Kit for rapidly and quantitatively detecting methylation of C promoter of EB (Epstein-Barr) virus

Through the improved MSRE-qPCR technology, the use of specific primers and probe design and combined with signal calibration, the rapid and accurate quantitative detection of EB virus C promoter methylation in nasopharyngeal carcinoma diagnosis is achieved, solving the complex and time-consuming problems in the prior art, and improving the accuracy and stability of the detection.

CN120272653APending Publication Date: 2025-07-08SUN YAT SEN UNIVERSITY CANCER CENTER (CANCER HOSPITAL AFFILIATED TO SUN YAT SEN UNIVERSITY CANCER RESEARCH INSTITUTE OF SUN YAT SEN UNIVERSITY)
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510655260.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-21
Publication Date
2025-07-08

AI Technical Summary

Technical Problem

The existing DNA methylation detection technology has problems such as cumbersome operation, long time consuming, expensive equipment and inability to achieve rapid and accurate quantification in the diagnosis of nasopharyngeal carcinoma. In particular, MSRE technology cannot complete the relative quantitative detection of methylation and non-methylation in a single tube, and the enzyme cutting efficiency is unstable, which affects the reliability of the detection results.

Method used

Using improved MSRE-qPCR technology, by designing specific primers and probes, combining phosphorothioate bond modified primers, the simultaneous detection of methylated and unmethylated DNA in a single tube is achieved, signal calibration is used for use with calibrators and unmethylated standards, and enzyme concentration and reaction conditions are optimized to achieve rapid and accurate quantity detection.

Benefits of technology

It realizes rapid and simple quantitative detection of the methylation level of EB virus C promoter in a single tube, reduces operational complexity and detection time, improves the accuracy and stability of the detection results, and supports early accurate screening of nasopharyngeal carcinoma.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120272653A_ABST
    Figure CN120272653A_ABST
Patent Text Reader

Abstract

The invention relates to a kit for rapidly and quantitatively detecting methylation of an EB (Epstein-Barr) virus C promoter, and belongs to the technical field of gene detection. The kit comprises two pairs of specific primers for amplifying the EB virus C promoter sequence, a methylation detection probe, a universal detection probe, an unmethylated standard substance and a calibrator. According to the kit disclosed by the invention, the MSRE technology is optimized and improved, so that the MSRE technology and the qPCR technology can be subjected to an integrated reaction, and rapid, simple and convenient quantitative detection on Cp methylation is achieved. According to the invention, a calculation and calibration mode of the digestion efficiency of MSRE detection is provided for the first time, the contained calibrator can calibrate an original qPCR result, and the unmethylated standard substance can realize monitoring of the digestion efficiency of MSRE and secondary calibration of the result, so that the accuracy of the result is remarkably improved, and technical support is provided for early accurate screening of nasopharyngeal carcinoma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and particularly to a kit for rapid quantitative detection of Epstein-Barr virus C promoter methylation. Background Art

[0002] Nasopharyngeal carcinoma (NPC) is a malignant tumor that occurs in the nasopharyngeal cavity. Early diagnosis of nasopharyngeal carcinoma is the main factor determining the treatment effect, but it still faces great challenges. Epstein-Barr virus (EBV) is a human herpesvirus that is closely related to the occurrence of various malignant tumors, especially an important carcinogen for nasopharyngeal carcinoma (NPC). At present, Epstein-Barr virus antibodies (EBNA1 / VCA-IgA) are used as conventional diagnostic markers for nasopharyngeal carcinoma, but their sensitivity is only 70% - 80%, and the false positive rate is as high as over 90%. There is an urgent need to develop more accurate diagnostic markers for nasopharyngeal carcinoma.

[0003] The C promoter (Cp) is an important element that regulates the expression of Epstein-Barr virus latency genes. Changes in its methylation level directly affect the latency and tumorigenic potential of the virus. Detection of Cp methylation of Epstein-Barr virus derived from nasopharyngeal swabs has the advantages of high sensitivity (early stage: 93.8%; late stage: 96.7%) and specificity (>90%) for nasopharyngeal carcinoma. Cp methylation detection can not only detect early micro-lesions (AUC = 0.93), but also effectively distinguish between benign and malignant nasopharyngeal lesions. However, traditional DNA methylation detection methods rely on bisulfite conversion, which has problems such as cumbersome operation, long time consumption (more than 5 hours), and dependence on expensive PCR equipment, seriously restricting the popularization and application of DNA methylation detection in clinical practice. Existing other methylation detection technologies such as methylation-specific PCR (MSP) can perform semi-quantitative detection of Cp methylation, but have low sensitivity and cumbersome operation; pyrosequencing has high precision, but the equipment is expensive, the operation is complex, and data analysis depends on a computing platform, making it difficult to achieve point-of-care testing. Therefore, there is an urgent need to optimize existing DNA methylation detection technologies to achieve simple and rapid detection, so as to provide an accurate, simple and rapid detection platform for clinical use.

[0004] Methylation-Sensitive Restriction Enzyme (MSRE) is a molecular tool that can distinguish methylated and unmethylated DNA without bisulfite treatment, with the advantages of mild reaction conditions and simple operation procedures. MSRE can identify specific unmethylated restriction sites and cleave them, but has no cleavage effect on methylated sites. Therefore, it is suitable for the discrimination of methylation status and is widely used in DNA methylation detection strategies. Although MSRE shows certain potential in DNA methylation detection, there are still significant limitations in its practical application: (1) The detection of MSRE is usually qualitative. If quantitative detection is required, it needs to be processed in separate tubes, that is, the digested and undigested samples are detected separately, and relative quantitative detection cannot be completed in a single tube, increasing the experimental steps and error risks; (2) The digestion efficiency of MSRE has a great impact on the results. Incomplete digestion will lead to false positives, thus affecting the stability and reliability of the detection results; (3) In clinical samples such as nasopharyngeal swabs, the relative content of Epstein-Barr virus DNA is low and fluctuates greatly among different nasopharyngeal swabs, further exacerbating the technical challenges in MSRE detection. Therefore, there is an urgent need to develop an MSRE-derived technology that can complete relative quantification of methylation and unmethylation in a single tube and has an inherent calibration ability for digestion efficiency to solve the bottleneck problem of existing MSRE technologies in clinical translation. Summary of the Invention

[0005] The object of the present invention is to provide a kit for rapid quantitative detection of Epstein-Barr virus C promoter methylation. The kit of the present invention optimizes and improves the MSRE technology (methylation-sensitive restriction enzyme) so that it can detect methylation and unmethylation simultaneously in an integrated qPCR reaction system, achieving rapid and simple quantitative detection of the Cp methylation level, overcoming the defects of long detection cycle, complex operation and inability to accurately quantify in the prior art, and providing technical support for the early precise screening of nasopharyngeal carcinoma.

[0006] In order to achieve the above-mentioned invention object, the present invention provides the following technical solutions:

[0007] The present invention provides a kit for quantitative detection of Epstein-Barr virus C promoter methylation based on MSRE technology, including 2 pairs of specific primers for amplifying Epstein-Barr virus C promoter sequence, methylation detection probe, universal detection probe, calibrator, unmethylated standard;

[0008] Among the 2 pairs of specific primers for amplifying Epstein-Barr virus C promoter sequence, one pair is SEQ ID NO.1 and SEQ ID NO.3, and the other pair is SEQ ID NO.2 and SEQ ID NO.4, and the 5' ends of the specific primers SEQ ID NO.1-4 are all modified with phosphorothioate bonds;

[0009] The sequence of the methylation detection probe is as shown in SEQ ID NO.5;

[0010] The sequence of the universal detection probe is as shown in SEQ ID NO.6;

[0011] The sequence of the calibrator is as shown in SEQ ID NO.7;

[0012] The unmethylated standard is a double-stranded sequence, specifically as shown in SEQ ID NO.8-9.

[0013] Preferably, the CpG site sequence of the Epstein-Barr virus C promoter methylation is as shown by the capitalized CG in SEQ ID NO.10.

[0014] Preferably, both the 5'-ends of the methylation detection probe and the universal detection probe are labeled with a fluorescent group;

[0015] The fluorescent group carried at the 5'-end of the methylation detection probe is FAM, and the fluorescent group carried at the 5'-end of the universal detection probe is TexadRed.

[0016] Preferably, both the 3'-ends of the methylation detection probe and the universal detection probe are labeled with a quenching group, and the quenching group is MGB.

[0017] Preferably, the kit further includes 10X rCutSmart TM Buffer, Taq DNA polymerase, NEB-Hpy99I, dNTPs, and water.

[0018] Preferably, the method for using the kit includes the following steps:

[0019] (6.1) Extract the sample DNA;

[0020] (6.2) Mix the extracted sample DNA with the 2 pairs of specific primers for amplifying the Epstein-Barr virus C promoter sequence as claimed in claim 1, 10X rCutSmart TM Buffer, Taq DNA polymerase, NEB-Hpy99I, dNTPs, and water, and perform quantitative detection of Epstein-Barr virus C promoter methylation in a single tube;

[0021] (6.3) Calibrate the fluorescence signals of the two detection channels using the calibrator, and quantitatively calculate the Epstein-Barr virus C promoter methylation level in the sample by using the unmethylated standard and the corresponding methylation ratio calibration formula.

[0022] Preferably, the detection system for quantitative detection of Epstein-Barr virus C promoter methylation, based on 20 μL, includes: 10X rCutSmart TM Buffer 2.0 μL, Taq DNA polymeraseL 0.1 μL, NEB-Hpy99I 0.15 μL, dNTPs 0.2 μL, each specific primer 0.48 μL, methylation detection probe 0.1 μL, universal detection probe 0.1 μL, sample DNA 2.5 μL, water 12.93 μL.

[0023] Preferably, the detection procedure for quantitative detection of Epstein-Barr virus C promoter methylation is: 37 °C for 60 min, 1 cycle, 95 °C for 3 min, 1 cycle, 95 °C for 10 s, 60 °C for 30 s, 40 cycles.

[0024] Preferably, the methylation ratio calibration formula is:

[0025] M true = [2^(-CqFAM) - (1 - a)×2^(-CqTexasRed)] / [a×2^(-CqTexasRed)] (Equation 1)

[0026] Wherein, CqFAM is the Cq value of the FAM channel of the detection sample, CqTexasRed is the Cq value of the TexasRed channel of the detection sample, and a is the digestion efficiency of the unmethylated standard;

[0027] a = 1 - {1 / [2^(CqFAM (未甲基化标准品) - CqTexasRed (未甲基化标准品) )]} (Equation 2)

[0028] Wherein, CqFAM (未甲基化标准品) is the Cq value of the FAM channel of the unmethylated standard, and CqTexasRed (未甲基化标准品) is the Cq value of the TexasRed channel of the unmethylated standard.

[0029] The present invention provides a reagent for diagnosing or screening nasopharyngeal carcinoma, and the reagent includes the said kit.

[0030] The present invention has the following technical effects and advantages:

[0031] 1. The traditional MSRE-qPCR reaction can only perform qualitative reactions, that is, to determine the presence or absence of methylated DNA. The kit of the present invention first uses MSRE-qPCR to achieve quantitative detection of the methylation ratio of specific Cp sites, and can accurately detect the CpG methylation ratio of the target site.

[0032] 2. The present invention for the first time uses two thiol-modified primers, significantly reducing the mutual interference between two amplicons during amplification, achieving segmental amplification detection under the same amplicon, and enabling it to detect without additionally detecting human or Epstein-Barr virus gene fragments as a reference.

[0033] 3. The kit of the present invention does not require bisulfite conversion. Compared with traditional bisulfite conversion, the reaction time of the MSRE-CpMQ technology using the kit of the present invention can be as short as within one hour, approximately one-fifth of the detection time of the traditional method. Therefore, the kit of the present invention can achieve rapid and efficient Cp methylation detection, supporting the rapid detection requirements of nasopharyngeal carcinoma.

[0034] 4. The kit of the present invention for the first time proposes a calculation and calibration method for the digestion efficiency of MSRE detection. The calibration products and unmethylated standards contained therein can calibrate the original detection signal and the digestion efficiency of MSRE, and the two calibrations significantly improve the accuracy of the results.

[0035] 5. The present invention has found the reaction concentrations of Hpy99I enzyme and Taq enzyme. According to the optimal enzyme concentrations provided by the manufacturer, an integrated reaction of MSRE and qPCR cannot be carried out. It is necessary to dilute Hpy99I by 6.6 times and Taq enzyme by 10 times before an integrated reaction can be carried out.

[0036] 6. The present invention for the first time has found that the digestion efficiency of Hpy99I enzyme for digestion substrates with different concentrations is almost the same, proving that its digestion efficiency is not affected by the substrate concentration and is constant in a single reaction. Therefore, the results of other samples in the same reaction can be calibrated according to the digestion efficiency of the unmethylated standard. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 is the methylation profile of CpG sites in the full-length Epstein-Barr virus C promoter sequence;

[0038] Figure 2 is the schematic diagram of the MSRE-CpMQ technology detection principle;

[0039] Figure 3 is the influence of different input volumes of Hpy99I on the integrated reaction, where the blue line is Cq_FAM and the red line is Cq_TexasRed;

[0040] Figure 4 is the MSRE-CpMQ reaction curve of the gradient-diluted samples;

[0041] Figure 5 is the comparison of the detection results before calibration, after the first calibration, after the second calibration, and the E-CpMQ results. DETAILED DESCRIPTION OF THE INVENTION

[0042] The present invention provides a kit for quantitatively detecting the methylation of Epstein-Barr virus C promoter based on MSRE technology, which includes 2 pairs of specific primers for amplifying Epstein-Barr virus C promoter sequence, a methylation detection probe, a universal detection probe, a calibrator, and an unmethylated standard;

[0043] Among the 2 pairs of specific primers for amplifying Epstein-Barr virus C promoter sequence, one pair is SEQ ID NO.1 and SEQ ID NO.3, and the other pair is SEQ ID NO.2 and SEQ ID NO.4, which are specifically as follows:

[0044] SEQ ID NO.1: agtgctatctttggaacagtagaa;

[0045] SEQ ID NO.3: tgcgtcttgagctctcttattggc;

[0046] SEQ ID NO.2: tcgcaaagtatagtggccccgt;

[0047] SEQ ID NO.4: cctggtgttattaccactttagacgt;

[0048] Among them, the 5' ends of the specific primers SEQ ID NO.1-4 are all modified with phosphorothioate bonds;

[0049] The sequence of the methylation detection probe is as shown in SEQ ID NO.5, which is specifically as follows:

[0050] SEQ ID NO.5: ataacgccttatctgggagg;

[0051] The sequence of the universal detection probe is as shown in SEQ ID NO.6, which is specifically as follows:

[0052] SEQ ID NO.6: accttagaggtggagcaacgtc;

[0053] The sequence of the calibrator is as shown in SEQ ID NO.7, which is specifically as follows:

[0054] SEQ ID NO.7: gtgagtgctatctttggaacagtagaaaattgaaccttgttggcgggagaaggaataa cgccttatctgggaggaggattatagccaataagagagctcaagacgcagggctcgcaaagtatagtggccccgtg ggaccttagaggtggagcaacgtctaaagtggtaataacaccaggcggggctgggcaaaggggtcctacgggcg gg;

[0055] The unmethylated standard is a double-stranded sequence, including a sense strand and an antisense strand. The specific sequences are shown in SEQ ID NO.8-9:

[0056] SEQ ID NO.8 (sense strand):

[0057] agtgctatctttggaacagtagaaaattgaaccttgttggcgggagaaggaataacgccttatctgggaggagcgacggattatagccaataagagagctcaagacgcagggctcgcaaagtatagtggccccgtgggaccttagaggtggagcaacgtctaaagtggtaataacaccaggcggggctgggcaaaggggtcctacgggcgggattaattacgccttgcttac;

[0058] SEQ ID NO.9 (antisense strand):

[0059] gtaagcaaggcgtaattaatcccgcccgtaggacccctttgcccagccccgcctggtgttattaccactttaga cgttgctccacctctaaggtcccacggggccactatactttgcgagccctgcgtcttgagctctcttattggctataatc cgtcgctcctcccagataaggcgttattccttctcccgccaacaaggttcaattttctactgttccaaagatagcact.

[0060] In the present invention, SEQ ID NO.1 and SEQ ID NO.3 (the first pair of primers) are used to amplify the uncut template DNA; SEQ ID NO.2 and SEQ ID NO.4 (the second pair of primers) can be used to simultaneously amplify the uncut and cut template DNA; the methylation detection probe (SEQ ID NO:5) is used to bind to the amplification product paired with the first pair of primers, so as to detect the content of methylated DNA not cut by MSRE; the universal detection probe (SEQ ID NO:6) is used to pair with the fragment amplified by the second pair of primers, so as to detect the total DNA content for control and calculation of the methylation ratio; the unmethylated standard is double-stranded DNA, including the sense strand (SEQ ID NO:8) and the antisense strand (SEQ ID NO:9), simulating the DNA sequence in the unmethylated state, which is used to evaluate the digestion efficiency of MSRE and correct the detection results.

[0061] In the present invention, the kit is applicable to rapidly and quantitatively detect the CpG methylation status of the Epstein-Barr virus C promoter region through the combined system of MSRE digestion and qPCR.

[0062] In the present invention, the CpG site sequence of the Epstein-Barr virus C promoter methylation is shown as the capitalized CG in SEQ ID NO.10, specifically as follows:

[0063] taaCGttttatttgggaggagCGaCGgattatagttaataagagagtttaagaCGtagggttCGtaaagtatagtggtttCGtgggattttagaggtggagtaaCGtttaaagtggtaataatattaggCGgggttgggtaaaggggttttaCGggCGggattaattaCGttttgtt.

[0064] In the present invention, the 5'-ends of both the methylation detection probe and the universal detection probe are provided with fluorescent groups;

[0065] The fluorescent group carried at the 5'-end of the methylation detection probe is FAM, and the fluorescent group carried at the 5'-end of the universal detection probe is TexadRed.

[0066] In the present invention, the 3'-ends of both the methylation detection probe and the universal detection probe are provided with quenching groups, and the quenching group is MGB.

[0067] In the present invention, the kit further includes 10X rCutSmart TMBuffer, Taq DNA polymerase, NEB-Hpy99I, dNTPs, water.

[0068] In the present invention, the method for using the kit comprises the following steps:

[0069] (6.1) Extract the sample DNA;

[0070] (6.2) Mix the extracted sample DNA with the 2 pairs of specific primers for amplifying the Epstein-Barr virus C promoter sequence as claimed in claim 1, 10X rCutSmart TM Buffer, Taq DNA polymerase, NEB-Hpy99I, dNTPs, water, and perform quantitative detection of Epstein-Barr virus C promoter methylation in a single tube;

[0071] (6.3) Calibrate the fluorescence signals of the two detection channels using a calibrator, and quantitatively calculate the Epstein-Barr virus C promoter methylation level in the sample by using the unmethylated standard and the corresponding methylation ratio calibration formula.

[0072] In the present invention, the sample is a nasopharyngeal swab.

[0073] In the present invention, the detection system for quantitative detection of Epstein-Barr virus C promoter methylation, calculated by 20 μL, comprises: 10XrCutSmart TM Buffer 2.0 μL, Taq DNA polymeraseL 0.1 μL, NEB-Hpy99I 0.15 μL, dNTPs 0.2 μL, each specific primer 0.48 μL, methylation detection probe 0.1 μL, universal detection probe 0.1 μL, sample DNA 2.5 μL, water 12.93 μL.

[0074] In the present invention, the detection program for quantitative detection of Epstein-Barr virus C promoter methylation is: 37 °C for 60 min, 1 cycle, 95 °C for 3 min, 1 cycle, 95 °C for 10 s, 60 °C for 30 s, 40 cycles.

[0075] In the present invention, the methylation ratio calibration formula is:

[0076] M true = [2^(-CqFAM) - (1 - a)×2^(-CqTexasRed)] / [a×2^(-CqTexasRed)] (Equation 1)

[0077] Wherein, CqFAM is the Cq value of the FAM channel of the detected sample, CqTexasRed is the Cq value of the TexasRed channel of the detected sample, and a is the digestion efficiency of the unmethylated standard;

[0078] a = 1 - {1 / [2^(CqFAM (未甲基化标准品) -CqTexasRed (未甲基化标准品) )]} (Formula 2)

[0079] Wherein, CqFAM (未甲基化标准品) is the Cq value of the FAM channel of the unmethylated standard, and CqTexasRed (未甲基化标准品) is the Cq value of the TexasRed channel of the unmethylated standard.

[0080] The present invention provides a reagent for diagnosing or screening nasopharyngeal carcinoma, and the reagent comprises the above-mentioned kit.

[0081] The technical solutions provided by the present invention will be described in detail below in conjunction with embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0082] Example 1: Determination of the methylation detection site of the Epstein - Barr virus C promoter

[0083] Using pyrosequencing, a total of 42 nasopharyngeal swab samples from the outpatient department of the Department of Nasopharyngeal Cancer, Sun Yat - sen University Cancer Center were detected, including 10 normal nasopharyngeal swabs and 32 nasopharyngeal swabs of nasopharyngeal carcinoma (4 cases of stage I, 8 cases of stage II, 10 cases of stage III, and 10 cases of stage IV). The results are as Figure 1 shown.

[0084] The CpG site sequences in the Epstein - Barr virus C promoter that can be methylated are shown as the capitalized CG in SEQ ID NO.10:[[]]

[0085] 5’ - taaCGttttatttgggaggagCGaCGgattatagttaataagagagtttaagaCGtagggttCGtaaagtatagtggtttCGtgggattttagaggtggagtaaCGtttaaagtggtaataatattaggCGgggttgggtaaaggggttttaCGggCGggattaattaCGttttgtt - 3’, and the CpG sites from the 5’ end to the 3’ end are CpG sites No. 1 - 11 in sequence.

[0086] By Figure 1It can be seen that CpG sites No. 1, 2, 3, and 6 can significantly distinguish early and late nasopharyngeal carcinoma samples from normal nasopharyngeal samples. Therefore, all four of these sites can be used as methylation detection sites. Among them, the two methylation sites at site 3 (V01555.2: 11062) and site 4 (V01555.2: 11065) can be recognized and cleaved by the Hpy99I restriction endonuclease, and the activity of this enzyme can be blocked by methylation modification. Therefore, it can be used to digest the unmethylated C promoter sequence.

[0087] Example 2: Establishment of a rapid Cp methylation detection technique (MSRE-CpMQ) based on the MSRE technique

[0088] 1. Determination of primers

[0089] In order to achieve the purpose of quantitatively detecting the Cp methylation ratio, after using MSRE to digest the unmethylated Cp, two pairs of primers and two probes were designed at the Cp position (Table 1). Among them, primer F1, primer R1, and probe P1 are used to detect the undigested methylated Cp sequence; while primer F2, primer R2, and probe P2 can detect all Cp sequences, whether methylated or unmethylated. By detecting the amplicons of the methylated sequence and the unmethylated sequence, quantitative detection of Cp site methylation can be achieved. The detection principle is as Figure 2 shown.

[0090] Table 1 Primer and probe sequences

[0091]

[0092]

[0093] After gradient dilution of the DNA samples from nasopharyngeal swabs, the samples were amplified using modified and unmodified primers respectively to judge the influence of different modified primers on the stability of qPCR reactions. The results are shown in Table 2.

[0094] Table 2 Influence of different modified primers on the stability of qPCR reactions

[0095]

[0096] As can be seen from Table 2, after gradient dilution of DNA samples from nasopharyngeal swabs, the use of thiophosphorothioate-modified primers can significantly reduce the coefficient of variation by 59.6% compared to ordinary primers (4.06% vs. 10.06%), demonstrating that thiophosphorothioate-modified primers can reduce the amplification interference between adjacent amplicons and enhance the stability of the reaction. The reason is that since the two amplicons are close in distance, there will be mutual influence during amplification (for example, the amplification initiated by the forward primer F1 will digest the amplicon of the forward primer F2, and the same is true for the reverse primer R2 digesting the amplicon of the reverse primer R1). Therefore, in order to reduce the influence between different amplicons, thiophosphorothioate-modified primers are used to inhibit the exonuclease activity of Taq enzyme. The primers have the following characteristics: the melting temperature of the forward primer F2 is higher than that of the forward primer F1; the melting temperature of the reverse primer R1 is higher than that of the reverse primer R2; the connection between the first 5 bases of the forward primer F2 and the reverse primer R1 is modified with a thiophosphate ester bond.

[0097] 2. Determination of the input amount of Hpy99I

[0098] In the previous tests, it was found that when the optimal input amount of Hpy99I (purchased from New England Biolabs) provided by the manufacturer (1 μL of Hpy99I per 20 μL system) was used, the overall Cq value was relatively late and the fluorescence intensity (RFU) was low. After adjusting various components in the reaction system, it was unexpectedly found that the concentration of Hpy99I enzyme had a great influence on the reaction. The results are as Figure 3 shown.

[0099] As Figure 3 can be seen, by reducing the input amount of Hpy99I to less than 0.2 μL, the subsequent qPCR reaction signal can be significantly enhanced.

[0100] In addition, it was found that by reducing the input amount of Taq enzyme, the Cq value could also be reduced (Table 3), that is, a decrease in the Taq enzyme concentration in the reaction system actually improved the amplification efficiency. This finding provides a new idea for optimizing the MSRE-qPCR integrated reaction system.

[0101] Table 3 Effects of different Hpy99I and Taq enzyme formulations on the MSRE-qPCR reaction

[0102]

[0103] Thus, the optimal detection system and detection procedure for performing the MSRE-CpMQ reaction in the present invention are shown in Table 4 and Table 5.

[0104] Table 4 MSRE-CpMQ detection system

[0105]

[0106]

[0107] Table 5 MSRE-CpMQ Detection Procedure

[0108]

[0109] The lower limit of detection was tested according to the detection systems in Table 4 and Table 5, and the results are shown in Table 6 and Figure 4 as follows.

[0110] Table 6 MSRE-CpMQ Reaction Results of Gradient-Diluted Samples

[0111] Sample Input Concentration (copies / μL) Cq_TexasRed Cq_FAM 1X 721800 18.79 17.72 10X 68430 22.35 21.17 100X 1864 27.44 26.29 1000X 446.8 29.47 28.26 10000X 42.15 33.13 31.82 100000X 3.427 37.11 36.13

[0112] As can be seen from Table 6 and Figure 4 it can be known that the MSRE-CpMQ reaction can detect samples with less than 10 copies / μL.

[0113] Example 3 Optimization of Cp Methylation Rapid Detection Technology (MSRE-CpMQ) Based on MSRE Technology

[0114] In practical applications, it was found that although the Hpy99I enzyme has a digestion effect on unmethylated Cp sequences, it cannot completely digest all unmethylated sequences. Even if the digestion time is increased, it cannot be completely digested, and the detection results are prone to false positives. When the present invention tested with Cp unmethylated DNA from B95-8 cell lines at different conventional concentrations, it was unexpectedly found that different concentrations of DNA with gradient dilution had almost the same digestion efficiency (Table 7), that is, the digestion efficiency was not affected by the substrate concentration.

[0115] Table 7 Comparison of Digestion Efficiencies of Unmethylated Cp DNA at Different Concentrations

[0116] Sample Cq_TexasRed Cq_FAM △Cq 2△Cq Digestion Efficiency B95-8.1 25.36 28.51 3.15 8.88 89% B95-8.2 26.31 29.48 3.17 9.00 89% B95-8.3 27.30 30.42 3.12 8.69 88% B95-8.4 28.30 31.48 3.18 9.06 89% B95-8.5 29.25 32.38 3.13 8.75 89% B95-8.6 30.15 33.46 3.31 9.92 90%

[0117] Based on this, the present invention first proposed a result calibration method for the MSRE-qPCR integrated detection technology to calibrate the influence of multi-channel detection and digestion efficiency on the results. The result calibration method of the present invention is divided into two steps:

[0118] ① When calibrating multi-channel detection, the threshold lines of different channels are delimited. By means of chemical synthesis, the Cp sequence was reconstructed so that the Hpy99I recognition sequence was not included in the sequence, thus preparing a calibration product (SEQ ID NO.7: gtgagtgctatctttggaacagtagaaaattgaaccttgttggcgggagaaggaataacgccttatctgggaggaggattatagccaataagagagctcaagacgcagggctcgcaaagtatagtggccccgtgggaccttagaggtggagcaacgtctaaagtggtaataacaccaggcggggctgggcaaaggggtcctacgggcggg). It is ensured that the calibration product can constantly hydrolyze the methylated probe P1 and the universal probe P2 at a ratio of 1:1 in one amplification cycle. During result analysis, the Cq values corresponding to the two channels only need to be adjusted to be consistent to complete the first calibration. The calibration effect is shown in Table 8. Using B95-8 cell DNA with unmethylated Cp and Raji cell DNA with methylated Cp, samples with 100% methylation and 50% methylation were prepared and serially diluted. The Cq values before calibration were the results automatically interpreted by the instrument. The methylation ratios calculated from the Cq values before calibration all exceeded 100%, and the average offsets from the true values reached -116.23% and -72.09%. After the threshold lines of the two channels were re-delimited with the calibration product, the accuracy of the detection results after calibration was greatly improved, and the average offsets from the true values were reduced to 3.20% and -5.20%, confirming that the calibration product of the present invention can greatly reduce the offset of the detection results.

[0119] ②Calibrate the influence of the digestion efficiency of Hpy99I on the detection results. As mentioned above, Hpy99I has a consistent digestion efficiency for samples with different concentrations. Therefore, the digestion efficiency of the current reaction can be measured through the unmethylated Cp sequence. In the present invention, PCR amplification was performed on the Cp sequence to obtain the unmethylated Cp sequence (SEQ ID NO.8: agtgctatctttggaacagtagaaaattgaaccttgttggcgggagaaggaataacgccttatctgggaggagcgacggattatagccaataagagagctcaagacgcagggctcgcaaagtatagtggccccgtgggaccttagaggtggagcaacgtctaaagtggtaataacaccaggcggggctgggcaaaggggtcctacgggcgggattaattacgccttgcttac; SEQ ID NO.9: gtaagcaaggcgtaattaatcccgcccgtaggacccctttgcccagccccgcctggtgttattaccactttagacgttgctccacctctaaggtcccacggggccactatactttgcgagccctgcgtcttgagctctcttattggctataatccgtcgctcctcccagataaggcgttattccttctcccgccaacaaggttcaattttctactgttccaaagatagcact), and it was used as the unmethylated standard. By detecting the digestion efficiency of this standard in the reaction, the results of the detected samples can be calibrated for the second time. As Figure 5 shown, samples with different methylation ratios were prepared using B95-8 cell DNA with unmethylated Cp and Raji cell DNA with methylated Cp, and the previously developed E-CpMQ technology was used as a control (patent number: 202210182834.3). Even after one calibration, although the correlation between the detection results and the true values was strong, there was still an offset. After the secondary calibration of the digestion efficiency of Hpy99I, the accuracy of the detection results was greatly improved. Not only was the correlation strong (slope = 1.04, R 2 = 1), but the average relative offset from the true results was only 1%, confirming that the two calibrations significantly improved the accuracy of the results.

[0120] Table 8 Comparison of the stability of the detection results of gradient-diluted samples before and after calibrating the channel threshold line

[0121]

[0122]

[0123] Experimental Example

[0124] Twenty-one nasopharyngeal carcinoma patients and 21 normal control subjects were recruited from the Sun Yat-sen University Cancer Center, and nasopharyngeal swabs were collected from all subjects. The DNA of the nasopharyngeal swabs was extracted using the QIAamp DNA Blood Minikit (51106) kit from QIAGEN. The experimental procedure was carried out exactly according to the kit instructions, and finally the DNA was dissolved in 100 μL of TE solution. For E-CpMQ detection, the DNA was subjected to bisulfite conversion using the EZ DNAMethylation-GoldTM Kit (D5005) from Zymo Research. The input DNA volume was 10 μL, and the elution volume was 10 μL. Finally, 2.5 μL of the converted DNA was used for E-CpMQ detection. The experimental procedure was carried out exactly according to the procedure described in the E-CpMQ patent (patent number: 202210182834.3). The detection results are shown in Table 9.

[0125] Table 9 Comparison of the detection performance between the MSRE-CpMQ technology and the E-CpMQ technology of the present invention

[0126]

[0127] As can be seen from Table 9, the AUC of both technical methods was as high as 0.96 or above (p = 0.95, no statistically significant difference). Taking the Cp methylation ratio ≥ 50% as the positive judgment value (cut-off value), the sensitivity and specificity of E-CpMQ were 100% and 90.5% respectively, and the sensitivity and specificity of MSRE-qPCR were both 95.2%. It can be seen that the detection performance of the kit of the present invention has no significant difference from that of the traditional bisulfite + qPCR E-CpMQ kit, and the detection specificity of the kit of the present invention is higher than that of the latter. It is speculated that the kit of the present invention can reduce the false positives in the detection at low DNA input amounts, so the detection specificity can be improved.

[0128] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A kit for quantitative detection of Epstein-Barr virus C promoter methylation based on MSRE technology, characterized in that, It includes 2 pairs of specific primers for amplifying the Epstein-Barr virus C promoter sequence, a methylation detection probe, a general detection probe, a calibrator, and an unmethylated standard; Among the 2 pairs of specific primers for amplifying the Epstein-Barr virus C promoter sequence, one pair is SEQ ID NO.1 and SEQ ID NO.3, and the other pair is SEQ ID NO.2 and SEQ ID NO.

4. The 5' ends of the specific primers SEQ ID NO.1-4 are all modified with phosphorothioate bonds; The sequence of the methylation detection probe is as shown in SEQ ID NO.5; The sequence of the general detection probe is as shown in SEQ ID NO.6; The sequence of the calibrator is as shown in SEQ ID NO.7; The unmethylated standard is a double-stranded sequence, specifically as shown in SEQ ID NO.8-9.

2. The kit according to claim 1, characterized in that, The CpG site sequence of the Epstein-Barr virus C promoter methylation is as shown by the capitalized CG in SEQ ID NO.

10.

3. The kit according to claim 1, characterized in that, Both the 5' ends of the methylation detection probe and the general detection probe are labeled with a fluorescent group; The fluorescent group carried by the 5' end of the methylation detection probe is FAM, and the fluorescent group carried by the 5' end of the general detection probe is TexadRed.

4. The kit according to claim 1, wherein Both the 3' ends of the methylation detection probe and the general detection probe are labeled with a quenching group, and the quenching group is MGB.

5. The kit according to any one of claims 1 to 4, characterized in that, The kit also includes 10XrCutSmart TM Buffer, Taq DNA polymerase, NEB-Hpy99I, dNTPs, and water.

6. The kit according to claim 5, wherein The usage method of the kit includes the following steps: (6.1) Extract the sample DNA; (6.2) Mix the extracted sample DNA with the 2 pairs of specific primers for amplifying the Epstein-Barr virus C promoter sequence described in claim 1, 10X rCutSmart TM Buffer, Taq DNA polymerase, NEB-Hpy99I, dNTPs, and water, and perform quantitative detection of Epstein-Barr virus C promoter methylation in a single tube; (6.3) Use the calibrator to calibrate the fluorescence signals of the two detection channels, and use the unmethylated standard and the corresponding methylation ratio calibration formula to quantitatively calculate the methylation level of the Epstein-Barr virus C promoter in the sample.

7. The kit according to claim 6, wherein, The detection system for quantitative detection of Epstein-Barr virus C promoter methylation, calculated as 20 μL, includes: 10X rCutSmart TM Buffer 2.0 μL, Taq DNA polymeraseL 0.1 μL, NEB-Hpy99I 0.15 μL, dNTPs 0.2 μL, each specific primer 0.48 μL, methylation detection probe 0.1 μL, universal detection probe 0.1 μL, sample DNA 2.5 μL, water 12.93 μL.

8. The kit according to claim 6, wherein The detection program for the quantitative detection of Epstein-Barr virus C promoter methylation is: 37°C for 60 min, 1 cycle, 95°C for 3 min, 1 cycle, 95°C for 10 s, 60°C for 30 s, 40 cycles.

9. The kit according to claim 6, wherein The methylation ratio calibration formula is: M true = [2^(-CqFAM) - (1 - a)×2^(-CqTexasRed)] / [a×2^(-CqTexasRed)] (Equation 1) Wherein, CqFAM is the Cq value of the FAM channel of the detected sample, CqTexasRed is the Cq value of the TexasRed channel of the detected sample, and a is the digestion efficiency of the unmethylated standard; a = 1 - {1 / [2^(CqFAM (未甲基化标准品) - CqTexasRed (未甲基化标准品) )]} (Equation 2) Among them, CqFAM (未甲基化标准品) is the Cq value of the FAM channel of the unmethylated standard, and CqTexasRed (未甲基化标准品) is the Cq value of the TexasRed channel of the unmethylated standard.

10. A reagent for diagnosing or screening nasopharyngeal carcinoma, characterized in that, The reagent includes the kit according to any one of claims 1-9.

Citation Information

Patent Citations

  • Kit for quantitative detection of EB virus Cp promoter methylation

    CN114574631A