Broiler chicken slaughtering and processing type new strain breeding method based on molecular marker
Through genome-wide association analysis, a SNP marker for chromosome 5 of chicken was screened, and a molecular marker-assisted selection system was constructed, which solved the problem of slow genetic progress in traditional breeding methods, and achieved early selection of chicken slaughtering traits and multi-index improvement.
Patent Information
- Application Number
- CN202510441790.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-09
- Publication Date
- 2025-07-08
AI Technical Summary
Traditional breeding methods rely on post-slaughter phenotypic data screening, and cannot directly breed live breeding, resulting in slow genetic progress, and existing molecular markers can only support the genetic improvement of a single slaughter trait index, making it difficult to improve multiple slaughter trait indexes at the same time.
Genome-wide association analysis (GWAS) was used to screen SNP markers related to chicken slaughter traits, construct a molecular marker-assisted selection (MAS) system, and early selection was used for chromosome 5 sense chain C/T genotypes were used for breeding. Individuals of CC genotypes were screened for breeding.
Early selection of chicken slaughtering traits is achieved, production costs are saved, genetic progress is accelerated, and breeding efficiency of slaughtering performance is improved.
Smart Images

Figure CN120272607A_ABST
Abstract
Description
[0001] The invention belongs to the technical field of gene detection, and in particular relates to a molecular marker related to chicken slaughter traits and a method for breeding a new slaughtering and processing type strain. Background Art
[0002] my country is the core market for global broiler production and consumption, with the world's second largest chicken production and consumption. Chicken is my country's second largest meat consumption product and an important source of animal protein, and it occupies a strategic position in ensuring the nutritional supply of residents, optimizing dietary structure and stabilizing the development of animal husbandry. The slaughter traits of chickens (such as whole carcass weight, carcass weight, live weight before slaughter, etc.) directly reflect the meat production performance of broilers, and therefore have always been a research hotspot in animal breeding and production. Traditional breeding relies on the screening of phenotypic data after slaughter, but it is impossible to directly select live breeder chickens, and the correlation between phenotype and genotype is complex, which seriously restricts the speed of genetic progress.
[0003] Molecular marker-assisted selection (MAS) technology constructs a precise breeding system from genotype to phenotype by detecting SNP markers that are closely linked to the target traits, greatly improving the efficiency and accuracy of early selection. In recent years, research on molecular markers and genes related to chicken slaughter traits has made significant progress. At present, a number of key molecular markers and candidate genes have been identified. For example, the SNP site (chr1:171223058) in the intron region of the RNASEH2B gene was located in the hybrid chicken population, and its genotype CC was significantly associated with higher carcass weight and breast muscle weight; the SNP site (g.22244031TC) of the CYP4B7 gene in yellow-feathered broilers was confirmed to be significantly associated with full eviscerated weight, half eviscerated weight and leg muscle weight; the second intron (g.3769G>A) of the FABP5 gene of Yanshan Hongyu broiler chicken was significantly associated with slaughter traits. Although these achievements provide a theoretical basis for molecular breeding, currently available markers can only support the genetic improvement of a specific indicator, and the genetic variation research on multiple slaughter traits such as live weight before slaughter, carcass weight, and eviscerated weight has yet to be explored and applied. Genome-wide association study (GWAS) provides an efficient path for MAS technology by systematically exploring genetic markers that regulate slaughter traits.
[0004] Therefore, this patent uses GWAS analysis to screen slaughter trait-associated molecular markers with application value, and constructs a genetic marker application system for multiple indicators of chicken slaughter traits through MAS technology, which is of great significance for improving the slaughter performance of broiler chickens. Summary of the invention
[0005] The primary purpose of the present invention is to provide SNP markers on chromosome 5 of chicken that are related to the slaughter traits of chickens, wherein the slaughter traits refer to the live weight before slaughter, carcass weight, and whole carcass weight. The base of the molecular marker is C / T, which leads to significant differences in the live weight, carcass weight, and whole carcass weight of chickens before slaughter.
[0006] In order to accurately determine the genotype of the chicken to be tested for the convenience of early selection of slaughter traits, save production costs and accelerate genetic progress, a molecular marker related to slaughter traits and its application are proposed. The specific technical solutions are as follows:
[0007] An SNP molecular marker related to chicken slaughter traits, where the SNP (single nucleotide polymorphism) molecular marker corresponds to the 7,132,158th position on the sense strand of chromosome 5 in the chicken reference genome Gallus_gallus-7.0 version sequence information published in NCBI, and the base here is C or T.
[0008] The application of the SNP molecular marker in chicken genetic breeding.
[0009] A method for early selection of chicken slaughter traits, which is to conduct early selection of chicken slaughter traits according to the genotype of the above SNP locus, including the following steps:
[0010] (1) Extract the genomic DNA of the chicken to be tested;
[0011] (2) Detect the genotype of the SNP locus at the 7,132,158th position on the sense strand of chromosome 5 of the chicken to be tested;
[0012] (3) Conduct early selection of chicken slaughter traits based on the genotype of the SNP locus. Among them, the slaughter performance of individuals with the CC genotype is better than that of the TC genotype.
[0013] The method for extracting the genomic DNA of the chicken to be tested in step (1) is: collect venous blood from the chicken wing of the chicken to be tested, anticoagulate it with an anticoagulant, then perform lysis and protease digestion treatment, and then extract the genomic DNA by the phenol-chloroform method and dissolve it with sterile double-distilled water.
[0014] In step (2), the genotype is detected by PCR.
[0015] The genotypes of the SNP molecular marker at the 7,132,158th position on the sense strand of chromosome 5 of the chicken to be tested in step (2) are CC and TC.
[0016] The chicken slaughter traits mentioned in step (3) refer to the live weight before slaughter, carcass weight and eviscerated weight.
[0017] The CC genotype mentioned in step (3) refers to the homozygote with the base C at the 7,132,158th position on the sense strand of chromosome 5; the TC genotype refers to the heterozygote with the bases C and T at this position.
[0018] The beneficial effects of the present invention are as follows: The SNP molecular marker of the present invention is related to the chicken slaughter traits and is a new molecular marker. By determining the genotype of the SNP locus of the chicken to be tested for early selection of chicken slaughter traits, it can save production costs and accelerate genetic progress, better serve chicken breeding, and has great economic application value and scientific research value. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 It is the Manhattan plot and Q-Q plot of genome-wide association analysis (GWAS) for three phenotypes of pre-slaughter live weight, carcass weight and eviscerated weight on chromosome 5 of the local chicken breed Qibainong chicken; The 1-37 on the X-axis of the left Manhattan plot represents chromosomes 1-37. The red dotted line in the figure represents the potential significant threshold line at the genome-wide level, which is -log10(0.05 / 12583842) = 8.43, and the black dotted line represents the significant threshold line -log10(1 / 12583842) = 7.12. When it is higher than the threshold, it is considered that the SNP locus is significantly related to the trait. The right Q-Q plot represents the fitting degree of the actual observed value and the expected value. Among them, SW is the phenotypic pre-slaughter live weight, DW is the phenotypic carcass weight, and EW is the phenotypic eviscerated weight.
[0020] Figure 2 It is the differential analysis between different genotypes of three phenotypes of pre-slaughter live weight, carcass weight and eviscerated weight. When the p-value is less than 0.05, the difference is considered to be statistically significant. DETAILED DESCRIPTION OF THE INVENTION
[0021] The following examples further illustrate the content of the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and essence of the present invention, any modification or replacement of the methods, steps or conditions of the present invention belongs to the scope of the present invention.
[0022] Example 1. Mining SNP Loci Related to Slaughter Traits by Genome-Wide Association Analysis
[0023] The experimental animals used in the present invention are the local chicken breed Qibainong chicken. During the feeding process, free feeding and drinking are adopted, and the diet refers to the feeding standard of yellow-feathered broilers (NY / T33-2004). After slaughter at 180 days of age, the pre-slaughter live weight, carcass weight and eviscerated weight are measured. The eviscerated weight refers to the weight after removing the trachea, esophagus, crop, intestine, spleen, pancreas, gallbladder, reproductive organs, cuticle, heart, liver, glandular stomach, muscular stomach, abdominal fat, head and feet from the poultry carcass.
[0024] DNA Extraction
[0025] Collect 0.5 mL of wing vein blood from all experimental chickens using blood collection tubes. Extract genomic DNA using the standard phenol-chloroform method. Accurately determine the concentration and purity of the DNA sample (OD values: OD260 / 280, OD260 / 230) using a Nanodrop 2000 / 2000C nucleic acid and protein detector. For DNA samples that pass the detection, perform electrophoresis using 0.7% agarose gel to detect the purity and integrity of the DNA samples. Send the DNA samples to BGI (Beijing Genomics Institute) for whole-genome resequencing, with the reference sequence version being Gallus gallus 7.0 (GRCg7b).
[0026] Perform quality control on the genotype data of 362 individuals using PLINK v1.9 software. The quality control criteria are as follows: the site detection rate is greater than 0.90; the minor allele frequency (MAF) is greater than 0.05; the individual detection rate is greater than 0.90. Fill in the missing SNPs using Beagle v5.0 software. Finally, retain 313 individuals and 13,585,899 SNP sites. Perform a genome-wide association study on the pre-slaughter live weight, carcass weight, and eviscerated weight traits using the LMM model of GEMMA software.
[0027] The model used is the mixed linear model (LMM), specifically:
[0028] y = Xα + Zβ + Wμ + e#
[0029] where y is the trait under study, Xα is the fixed effect, other factors affecting y, mainly referring to population structure; zβ is the marker effect; Wμ is the random effect, generally referring to the kinship of individuals here.
[0030] After correction by Bonferroni multiple testing, 12,583,842 SNP sites remain. The genome-wide significance threshold is -log10(0.05 / 12,583,842) = 8.43, and the suggestive threshold is -log10(1 / 12,583,842) = 7.12. Use the CMplot package in R to plot Manhattan plots and QQ plots for the genome-wide association analysis results (see Figure 1 ), and screen out the sites that reach the significance threshold. The phenotypic variance explained (PVE) is calculated using the following formula.
[0031]
[0032] where β is the effeTC value of the GWAS result, MAF is the minor allele frequency of the SNP, and N is the number of individuals participating in the GWAS analysis.
[0033] Gene function annotation of significant loci was performed through the Ensemble and NCBI databases; further intersection analysis was carried out on the significant loci of three phenotypes, namely pre-slaughter live weight, carcass weight, and eviscerated weight, to find common loci; linkage disequilibrium analysis of significant SNPs was performed using the "Solid spine of LD" algorithm of the Haploview software; according to the p-value, the locus 5:7132158 was finally locked as a candidate locus. After mutation at this locus, it can increase pre-slaughter live weight, carcass weight, and eviscerated weight, showing a pleiotropic effect.
[0034] Example 2. Determination of favorable genotypes related to slaughter traits
[0035] In the Qibailong chicken population, the mean pre-slaughter live weight, mean carcass weight, and mean eviscerated weight of the genotype CC at locus 5:7132158 were significantly higher than those of the genotype TC for pre-slaughter live weight, carcass weight, and eviscerated weight (P<0.05). Finally, it was obtained that the SNP at the 7132158th position on the plus strand of chromosome 5 contains a favorable genotype and can be used for early selection of slaughter-type indicators. The genotype frequencies and phenotypic means are shown in Table 1. It can be seen that the CC genotype is the favorable genotype at this locus. Table 2 is the descriptive statistics of phenotypic data.
[0036] Table 1 Distribution of C / T genotypes at locus 5:7132158 in the Qibailong chicken population
[0037] Genotype TC CC Number of individuals 63 250 Genotype frequency 20.13% 79.87% Allele T C Gene frequency 10.06% 89.94% Mean pre-slaughter live weight 1883.63 2262.55 Mean carcass weight 1673.1 1996.72 Mean eviscerated weight 1338.28 1734.84
[0038] Table 2 Descriptive statistics of phenotypic data
[0039] Phenotype Number of individuals Mean Standard deviation Coefficient of variation Pre-slaughter live weight 313 2186.28 311.24 14.24% Carcass weight 313 1931.58 279.26 14.46% Eviscerated weight 313 1655.02 276.18 16.69%
[0040] Differential analysis between genotypes was carried out through the Kruskal-Wallis test, and the results (see Figure 2 ) showed that for the phenotypes of pre-slaughter live weight, carcass weight, and eviscerated weight, the CC genotype was significantly higher than the TC genotype. The SNP at the 7132158th position on the plus strand of chromosome 5 containing the favorable genotype CC can be used for the selection of high pre-slaughter live weight, high carcass weight, and high eviscerated weight.
[0041] Example 3 Method for early selection of slaughter traits using the SNP molecular marker of the present invention
[0042] Blood samples from the wing veins of all selected individuals were collected at about 20 days of age, added with ACD anticoagulant, and stored at -20°C for later use.
[0043] Genomic DNA was extracted using the conventional phenol-chloroform method, dissolved in TE buffer, and the purity and concentration of DNA were detected by both agarose gel electrophoresis and ultraviolet spectrophotometry, and then diluted to a concentration of 50 ng / μl.
[0044] For individuals with qualified DNA extraction, detect the SNP genotype at position 7132158 on the sense strand of chromosome 5, screen and retain individuals with the favorable genotype CC type for continued breeding, and eliminate individuals with the TC heterozygous genotype to achieve early selection of slaughter-type individuals and save breeding costs.
[0045] Raise the healthy roosters and hens with the favorable CC genotype until 30 weeks of age for mating. The mating should avoid inbreeding within three generations, and record the individual numbers of the mated roosters and hens to establish a pedigree. Experiments have confirmed that using this molecular marker for marker-assisted selection can save production costs and accelerate genetic progress.
[0046] The present invention provides methods such as GWAS analysis of the SNP at position 7132158 on the sense strand of chicken chromosome 5, detection of mutation sites, and application in the breeding of new slaughter-processing strains, etc., providing a new molecular marker for marker-assisted selection of chicken slaughter-processing indicators.
[0047] Although the above embodiments have described the present invention and its implementation methods in detail, it should be noted that for those of ordinary skill in the art, without departing from the technical principles of the present invention, changes, modifications, substitutions, combinations, simplifications, etc. made to the corresponding conditions should all be regarded as equivalent replacement methods, and these improvements should also be regarded as the protection scope of the present invention.
Claims
1. Use of an SNP molecular marker in breeding for broiler slaughter-related traits, characterized in that, The slaughter traits refer to the live weight before slaughter, carcass weight, and eviscerated weight. The SNP molecular marker sequence is TTCTCACTCGAGCAGGAAAGCGTTTGCCTTCAATAGCTGAA, corresponding to the 7,132,158th position on the plus strand of chromosome 5 in the chicken reference genome Gallus_gallus-7.0 version sequence information published by NCBI, where the base is C or T, and the genotypes are TC or CC; the slaughter performance of individuals with the CC genotype is superior to that of the TC genotype. The broiler chicken is the Qibainong chicken.
2. A primer for detecting the SNP molecular marker related to chicken slaughter traits described in claim 1, characterized in that, Including: Forward primer F: CGGTATCCACCAATGCTCTAT; Reverse primer R: TGATGAACCCGTAGAACTCG.
3. Use of the primer according to claim 2 in detecting the slaughter traits of chickens.
4. A method for identifying broiler slaughter traits using the SNP molecular markers described in claim 1, characterized in that, The specific steps of the method are as follows: (1) Extract the genomic DNA of the chicken to be tested; (2) Detect the genotype of the SNP molecular marker at the 7,132,158th position on the plus strand of chromosome 5 of the chicken to be tested; (3) Conduct early selection of the chicken slaughter traits based on the genotype of the SNP locus. Among them, the slaughter performance of individuals with the CC genotype is superior to that of the TC genotype, and the CC genotype has the effects of high live weight before slaughter, high carcass weight, and high eviscerated weight; on the contrary, the TC genotype has the effects of low live weight before slaughter, low carcass weight, and low eviscerated weight.
5. The method according to claim 4, wherein The method for extracting the genomic DNA of the chicken to be tested in step (1) is: Collect blood from the wing vein of the chicken to be tested, anticoagulate it with an anticoagulant, then perform lysis and protease digestion treatments, and then extract the genomic DNA by the phenol-chloroform method and dissolve it in sterile double-distilled water.
6. Use of the SNP molecular marker according to claim 1 or the method according to claim 2 in the genetic breeding of broiler chickens, and the broiler chicken is the Qibainong chicken.
Citation Information
Cited By
Application of RNASEH2B gene SNP molecular marker in evaluation of chicken growth and slaughter traits
CN121380376A