Primer combination and kit for digitally detecting nucleic acid of monkey B virus and use method of primer combination and kit
The digital detection method of monkey B virus nucleic acid through primer combination and probe sequence design, combined with RPA technology and blood glucose meter detection, solves the sensitivity and specificity of monkey B virus detection in the prior art, and achieves rapid and accurate detection under non-laboratory conditions.
Patent Information
- Application Number
- CN202510431630.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-08
- Publication Date
- 2025-07-08
AI Technical Summary
The existing monkey B virus detection methods have low sensitivity, poor specificity and complex operation, making it difficult to quickly and accurately detect under non-laboratory conditions.
The primer combination and probe sequence design were used, combined with recombinase-mediated isothermal amplification technology (RPA), and a blood glucose meter was used for digital detection to construct a monkey B virus nucleic acid digital detection kit, including primer combination, Primer Free Rehydration buffer, recombinase, polymerase, single-chain binding protein, magnesium acetate solution and magnetic beads. The concentration of the target gene in the reaction solution was read through the blood glucose meter for results.
A high sensitivity and specificity monkey B virus detection is achieved, with a detection limit of 0.35copies/μL, avoiding dependence on precision temperature control equipment, suitable for rapid detection under non-laboratory conditions, and reducing dependence on professional and technical personnel and large instruments.
Smart Images

Figure CN120272647A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of virus detection, and particularly relates to a primer combination and a kit for digital detection of monkey B virus nucleic acid and a method for using the same. Background Art
[0002] Monkey B virus is a zoonotic virus, and its natural host is macaques, which are widely distributed among monkey populations. After human infection with monkey B virus, it can cause encephalomyelitis and even death, and the mortality rate without treatment exceeds 70%. Monkey B virus is the only known pathogenic virus to humans among the 35 non-human primate herpesviruses identified so far. According to the national standard for the grading and detection of experimental animal microbiology promulgated and implemented in China in 2011, monkey B virus has been classified as a pathogenic microorganism that should be excluded from ordinary experimental monkeys. Therefore, constructing a rapid and accurate detection method for monkey B virus is of great significance for the rapid diagnosis and treatment of relevant staff after exposure and for establishing a high-quality experimental monkey population. Summary of the Invention
[0003] The purpose of the present invention is to obtain a method for digital detection of monkey B virus nucleic acid with high sensitivity, strong specificity, simple and rapid operation.
[0004] The present invention provides a primer combination for digital detection of monkey B virus nucleic acid, and the sequences of the primer pairs are shown as SEQ ID NO.1 and SEQ ID NO.2.
[0005] Further defined, it also includes that the probe sequence is modified with thiol at the 5' end and C3-Spacer at the 3' end of the nucleotide sequence shown as SEQ ID NO.3, and can be reduced to a thiolated probe by the thiol reducing agent tris(2-carboxyethyl)phosphine hydrochloride.
[0006] The present invention discloses the application of the above primer combination in the preparation of a kit or reagent for digital detection of monkey B virus nucleic acid.
[0007] The present invention discloses a kit for digital detection of monkey B virus nucleic acid, and the kit includes the above primer combination.
[0008] Further defined, the kit also includes Primer Free Rehydration buffer, recombinase, polymerase, single-stranded binding protein, magnesium acetate solution and magnetic beads.
[0009] Further defined, the primer concentration is 10 μM.
[0010] Further defined, the kit further comprises a positive control and a negative control. The positive control is a plasmid containing the sequence shown in SEQ ID NO.4, and the negative control is an empty vector.
[0011] The present invention provides a method for using the above-mentioned kit for non-diagnostic purposes, characterized in that the steps of the method are as follows:
[0012] Step 1: Mix the DNA of the sample to be tested with the sequences shown in SEQ ID NO.1 and SEQ ID NO.2, then add recombinase, polymerase, single-stranded binding protein, hydrolysis buffer, magnesium acetate solution and ddH2O and mix well, and perform recombinase-mediated isothermal amplification;
[0013] Step 2: Bind the RPA amplification product to the resuspended magnetic beads, wash the magnetic beads with 500 μL of 0.1 M PBST, and magnetically separate and discard the supernatant;
[0014] Step 3: Incubate with 250 μL of the above PBST and 4 μL of the 1 mM probe described in claim 2, finally add 50 μL of 0.5 M sucrose for catalytic reaction, magnetically separate, take the supernatant and detect it with a blood glucose meter, and perform result interpretation.
[0015] Further defined, the conditions for the recombinase-mediated isothermal amplification in Step 1 are 37-42 °C for 30 min; the conditions for the recombinase-mediated isothermal amplification are 42 °C; the RPA reaction system is 50 μL and includes the following substances: 2.4 μL each of the upstream and downstream primers with a concentration of 10 μM, 29.5 μL of Primer Free Rehydration buffer, 2 μL of DNA template, 8.2 μL of ddH2O. After mixing, transfer it to a reaction tube containing the freeze-dried powder of recombinase, polymerase, and single-stranded binding protein, and finally add 2.5 μL of magnesium acetate solution with a concentration of 280 mM.
[0016] Further defined, the interpretation criterion in Step 3 is: if the blood glucose meter reading is lower than 28 mmol / L, it is determined that the amplification product is positive, indicating the presence of monkey B virus in the sample to be tested; if the blood glucose meter reading is higher than or equal to 28 mmol / L, it is determined that the amplification product is negative, indicating the absence of monkey B virus in the sample to be tested.
[0017] Beneficial effects: (1) The detection method established by the present invention can detect monkey B virus with high specificity. In the early stage of the present invention, the gene sequences of monkey B virus were analyzed and compared, and the sequence shown in SEQ ID NO.5 was selected as the target, and its target sequence is highly conserved in the genes of different strains of monkey B virus. And through specific evaluation, it was verified that the primers and probes used in the present invention have no cross-reaction with monkeypox virus, vaccinia virus (Tian Tan strain), cowpox virus, and varicella-zoster virus.
[0018] (2) The detection method established in the present invention has a minimum detection limit of 0.35 copies / μL of positive plasmid. Compared with the gold standard virus isolation and culture, it overcomes the limitations of strict requirements for laboratory conditions, dependence on power supply equipment support, and time-consuming operation.
[0019] (3) The kit of the present invention combines isothermal amplification technology with a blood glucose monitoring device, effectively avoiding the dependence on precise temperature control equipment in traditional nucleic acid amplification detection. This kit can achieve efficient amplification of the target gene of monkey B virus in a constant temperature environment. Further, the digital detection function of a blood glucose meter is used to interpret the amplification results, not only realizing the quantitative analysis of the detection results, but also reducing the dependence on large experimental instruments and professional technical personnel. This detection method has high stability and reliability and has the potential for digital detection at the disease site. Description of the Drawings
[0020] Figure 1 It is a graph of the optimization result of the optimal amplification temperature of the digital detection method for monkey B virus nucleic acid;
[0021] Figure 2 It is a graph of the sensitivity evaluation result of the digital detection method for monkey B virus nucleic acid;
[0022] Figure 3 It is a graph of the specificity evaluation result of the digital detection method for monkey B virus nucleic acid;
[0023] Figure 4 It is a graph of the evaluation result of the digital detection method for monkey B virus nucleic acid. Detailed Description of the Invention
[0024] Example 1: A primer composition for detecting monkey B virus
[0025] Obtaining primers and probes for detecting monkey B virus: According to the RPA primer design principle, a primer and probe for detecting monkey B virus were designed. For the primers and probes of the digital detection method for monkey B virus nucleic acid (hereinafter simply written as the RPA-PGM method) targeting the sequence shown in SEQ ID NO.5, the nucleotide sequence of the upstream primer FI is shown in SEQ ID NO.1 (5’-CGCATCGAGTTCTGCATGATGACGTTGTCG-3’); the downstream primer RI was obtained by modifying the 5’ end of the sequence shown in SEQ ID NO.2 (5’-CGTACGACCACATCCAGCGGCACGTCAACG-3’) with biotin;
[0026] The probe Thiol-P is modified with thiol at the 5'-end of a nucleotide sequence as shown in SEQ ID NO.3 (5’-CGTTGACGTGCCGCTGGATG-3’), and modified with C3-Spacer (polymer extension blocker) at the 3'-end. The specific steps are as follows: first, activate the probe, that is, use Tris-(2-carboxyethyl)-phosphine (TCEP) to reduce the thiol of Thiol-P to a mercapto group. Add 30 μL of Thiol-P (1 mM), 2 μL of 1 M PBS, and 2 μL of 30 mM TCEP to a 1.5 mL centrifuge tube, mix well, and place it at room temperature with gentle shaking for incubation for 1 h. The excess TCEP can completely reduce Thiol-P to a mercaptoylated probe (Sulfydryl-P). Transfer the mixture to a 10 KD ultrafiltration concentrator tube, centrifuge at 8000 rpm / min at 4°C for 5 min, and then replace the activation solution with 100 μL of 0.1 M PBS (pH = 7.5). Repeat the above steps 7 times to completely remove the excess TCEP. Concentrate Sulfydryl-P to 30 μL and store it at 4°C for later use.
[0027] Then, invertase activation is carried out. The amino group on the protein can be linked to the maleimide group of 4-(N-maleimidomethyl)cyclohexane-1-carboxylic acid sulfosuccinimide ester (Sulfo-SMCC), and then the maleimide group of Sulfo-SMCC is used for molecular conjugation with the mercapto group, thereby bridging the protein and the mercaptoylated molecule. Weigh 1 mg of Sulfo-SMCC using a static-free weighing paper and dissolve it in 400 μL of sterile water containing 2 mg of invertase, and place it on a shaker for shaking incubation for 1 h. Centrifuge at 8000 rpm / min for 5 min to remove the undissolved Sulfo-SMCC. Transfer the supernatant to a 100 KD ultrafiltration concentrator tube and centrifuge at 10000 rpm / min at 4°C for 8 min. Replace the activation solution with 100 μL of 0.1 M PBS. Repeat the above steps 7 times. The volume of the concentrated mixture is about 400 μL, and store it at 4°C for later use.
[0028] Finally, mix 30 μL of purified Sulfydryl-P with 400 μL of activated invertase evenly, let it stand at room temperature for 48 h, and invert and mix it 3 times every 12 h. Through the above operations, a detection probe labeled with invertase is prepared. To remove the Sulfydryl-P that did not participate in the coupling reaction, transfer the detection probe to a 100 KD ultrafiltration concentrator tube and wash it 8 times with 0.1 M PBS. Dilute the purified detection probe to a volume of 250 μL and store it at 4°C.
[0029] Example 2: A nucleic acid digitization method for detecting simian B virus for non-diagnostic purposes
[0030] (1) Establishment of the RAA-PGM Detection System
[0031] Using the positive plasmid pcDNA3.1-MB containing the simian B virus SEQ ID NO.4 as a template, the nucleotide sequence of pcDNA3.1-MB is shown in SEQ ID NO.4. The RPA-PGM amplification method was established using the RPA nfo kit from TwistDx, UK. The reaction system was 50 μL, with 2.4 μL each of the upstream and downstream primers at a concentration of 10 μM, 29.5 μL of Primer Free Rehydration buffer, 2 μL of template, and 8.2 μL of ddH2O. After mixing, the 47.5 μL of the above system was mixed well and added to a reaction tube containing lyophilized powder (containing recombinase, polymerase, and single-stranded binding protein), and pipetted until completely dissolved. Then, 2.5 μL of a magnesium acetate solution with a concentration of 280 mM was added to the reaction tube, and after mixing evenly, RPA was performed. The amplification conditions were incubation in a constant temperature water bath at 42°C for 30 min. Subsequently, 45 μL of the RPA amplification product was bound to 1 mg of streptavidin-coated magnetic beads with a diameter of 0.5 μm at room temperature for 30 min. The magnetic beads were washed with 500 μL of 0.1 M (pH = 7.5) PBST, and the supernatant was discarded by magnetic separation; then, 250 μL of the above PBST and 4 μL of the conjugated probe were added for incubation. Finally, 50 μL of 0.5 M sucrose was added to carry out the enzyme-catalyzed reaction. Again, using the magnetic separation technique, the supernatant was taken and detected using a blood glucose meter, and then the results were analyzed and interpreted.
[0032] Read the value of the blood glucose meter. If the value of the blood glucose meter is lower than 28 mmol / L, the sample contains the target DNA and the amplification product is positive; if the value of the blood glucose meter is higher than or equal to 28 mmol / L, the sample does not contain the target DNA and the amplification product is negative.
[0033] SEQ ID NO.4:
[0034]
[0035] SEQ ID NO.5:
[0036] CGCATCGAGTTCTGCATGATGACGTTGTCGGGGGTCACGGGCACGCAGGTGGAGACGGCCATCACGTCCCCGAGCATCCGCGCGCTCACCCGGCGGCCGACGGTGGCCGAGGCGATGGCGTTGGGGTTCAGCTTGCGGGCCTCGTTCCACAGCGTCAGCTCGTGGTTCTGGAGCTCACACCAGGCGATGGCGATGCGCCCCAGCATGTCGTTGACGTGCCGCTGGATGTGGTCGTACG。
[0037] (2) Optimization of RPA-PGM Amplification Temperature
[0038] The positive plasmid pcDNA3.1-MB with a concentration of 3.15×10 10 copies / μL was serially diluted 10-fold to 3.5×10 -2 copies / μL and used as the template for the RPA-PGM method. Amplification was carried out at 37°C, 39°C, and 42°C for 30 min according to the above system to screen the optimal amplification temperature. The RPA amplification product was combined with magnetic beads, and the magnetic beads were washed with 500 μL of 0.1 M (pH = 7.5) PBST, and the supernatant was discarded by magnetic separation; 250 μL of the above PBST and 4 μL of the probe were added for incubation. Finally, 50 μL of 0.5 M sucrose was added for the catalytic reaction, and the supernatant was taken by magnetic separation and detected using a blood glucose meter. The results showed that under the conditions of 39 - 42°C, the lowest detection limit of the RPA-PGM method was 0.35 copies / μL; see Figure 1 . Therefore, the optimal amplification temperature of the RPA-PGM method was determined to be 42°C.
[0039] (3) Sensitivity Evaluation of the Digital Detection Method for Monkey B Virus Nucleic Acid
[0040] The sensitivity of the method of the present invention was evaluated using the full-length positive plasmid pcDNA3.1-MB containing the gB gene sequence shown in SEQ ID NO.4 of monkey B virus as the detection template, and the specific sequence information is shown in SEQ ID NO.4.
[0041] The positive plasmid pcDNA3.1-MB was serially diluted 10-fold. After amplification at 42 °C for 30 min according to the RPA-PGM detection system established in Example 1, the RPA amplification product was combined with magnetic beads. The magnetic beads were washed with 500 μL of 0.1 M (pH = 7.5) PBST, and the supernatant was discarded by magnetic separation. 250 μL of the above PBST and 4 μL of the probe described in Claim 2 were added for incubation. Finally, 50 μL of 0.5 M sucrose was added for the catalytic reaction, and the supernatant was taken by magnetic separation and detected using a blood glucose meter. The results showed that the sensitivity of the above nucleic acid digital detection method was 0.35 copies / μL of positive plasmid, as shown in Figure 2 。
[0042] (4) Specificity evaluation of the nucleic acid digital detection method for simian B virus
[0043] Since monkeypox virus (MPXV), vaccinia virus (Tian Tan strain) (VTT), cowpox virus (CPXV), varicella-zoster virus (VZV), etc. can all cause skin vesicular lesions, it is difficult to accurately identify the type of pathogen infected by relying solely on clinical symptoms. Therefore, the detection technology for monkeypox virus must be specific to ensure no cross-reaction with other orthopoxviruses, thus avoiding misleading clinical treatment decisions. In this invention, the DNA of viruses such as monkeypox virus (MPXV), vaccinia virus (Tian Tan strain) (VTT), varicella-zoster virus (VZV), etc., and the recombinant plasmid of cowpox virus (CPXV), and the positive plasmid pcDNA3.1-MB containing the sequence shown in SEQ ID NO.4 of simian B virus were used as templates to evaluate the specificity of the nucleic acid digital detection method for simian B virus.
[0044] The results showed that the RPA-PGM method for simian B virus was only positive in the detection result of the positive plasmid pcDNA3.1-MB, while negative in the detection results of monkeypox virus, vaccinia virus (Tian Tan strain), recombinant plasmid of cowpox virus, and varicella-zoster virus DNA, as shown in Figure 3 。The results indicated that the nucleic acid digital detection method for simian B virus established in this invention had no cross-reaction with monkeypox virus, vaccinia virus (Tian Tan strain), varicella-zoster virus, etc., and this method had high specificity.
[0045] (5) Evaluation of the nucleic acid digital detection method for simian B virus using simulated clinical samples
[0046] Clinical applicability is a key indicator for evaluating detection methods. To verify the applicability of the method proposed in this study in a clinical setting, genomic DNA was extracted from Vero cells. Positive plasmid pcDNA3.1-MB containing the sequence shown in SEQ ID NO.4 of simian B virus at different concentrations was mixed with the extracted genomic DNA of Vero cells and used as samples for detection. 70 simulated clinical samples were set up in the experiment. The detection results showed that the proportion of positive samples detected by the RPA-PGM method was 64.3% (45 / 70), as shown in Figure 4 (a). The proportion of positive samples detected by the qPCR method was 57.1% (40 / 70), as shown in Figure 4 (b), and the sensitivity of the RPA-PGM method was higher than that of the qPCR method.
[0047] Example 3: A kit for digital detection of simian B virus nucleic acid
[0048] The composition for simian B virus detection obtained in Example 1, positive plasmid pcDNA3.1-MB containing the sequence shown in SEQ ID NO.4 of simian B virus, Primer Free Rehydration Buffer, magnesium acetate, a freeze-dried powder tube containing enzyme preparations (recombinase, polymerase, single-stranded binding protein), ddH2O, a digital detection device for a blood glucose meter, and an eight-well strip were assembled into a 96T kit for simian B virus detection.
[0049] In summary, the present invention utilizes a blood glucose meter to read the concentration of the target gene in the reaction solution, achieving low-cost and precision instrument-free detection of simian B virus, enabling sensitive and portable quantitative detection, and solving the problem of point-of-care testing (POCT). It provides an efficient and accurate solution for large-scale screening.
[0050] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Any person familiar with this technology can make various modifications and refinements without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.
Claims
1. A primer combination for digital detection of monkey B virus nucleic acid, characterized in that, The sequences of the primer pairs are shown in SEQ ID NO.1 and SEQ ID NO.
2.
2. The primer combination according to claim 1, characterized in that, It also includes that the probe sequence is modified with thiol at the 5' end of the nucleotide sequence shown in SEQ ID NO.3 and modified with C3-Spacer at the 3' end, and is reduced to a thiolated probe.
3. Use of the primer combination according to claim 1 or 2 in the preparation of a kit or reagent for digital detection of monkey B virus nucleic acid.
4. A digital detection kit for monkey B virus nucleic acid, characterized in that, The kit includes the primer combination according to claim 1 or claim 2.
5. The kit according to claim 4, wherein The kit also includes Primer Free Rehydration buffer, recombinase, polymerase, single-stranded binding protein, magnesium acetate solution and magnetic beads.
6. The kit according to claim 4, wherein The primer concentration is 10 μM.
7. The kit according to claim 4, wherein The kit also includes a positive control and a negative control. The positive control is a plasmid containing the sequence shown in SEQ ID NO.4, and the negative control is an empty vector.
8. A method of using the kit according to any one of claims 4-7 for non-diagnostic purposes, characterized in that, The steps of the method are as follows: Step 1: Add the DNA of the sample to be tested to a reagent containing the primers shown in SEQ ID NO.1 and SEQ ID NO.2, recombinase, polymerase, single-stranded binding protein, hydrolysis buffer, magnesium acetate solution and ddH2O, mix well, and perform recombinase-mediated isothermal amplification. Step 2: Bind the RPA amplification product to streptavidin-coated magnetic beads, wash the magnetic beads with 500 μL of 0.1 M PBST, and magnetically separate and discard the supernatant. Step 3: Incubate with 250 μL of the above PBST and 4 μL of the 1 mM probe described in claim 2, finally add 50 μL of 0.5 M sucrose for catalytic reaction, magnetically separate, take the supernatant and detect it with a blood glucose meter, and interpret the results.
9. The method according to claim 8, wherein The conditions for the recombinase-mediated isothermal amplification in Step 1 are 37 - 42 °C for 30 min; the conditions for the recombinase-mediated isothermal amplification are 42 °C; the RPA reaction system is 50 μL, including the following substances: 2.4 μL each of the upstream and downstream primers with a concentration of 10 μM, 29.5 μL of Primer Free Rehydration buffer, 2 μL of DNA template, 8.2 μL of ddH2O. After mixing, transfer it to a reaction tube containing freeze-dried powders of recombinase, polymerase and single-stranded binding protein, and finally add 2.5 μL of magnesium acetate solution with a concentration of 280 mM.
10. The method according to claim 8, wherein The interpretation criterion in Step 3 is: If the blood glucose meter reading is lower than 28 mmol / L, it is determined that the amplification product is positive, indicating the presence of monkey B virus in the sample to be tested; if the blood glucose meter reading is higher than or equal to 28 mmol / L, it is determined that the amplification product is negative, indicating the absence of monkey B virus in the sample to be tested.