQ ID NO.20); R: AACGCTTCACGAATTTGCGT (SEQ ID NO.10).
8. Application of the kit for detecting miRNA markers in preparing reagents for diagnosing and differentiating tuberculosis, wherein the miRNA marker is 2 to 4 of the following 4 miRNAs: miR-93-5p, miR-200c-3p, miR-140-5p, miR-17-5p; the kit includes primers, fluorescent dyes, probes or chips for detecting the miRNA marker.
9. The application according to claim 8, wherein If the expression level of miR-93-5p is not less than 1.3123015, the expression level of miR-200c-3p is not less than 2.312896, the expression level of miR-140-5p is not less than 0.744581, and the expression level of miR-17-5p is not less than 1.3586245, then the subject is determined to be a tuberculosis patient.
10. The application according to claim 8, wherein The kit further includes a serum RNA extraction solution, a reverse transcription reaction solution, a fluorescence quantitative PCR reaction solution, and an internal reference primer.
Citation Information
Patent Citations
MiRNA marker and kit for tuberculosis diagnosis and identification
CN115505635A