RPA-CRISPR / Cas12a-based sequence combination for rapidly detecting Philospora maydis and application of RPA-CRISPR / Cas12a-based sequence combination

Abstract

The invention belongs to the technical field of biological detection, and particularly relates to a sequence combination for rapidly detecting Paphanerospora maydis based on RPA-CRISPR / Cas12a and application of the sequence combination. The invention relates to a sequence combination for rapidly detecting Philospora maydis based on RPA-CRISPR / Cas12a, which is characterized in that the sequence combination comprises RPA (recombinase polymerase amplification) primers Bm-F3 / Bm-R3 and Bm-crRNA (complementary ribosomal ribonucleic acid) sequences. The specific RPA primer is designed for the bipolaris maydis which is high in separation frequency, wide in distribution range and serious in harm, and field visual rapid detection of the bipolaris maydis can be achieved by combining recombinase polymerase amplification with a CRISPR / Cas12a detection technology. The technology is easy and convenient to operate, reaction can be carried out under the constant-temperature condition, expensive instruments are not needed, and detection time is short. Aerosol pollution caused by secondary cover opening can also be avoided by using a one-tube method for detection, meanwhile, the specificity and sensitivity of RPA detection can be improved by using a CRISPR / Cas12a system, and an efficient and reliable detection scheme can be provided for field monitoring of the Philospora maydis.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological detection, and specifically relates to a sequence combination for rapidly detecting *Bipolaris maydis* based on RPA-CRISPR / Cas12a and its application. Background Art

[0002] Northern leaf blight of maize is a global maize disease caused by *Bipolaris maydis* ( Bipolaris maydis ), which occurs in most maize-producing areas in China, especially severely in the Huang-Huai-Hai River Basin. By infecting tissues such as leaves and stalks, the pathogen can cause a 10%-70% reduction in maize yield, and even complete crop failure in severe cases, bringing huge economic losses to the maize industry. In addition, secondary metabolites produced by the pathogen (such as bipolaroxin) can inhibit the plant antioxidant system and exacerbate physiological damage. Therefore, establishing a highly sensitive and specific detection technology for *Bipolaris maydis* is of great significance for achieving early warning, guiding precise prevention and control, and reducing the use of chemical pesticides.

[0003] In recent years, molecular diagnostic techniques based on Recombinase Polymerase Amplification (RPA) and the CRISPR / Cas12a system have provided a new direction for the detection of pathogenic microorganisms. The RPA technology can achieve rapid isothermal amplification of nucleic acids at room temperature, breaking through the dependence on thermal cyclers in traditional PCR; the CRISPR / Cas12a system can specifically bind to double-stranded DNA through crRNA-mediated targeted recognition and activate its trans-cleavage activity to continuously cleave single-stranded fluorescent reporter probes to generate detectable signals. Research shows that the sensitivity of this combined technology in plant pathogens, viruses, etc. can reach 10-45 copies / μL, and the detection time can be completed within 1 h, greatly shortening the detection time. This technology has diverse visualization methods. It can not only perform fluorescence detection through a blue light gel cutter, but also be combined with a lateral flow assay (LFA) strip to directly observe the results with the naked eye, truly realizing the rapid visualization detection of nucleic acids.

[0004] Currently, there are no relevant reports on the rapid detection of northern leaf blight of maize using the RPA-CRISPR / Cas12a technology. Therefore, developing a rapid detection technology for northern leaf blight of maize combining RPA and CRISPR / Cas12a has important application value for realizing in-field real-time diagnosis and disease prevention and control.

[0005] The information disclosed in this background art section is only intended to enhance the overall understanding of the present invention and should not be regarded as an admission or any form of implication that this information constitutes prior art already known to those of ordinary skill in the art. Summary of the Invention

[0006] The object of the present invention is to provide a sequence combination for rapidly detecting Bipolaris maydis based on RPA-CRISPR / Cas12a and its application.

[0007] To achieve the above object, the present invention provides the following technical solutions: A sequence combination for rapidly detecting Bipolaris maydis based on RPA-CRISPR / Cas12a, the sequence combination includes RPA primers Bm-F3 / Bm-R3 and crRNA sequence, and their sequences are as follows: Bm-F3: AACCCCCACCACTGTCCATTACAACTTCCGAGC; Bm-R3: GATGACCTTGATGTCGTTGAAGTTGGTGGTGGT; crRNA: UAAUUUCUACUAAGUGUAGAUGGUGGUGGGGUUGUGCGAACUU.

[0008] Furthermore, the sequence combination further includes a signal reporter molecule.

[0009] Furthermore, the signal reporter molecule is ssDNA-reporter-FAM for detecting Bipolaris maydis by a fluorescence quantitative PCR instrument, and its nucleotide sequence is: 5′-6′FAM-TTATT-BHQ1-3′; Or the signal reporter molecule is FB-reporter for detecting Bipolaris maydis by a lateral flow chromatography test strip, and its nucleotide sequence is: 5′-6′FAM-TTTTTTTTT-Biotin-3′.

[0010] Furthermore, the 5′ end of the reporter molecule is labeled with a FAM fluorescent reporter group, and the 3′ end is labeled with a fluorescence quenching group; or the 5′ end of the reporter molecule is labeled with a fluorescence reporter group, and the 3′ end is labeled with a biotin affinity group.

[0011] The present invention also provides a kit for rapidly detecting Bipolaris maydis, the kit includes RPA amplification reagents, CRISPR / Cas12a detection reagents and the RPA primers, Bm-crRNA sequence and signal reporter molecule; Among them, the RPA amplification reagents include enzyme lyophilized powder and MgOAC; The CRISPR / Cas12a detection reagents include LbCas12a enzyme and HOLMES Buffer.

[0012] The present invention also provides the application of the kit for rapid detection of *Bipolaris maydis* in the detection or classification and identification of *Bipolaris maydis* pathogens.

[0013] The present invention also provides a method for rapid detection of *Bipolaris maydis*, comprising the following steps: S1. Extracting the genomic DNA of the fungus in the sample to be tested; S2. Performing an RPA amplification reaction on the genomic DNA extracted in step S1 using an RPA amplification reaction system to obtain an RPA amplification product; S3. Taking the RPA amplification product and adding it to a CRISPR / Cas12a detection system for fluorescence detection or lateral flow chromatography strip detection.

[0014] Furthermore, the total volume of the RPA amplification reaction is 50 μL, specifically including the following components: 2.4 μL each of 10 μM forward and reverse primers, 29.5 μL of Rehydration Buffer, 2 μL of template DNA, 11.2 μL of ddH2O, freeze-dried RPA enzyme and 2.5 μL of 280 mM MgOAc, and performing the amplification reaction at 39 °C for 15 min.

[0015] Furthermore, the total volume of the CRISPR / Cas12a detection system is 20 μL, specifically including the following components: 2 μL of 10×HOLMES Buffer, 0.3 μL of 1 μM LbCas12a, 0.3 μL of 10 μM crRNA, 0.3 μL of 10 μM ssDNA Reporter-FAM, 2 μL of the RPA amplification product, and 15.1 μL of ddH2O; after mixing, fluorescence detection is performed; Or the CRISPR / Cas12a detection system specifically includes the following components: 2 μL of 10×HOLMES Buffer, 0.3 μL of 1 μM LbCas12a, 0.3 μL of 10 μM crRNA, 0.7 μL of 10 μM ssDNA FB-Reporter, 2 μL of the RPA amplification product, and 14.7 μL of ddH2O; after mixing, reacting at 37 °C for 15 min, and detecting using a test strip.

[0016] The present invention also provides the application of the method for rapid detection of *Bipolaris maydis* in the detection or classification and identification of *Bipolaris maydis* pathogens.

[0017] Compared with the prior art, the present invention has the following beneficial effects: The present invention designs specific RPA primers for Bipolaris maydis with high separation frequency, wide distribution range and serious harm. Through recombinase polymerase amplification combined with CRISPR / Cas12a detection technology, rapid on-site visual detection of Bipolaris maydis can be achieved. This technology is easy to operate, can react under constant temperature conditions, does not require expensive instruments, and has a short detection time. Using the one-tube method for detection can also avoid aerosol contamination caused by secondary opening of the lid. At the same time, the CRISPR / Cas12a system can improve the specificity and sensitivity of RPA amplification detection, providing an efficient and reliable detection scheme for on-site monitoring of Bipolaris maydis. Description of the Drawings

[0018] Figure 1 Electrophoresis detection results of RPA reaction products with different primer pairs; Figure 2 Detection results of RPA-CRISPR / Cas12a for Bipolaris maydis; Figure 3 A is the optimization of RPA reaction time; Figure 3 B is the optimization of RPA reaction temperature; Figure 4 Optimization of the cleavage time of the CRISPR / Cas12a detection system; Figure 5 Sensitivity detection results of the one-step RPA-CRISPR / Cas12a detection system; Figure 6 Application of the one-step RPA-CRISPR / Cas12a detection system in field samples.

[0019] Description of the main reference numerals: In Figure 1 Figure A is the agarose gel electrophoresis result of the specific primer Bm-F1 / Bm-R1, Figure B is the agarose gel electrophoresis result of Bm-F2 / Bm-R2, and Figure C is the agarose gel electrophoresis result of Bm-F3 / Bm-R3; in Figures A-C, from left to right, the lanes are: D700 Marker, 1 is the water control, 2 and 3 are Exserohilum turcicum, 4 is Bipolaris maydis, 5 is Bipolaris sorokiniana, 6 is Exserohilum procerum, 7 is Curvularia lunata, 8 is Fusarium proliferatum, 9 is Fusarium equiseti, 10 is Fusarium oxysporum, 11 is Fusarium graminearum, 12 is Fusarium pseudograminearum, 13 is Fusarium solani; In Figure 2 Figure A is the fluorescence signal detection result, and Figure B is the test strip detection result; In Figure 5Among them, the template concentrations from left to right are: 34.5 ng / μL, 3.45 ng / μL, 345 pg / μL, 34.5 pg / μL, 3.45 pg / μL, 0.34 pg / μL, 34 fg / μL. Detailed Implementation Modes

[0020] The technical solutions of the present invention will be described in detail below. However, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments.

[0021] Example 1 Establishment of RPA-CRISPR / Cas12a Detection System 1.1 Fungal Strains Bipolaris maydis B. maydis ), Exserohilum turcicum (corn) ( Exserohilum turcicum ), Exserohilum turcicum (sorghum) ( E. turcicum ), Curvularia lunata Curvularia lunata ), Bipolaris sorokiniana B. sorokiniana ), Fusarium graminearum Fusarium graminearum ), Fusarium pseudograminearum F. pseudograminearum ), Fusarium proliferatum F. proliferatum ), Fusarium equiseti F. equiseti ), Fusarium oxysporum F. oxysporum ), Fusarium solani F. solani ).

[0022] 1.2 Design of RPA Primers and crRNA for Bipolaris maydis Download the translation elongation factor gene (Translation Elongation Factor 1alpha, TEF-1α) of Bipolaris maydis B. maydis ), its related species Exserohilum turcicum E. turcicum ), Curvularia lunata C. lunata ), and Bipolaris sorokiniana B. sorokiniana from NCBI, perform multiple alignments on the downloaded multiple sequences using DNAMAN, find multiple bases with large differences, and manually design RPA-specific primers.

[0023] Target the EF-1α gene on the website CRISPOR (http: / / crispor.tefor.net / ), and select the spacer sequence with a high score to design the crRNA sequence. The specific sequences of RPA primers and crRNA are shown in Table 1.

[0024] Table 1 RPA primers and crRNA sequences of Bipolaris maydis Primer Name Sequence (5′-3′) Bm-F1 CCACCAACTGCCCATGGTACAAGGGTTGGGAGA Bm-R1 AAGACGGAGGGGCTTGTCGGTAGGACGGCTGG Bm-F2 CCAAGGCCACCGGTAAGACCCTCCTCGAGGCCATC Bm-R2 CGGACTTGACTTCAGTGGTGACACCAGCGGGGG Bm-F3 AACCCCCACCACTGTCCATTACAACTTCCGAGC Bm-R3 GATGACCTTGATGTCGTTGAAGTTGGTGGTGGT Bm-crRNA UAAUUUCUACUAAGUGUAGAUGGUGGUGGGGUUGUGCGAACUU 1.3 Screening of RPA primer sequences 1.3.1 DNA extraction Genomic DNA was extracted using the strong acid and strong base method. The specific operations are as follows: (1)Add 50 μL of 50 mmol / L NaOH solution to a 1.5 mL centrifuge tube. Pick up a small amount of mycelium with a sterile toothpick and put it into the centrifuge tube. Vortex to disperse the mycelium or disease sample, and then perform a boiling water bath for 10 min; (2)Add another 5 μL of 1 mol / L Tris-HCl (pH 8.0) buffer to the centrifuge tube, centrifuge at 12000 r / min for 5 min, and transfer the supernatant to a new centrifuge tube. The prepared template DNA is obtained; (3)Measure the concentration of the DNA sample using a Nanodrop ND-1000 spectrophotometer (Thermo Scientific, Waltham, MA), record the data, and store the DNA sample at -20 °C for later use.

[0025] 1.3.2 Primer screening The TwistDX company (UK) Basic RPA kit was used for the RPA reaction. The reaction system was prepared according to the instruction manual. Specifically: Add 29.5 μL of Rehydration Buffer, 2.4 μL each of the upstream and downstream primers (10 μM), and 11.2 μL of ddH2O to the dry RPA enzyme powder; after the dry RPA enzyme powder is dissolved, add 2 μL of the template DNA sample, and finally add 2.5 μL of 280 mM MgOAc. Mix well and place it in a metal bath at 39 °C for reaction for 15 min. Mix the RPA product with chloroform / isopentanol (24:1), centrifuge at 12000 r / min for 5 min, take 5 μL of the supernatant and mix it with 1 μL of 6×loading buffer, and add it to the sample well to screen for RPA primers with strong specificity. Some of the screening results are as Figure 1 shown.

[0026] From Figure 1 it can be seen that the primers Bm-F1 / Bm-R1 and Bm-F2 / Bm-R2 can amplify bands for Bipolaris maydis, Exserohilum turcicum, Bipolaris sorokiniana, Curvularia lunata, and Exserohilum procerum, and can also amplify multiple non-specific bands for other species ( Figure 1 A and Figure 1 B), indicating that these primers have poor specificity.

[0027] Primer Bm-F3 / Bm-R3 could only amplify bands for *Bipolaris maydis*, and no bands were amplified for other species of bacteria ( Figure 1 C), indicating that primer Bm-F3 / Bm-R3 had high specificity for *Bipolaris maydis*. Therefore, primer Bm-F3 / Bm-R3 was selected for subsequent experiments.

[0028] 1.4 Establishment of the RPA-CRISPR / Cas12a detection system The reagents used were the LbCas12a nuclease, supporting reagents, and lateral flow chromatography test strips from ToloBio.

[0029] 1.4.1 Fluorescence detection The CRISPR / Cas12a fluorescence detection system is shown in Table 2.

[0030] Table 2 CRISPR / Cas12a fluorescence detection reaction system Reagent Volume 10×HOLMES Buffer 2.0 μL 1μM LbCas12a 0.3 μL 10μM crRNA 0.3 μL 10μM ssDNA Reporter-FAM 0.3 μL RPA Amplification Product 2.0 μL DEPC Water 15.1 μL When in use, the CRISPR / Cas12a fluorescence detection system was mixed and reacted at 37 °C for 30 min, and the fluorescence signal was read. The results are shown in Figure 2 A.

[0031] As can be seen from Figure 2 A, among the 7 strains, only *Bipolaris maydis* could produce obvious fluorescence signals, which had extremely significant differences from the fluorescence signals of the other strains, indicating that the system established in this study could specifically detect *Bipolaris maydis*.

[0032] 1.4.2 Lateral flow chromatography test strip detection The CRISPR / Cas12a detection reaction system is shown in Table 3.

[0033] Table 3 CRISPR / Cas12a detection reaction system Reagent Volume 10×HOLMES Buffer 2.0 μL 1μM LbCas12a 0.3 μL 10μM crRNA 0.3 μL 10μM ssDNA FB-Reporter 0.7 μL RPA Amplification Product 2.0 μL DEPC Treated Water 14.7 μL When in use, the CRISPR / Cas12a-LFA reaction system was mixed and reacted at 37 °C for 15 min, then 30 μL of deionized water was added. After mixing, one end of the test strip was immersed in the reaction solution for detection, and the appearance of bands on the test strip was observed. The results are shown in Figure 2 B.

[0034] As can be seen from Figure 2 B, among various pathogenic bacteria, only *Bipolaris maydis* showed a detection band, and no detection bands appeared for the other strains, indicating that this system could specifically detect *Bipolaris maydis*.

[0035] Example 2 Optimization of the RPA-CRISPR / Cas12a detection system 2.1 Optimization of RPA reaction time Set the RPA reaction time to 5 min, 10 min, 15 min, 20 min, and 30 min respectively. Using the amplification product as a template, perform the CRISPR / Cas12a reaction. According to the fluorescence signal intensity, determine the optimal reaction time. The results are shown in Figure 3 A.

[0036] As can be seen from Figure 3 A, when the RPA reaction time is 5 min, the fluorescence signal intensity reaches the maximum value. Therefore, 5 min is selected as the optimal time for the subsequent RPA reaction.

[0037] 2.2 Optimization of RPA reaction temperature Set the RPA reaction temperature to 35 °C, 37 °C, 39 °C, and 41 °C respectively. Using the RPA amplification product as a template, perform the CRISPR / Cas12a reaction. According to the fluorescence signal intensity, determine the optimal reaction temperature. The results are shown in Figure 3 B.

[0038] As can be seen from Figure 3 B, the fluorescence intensity is the highest when the RPA reaction temperature is 37 °C. Therefore, 37 °C is selected for the subsequent experiment.

[0039] 2.3 Optimization of cleavage time Set the CRISPR cleavage time to 5 min, 10 min, 15 min, 20 min, and 30 min, and then perform the CRISPR / Cas12a reaction. Screen the optimal cleavage time according to the fluorescence signal intensity at different reaction times. The results are shown in Figure 4 .

[0040] As can be seen from Figure 4 , the fluorescence signal reaches the threshold at 10 min of cleavage. After that, increasing the CRISPR / Cas12a cleavage time, the fluorescence intensity still tends to be flat. Therefore, the CRISPR / Cas12a cleavage time is optimized to 10 min.

[0041] Example 3 Sensitivity analysis of the RPA-CRISPR / Cas12a detection system 3.1 One-step RPA-CRISPR / Cas12a detection system The one-step RPA-CRISPR / Cas12a detection system includes: adding 2.4 μL of each of the 10 μM upstream and downstream primers, 29.5 μL of Rehydration Buffer, and 11.2 μL of ddH2O to the dry powder of RPA enzyme; after the dry powder of RPA enzyme is dissolved, the solution is aliquoted into 5 PCR tubes in equal volumes, and then 0.5 μL of DNA template and 0.5 μL of MgOAC are added to each PCR tube; finally, the configured CRISPR / Cas12a system is added to the inside of the PCR tube cap respectively. The system inside the PCR tube cap includes 2 μL of 10×HOLMES Buffer, 0.3 μL of 1 μM LbCas12a, 0.3 μL of 10 μM crRNA, and 0.7 μL of 10 μM ssDNA FB-Reporter. The PCR tubes are placed in a metal bath and reacted at 37°C for 5 min (RPA reaction time). After instantaneous centrifugation or shaking the PCR tubes, incubate at 37°C for 10 min, then add 30 μL of deionized water, mix well, and immerse one end of the test strip into the reaction solution to observe the appearance of the band.

[0042] 3.2 Sensitivity detection of the RPA-CRISPR / Cas12a detection system Dilute the DNA concentration (34.5 ng / μL) of Bipolaris maydis by 10-fold gradients, a total of 7 concentrations are diluted, which are 10 0 、10 -1 、10 -2 、10 -3 、10 -4 、10 -5 and 10 -6 , and use the one-step RPA-CRISPR / Cas12a detection system for sensitivity detection. The RPA reaction time, temperature, and cleavage time all adopt the optimized data. The results are shown in Figure 5 .

[0043] As can be seen from Figure 5 , 10 0 、10 -1 、10 -2 、10 -3 、10 -4 and 10 -5 all have bands, which are significantly different from the control group, indicating that the sensitivity of the CRISPR-Cas12a test strip is 0.34 pg / μL.

[0044] Example 4 Field application Collect samples of suspected southern leaf blight disease in the field and healthy leaves. Extract the DNA of the disease samples according to the DNA extraction method in Example 1, and use the one-step RPA-CRISPR / Cas12a detection system in Example 3 to detect the field samples. The results are shown in Figure 6 .

[0045] It can be seen from Figure 6 that bands can be detected in all 4 samples suspected of southern leaf blight collected in the field, and no bands appear in the 2 healthy leaves collected. However, some of the samples with detected bands have lighter colors, presumably because the leaves are starting to get diseased and the amount of hyphae is less, resulting in a lighter band color.

[0046] In summary, the one-step RPA-CRISPR / Cas12a detection system established by the present invention can achieve rapid detection of the pathogen of southern leaf blight in the field, and can provide an efficient and reliable detection means for rapid screening of the pathogen of southern leaf blight in the field.

[0047] The above is a description of specific exemplary embodiments of the present invention. These descriptions do not limit the present invention to the precise forms disclosed, and many changes and variations can be made. The purpose of selecting and describing the exemplary embodiments is to explain the specific principles of the present invention and its practical applications, so that those skilled in the art can implement and utilize various different exemplary embodiments of the present invention, as well as various different selections and changes.

Claims

1. A sequence combination for rapid detection of Bipolaris maydis based on RPA-CRISPR / Cas12a, characterized in that, The sequence combination includes RPA primers Bm-F3 / Bm-R3 and crRNA sequences, and their sequences are as follows: Bm-F3: AACCCCCACCACTGTCCATTACAACTTCCGAGC; Bm-R3: GATGACCTTGATGTCGTTGAAGTTGGTGGTGGT; crRNA: UAAUUUCUACUAAGUGUAGAUGGUGGUGGGGUUGUGCGAACUU.

2. The sequence combination for rapid detection of *Bipolaris maydis* based on RPA-CRISPR / Cas12a according to claim 1, wherein The sequence combination further includes a signal reporter molecule.

3. The sequence combination for rapid detection of *Bipolaris maydis* based on RPA-CRISPR / Cas12a according to claim 2, characterized in that, The signal reporter molecule is ssDNA-reporter-FAM for detecting Bipolaris maydis by a fluorescence quantitative PCR instrument, and its nucleotide sequence is: 5′-6′FAM-TTATT-BHQ1-3′; Or the signal reporter molecule is FB-reporter for detecting Bipolaris maydis by a lateral flow chromatography strip, and its nucleotide sequence is: 5′-6′FAM-TTTTTTTTT-Biotin-3′.

4. The sequence combination for rapid detection of *Bipolaris maydis* based on RPA-CRISPR / Cas12a according to claim 3, wherein The 5′ end of the reporter molecule is labeled with a FAM fluorescent reporter group, and the 3′ end is labeled with a fluorescence quenching group; or the 5′ end of the reporter molecule is labeled with a fluorescence reporter group, and the 3′ end is labeled with a biotin affinity group.

5. A kit for rapid detection of Bipolaris maydis, characterized in that, The kit includes RPA amplification reagents, CRISPR / Cas12a detection reagents, and the RPA primers, Bm-crRNA sequence, and signal reporter molecule described in claim 2; wherein, the RPA amplification reagents include freeze-dried enzyme and MgOAC; The CRISPR / Cas12a detection reagents include LbCas12a enzyme and HOLMES Buffer.

6. Use of the kit for rapidly detecting Bipolaris maydis according to claim 5 in the detection or classification and identification of Bipolaris maydis pathogens.

7. A method for rapid detection of Bipolaris maydis, characterized in that, Comprising the following steps: S1. Extract the genomic DNA of the fungus in the sample to be tested; S2. Perform an RPA amplification reaction on the genomic DNA extracted in step S1 using an RPA amplification reaction system to obtain an RPA amplification product; S3. Take the RPA amplification product and add it to the CRISPR / Cas12a detection system for fluorescence detection or lateral flow chromatography strip detection.

8. The method for rapid detection of Bipolaris maydis according to claim 7, characterized in that, The total volume of the RPA amplification reaction is 50 μL, and specifically includes the following components: 2.4 μL each of 10 μM forward and reverse primers, 29.5 μL of Rehydration Buffer, 2 μL of template DNA, 11.2 μL of ddH2O, 2.5 μL of freeze-dried RPA enzyme and 280 mM MgOAc, and perform the amplification reaction at 39°C for 15 min.

9. The method for rapidly detecting Bipolaris maydis according to claim 7, characterized in that The total volume of the CRISPR / Cas12a detection system is 20 μL, and specifically includes the following components: 2 μL of 10× HOLMES Buffer, 0.3 μL of 1 μM LbCas12a, 0.3 μL of 10 μM crRNA, 0.3 μL of 10 μM ssDNA Reporter-FAM, 2 μL of RPA amplification product, and 15.1 μL of ddH2O; after mixing, fluorescence detection is carried out. Or the CRISPR / Cas12a detection system specifically includes the following components: 2 μL of 10× HOLMES Buffer, 0.3 μL of 1 μM LbCas12a, 0.3 μL of 10 μM crRNA, 0.7 μL of 10 μM ssDNA FB-Reporter, 2 μL of RPA amplification product, and 14.7 μL of ddH2O; after mixing, react at 37 °C for 15 min, and detect using a test strip.

10. Use of the method for rapid detection of Bipolaris maydis according to claim 7 in the detection or classification and identification of Bipolaris maydis pathogens.

Images