Signal system for non-derailing three-drive DNA harvester to continuously and autonomously move along nanogold solidified nucleic acid substrate track, preparation method and application

Abstract

The invention relates to the field of molecular machines, in particular to a signal system for continuous autonomous movement of a derailment-free three-drive DNA harvester along a nanogold solidified nucleic acid substrate track, a preparation method and application. The signal system comprises a three-drive DNA harvester and a nanogold curing substrate track; the three-drive DNA harvester comprises a DNA tetrahedron, a nucleic acid aptamer used for recognizing target cells is assembled at one fixed point vertex of the DNA tetrahedron, and locking foot chains are assembled at the other three vertexes of the DNA tetrahedron; the nanogold curing and nucleic acid substrate orbital is formed by covalent binding of three linear sequences and nanogold particles and complementary pairing of part of basic groups; the three linear sequences are two split enzyme chains and a substrate chain, and the substrate chain modifies a fluorophore and has a deoxyribozyme digestion site. The signal system provided by the invention has the advantages of no cytotoxicity, nuclease degradation resistance, three-drive autonomous continuous movement, avoidance of orbital detachment and sequential precise recognition mediated by double biomarkers.

Description

Technical Field

[0001] The present invention relates to the field of molecular machines, and particularly relates to a signal system, a preparation method and an application of a triple-driven DNA harvester that continuously moves autonomously along a nucleic acid substrate track solidified with nano-gold without derailment. Background Art

[0002] All kinds of molecular machines have highly refined and hierarchical operating mechanisms to ensure the precise operation of various biological functions in organisms. Based on molecular protein motors, cells have achieved a high degree of organization of cell molecules and organelles in space and time. DNA oligonucleotides have the characteristics of good biocompatibility, high programmability, diverse functions, easy availability and strong predictability. They are a powerful and versatile molecular material that can be used to assemble various nano-scale structures and complete expected tasks in biological and medical research centers. Inspired by the complex movement behaviors of molecular motors in nature and the emergence and development of DNA nanotechnology, researchers have designed various artificial intelligent DNA machines to efficiently execute nano-scale movements, with remarkable autonomy and controllability, and can be used for molecular sensing, programmable chemistry, and intelligent transportation of nano-scale cargo from one position to another along a specified track.

[0003] The main dynamic characteristics of molecular machines include good adhesion to the track during movement, high directionality of preferentially migrating to a specific destination, and the ability to autonomously perform repetitive and progressive movements without further auxiliary stimuli. However, DNA lacks the versatility of proteins and RNAs that have evolved through natural environmental selection by cells or the body. Therefore, it is still a formidable challenge to construct a DNA machine that can respond to external environmental changes with collective and predictable behaviors. DNA walkers can convert chemical energy into mechanical kinetic energy under specific fuels or stimuli and walk along one-dimensional (1D) DNA-specified directional paths and two-dimensional (2D) different specified paths, but their low processing ability and limited tracks limit their applications. The three-dimensional (3D) spherical DNA architecture of non-nucleic acid particles supports an inherently large space, a sufficient number of tracks, easy internalization, and protection of nucleic acids from nuclease degradation, thus achieving a longer walking distance and stable operating ability. However, there is an inevitable contradiction between the number of feet of DNA walkers and the movement speed, that is, too few or too many feet will respectively lead to derailment or low movement speed. Therefore, it is still a formidable challenge to construct a DNA machine that can respond to external environmental changes with collective and predictable behaviors. Summary of the Invention

[0004] To solve the above problems, the present invention provides a signal system based on the continuous autonomous movement of a three-driven DNA harvester along a nucleic acid substrate track solidified with gold nanoparticles without derailment, and its preparation method and application. The signal system provided by the present invention has the advantages of no cytotoxicity, resistance to nuclease degradation, three-driven autonomous continuous movement, avoidance of derailment, and sequential precise recognition mediated by dual biomarkers.

[0005] To achieve the above object, the present invention provides the following technical solutions:

[0006] In the first aspect of the present invention, there is provided a signal system for the continuous autonomous movement of a three-driven DNA harvester along a nucleic acid substrate track solidified with gold nanoparticles without derailment, including a three-driven DNA harvester and a gold nanoparticle-solidified substrate track;

[0007] The three-driven DNA harvester includes a DNA tetrahedron, and a nucleic acid aptamer for recognizing target cells is assembled at one fixed vertex of the DNA tetrahedron, and locking foot chains are assembled at the remaining three vertices;

[0008] The DNA tetrahedron is assembled from sequences Sa, Sb, Sc, and Sd. The nucleotide sequence of Sa is as shown in SEQ ID NO.1; the nucleotide sequence of Sb is as shown in SEQ ID NO.2; the nucleotide sequence of Sc is as shown in SEQ ID NO.3; the nucleotide sequence of Sd is as shown in SEQ ID NO.4;

[0009] The locking foot chain is formed by partial pairing of sequences Wheel and Lock. The nucleotide sequence of Wheel is as shown in SEQ ID NO.6, and the sequence Lock is a nucleotide sequence for miRNA recognition;

[0010] The gold nanoparticle-solidified substrate track is formed by covalent binding and partial base complementary pairing of three linear sequences and gold nanoparticles. The three linear sequences are two split enzyme chains and a substrate chain. The substrate chain is modified with a fluorescent group and has a deoxyribozyme cleavage site;

[0011] Part of the sequence of the three-driven DNA harvester is connected to the gold nanoparticle-solidified substrate track in a base complementary pairing manner.

[0012] Preferably, the nucleic acid aptamer for recognizing target cells is E-AS1411, and the nucleotide sequence of E-AS1411 is as shown in SEQ ID NO.5.

[0013] Preferably, the two split enzyme chains are SDzA and SDzB. The nucleotide sequence of the sequence SDzA is as shown in SEQ ID NO.9; the nucleotide sequence of the sequence SDzB is as shown in SEQ ID NO.10.

[0014] Preferably, the fluorescent group includes FAM.

[0015] Preferably, the substrate chain is Substrate-FAM. The nucleotide sequence of Substrate-FAM is shown in SEQ ID NO.8. The first base T of the sequence Substrate-FAM is modified with a disulfide bond, the 24th base T is modified with RNA, and the 39th base T is modified with a fluorescent group.

[0016] Preferably, the molar ratio of the triple-driven DNA harvester to the nano-gold immobilized substrate track is 4:1.

[0017] Preferably, the molar ratio of Sa, Sb, Sc, Sd, the nucleic acid aptamer for identifying target cells, Wheel and Lock is 1:1:1:1:1:3:3.

[0018] Preferably, the molar ratio of the fluorescent group-modified substrate, SDzA, SDzB and nano-gold is 45:45:45:1.

[0019] In the second aspect of the present invention, there is provided a method for preparing the signal system for the continuous autonomous movement of the triple-driven DNA harvester along the nano-gold immobilized nucleic acid substrate track without derailment as described above, comprising the following steps:

[0020] (1) Mix Sa, Sb, Sc and Sd, perform the first heating denaturation and cooling renaturation to obtain a DNA tetrahedron;

[0021] (2) Mix the DNA tetrahedron with the nucleic acid aptamer for identifying target cells, and let it stand for incubation to obtain an aptamer-functionalized DNA tetrahedron;

[0022] (3) Mix Wheel and Lock, perform the second heating denaturation and cooling renaturation to obtain a locked foot chain;

[0023] (4) Mix the aptamer-functionalized DNA tetrahedron and the locked foot chain, and let it stand for incubation to obtain the triple-driven DNA harvester;

[0024] (5) Reduce the substrate chain to obtain a reduced substrate chain;

[0025] (6) Mix the reduced substrate chain with nano-gold particles, slowly add phosphate buffer and sodium chloride solution in sequence, perform centrifugation, remove the supernatant and resuspend to obtain substrate-modified nano-gold particles;

[0026] (7) Mix the substrate-modified nano-gold particles with sequences SDzA and SDzB, and let it stand for incubation to obtain the nano-gold immobilized substrate track;

[0027] (8) Mix the three - driven DNA harvester with the nano - gold - immobilized substrate track, let it stand for incubation, and obtain the signal system described above.

[0028] Preferably, in step (1), the first heating and denaturation temperature is 90 °C and the time is 5 min; in step (3), the second heating and denaturation temperature is 90 °C and the time is 5 min; in step (6), the centrifugation speed is 8500 rpm and the time is 10 min.

[0029] Application of the signal system of the three - driven DNA harvester that continuously and autonomously moves along the nano - gold - immobilized nucleic acid substrate track without derailment as described above in the preparation of miRNA detection reagents.

[0030] Preferably, the miRNA detection reagent includes in vitro and / or in vivo imaging reagents.

[0031] Beneficial effects: The signal system provided by the present invention has the advantages of no cytotoxicity, resistance to nuclease degradation, three - driven autonomous and continuous movement, avoiding derailment from the track, and sequential and precise recognition mediated by dual biomarkers.

[0032] The signal system provided by the present invention has the following advantages:

[0033] 1. High detection sensitivity. The inherently large surface area of gold nanoparticles ensures a high substrate loading capacity. The continuous movement of the three - driven DNA nanoharvester lyses the substrate, greatly enhancing the fluorescence signal and significantly improving the detection sensitivity.

[0034] 2. Precise recognition of target tumor cells. Based on the signal transduction process mediated by two biomarkers, namely cell - membrane - surface protein receptors and endogenous miRNAs, the target cells are screened step by step in an orderly manner, thus ensuring the accuracy of recognition.

[0035] 3. Resistance to nuclease degradation. Spherical gold nanoparticles and DNA tetrahedrons can synergistically enhance the nuclease - degradation resistance of DNA components.

[0036] 4. Avoidance of derailment risk. The three - driven DNA nanoharvester contains three foot chains, each of which is partially complementary to the cleavage enzyme chain. Therefore, without sacrificing the movement speed, the long - distance stepping performance is greatly improved, and derailment events are avoided.

[0037] 5. Evaluation of the malignancy degree of tumor cells. The aptamer mediates cell internalization with the cell - membrane protein receptor and is suitable for quantitative measurement of intracellular miRNAs. Therefore, it has the ability to evaluate the malignancy degree of tumor cells. Description of the Drawings

[0038] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, obtaining other drawings based on these drawings still belongs to the scope of the present invention.

[0039] Figure 1 Schematic diagram of base complementary pairing of the three-drive DNA harvester;

[0040] Figure 2 Flow chart for the preparation of the signal system;

[0041] Figure 3 Base information diagram of the three-drive DNA harvester in the signal system in the locked and activated states;

[0042] Figure 4 Schematic diagram of the operating mechanism of the signal system (A) and precise cellular miRNA imaging (B);

[0043] Figure 5 Verification of the stepwise assembly results of A-Tetra by 12% polyacrylamide gel electrophoresis;

[0044] Figure 6 Verification of the stepwise assembly results of the three-drive DNA harvester by 12% polyacrylamide gel electrophoresis;

[0045] Figure 7 Atomic force microscope image of AP-track (A) and cross-sectional analysis results (B);

[0046] Figure 8 Atomic force microscope image of TH-AT system (A) and cross-sectional analysis results (B);

[0047] Figure 9 Feasibility analysis of detecting miR-21D by TH-AT system;

[0048] Figure 10 Intracellular imaging and fluorescence intensity quantification of miR-21 in MCF-7, HeLa and L02 cells based on TH-AT system. Detailed implementation manners

[0049] To make the objectives, technical solutions and advantages of the present invention clearer, the following will further describe the present invention in detail with reference to the drawings.

[0050] The present invention provides a signal system for continuous autonomous movement of a three-drive DNA harvester along a nucleic acid substrate track solidified with nano-gold without derailment, which includes a three-drive DNA harvester and a nano-gold solidified substrate track.

[0051] The structure of the three-drive DNA harvester is as Figure 1As shown, it includes a DNA tetrahedron. At one fixed vertex of the DNA tetrahedron, a nucleic acid aptamer for identifying target cells is assembled, and the remaining three vertices are assembled with locking foot chains. Specifically, the DNA tetrahedron is assembled from sequences Sa, Sb, Sc, and Sd. The nucleotide sequence of Sa is CATTACAATGCATCAATTCAACATTCCTAAGT CTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTA (as shown in SEQ ID NO.1); the nucleotide sequence of Sb is AAAAAAAAAAAAAAAAAAAAATTC AGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCA T (as shown in SEQ ID NO.2); the nucleotide sequence of Sc is AAAAAAAAAAAAAAAAA AAAATCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGG CGGCTCTTC (as shown in SEQ ID NO.3); the nucleotide sequence of Sd is AAAAAAAAA AAAAAAAAAAAATATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATA GATGCGAGGGTCCAATAC (as shown in SEQ ID NO.3); the locking foot chain is formed by partial pairing of sequence Wheel and sequence Lock. The nucleotide sequence of Wheel is TTTTTTTTTTT TTTTTTTTTAATACAGACTGATGTTGACTATGACACT (as shown in SEQ ID NO.6), and the sequence Lock is a nucleotide sequence for miRNA recognition, and the specific sequence is designed according to the target miRNA to be detected. In some embodiments of the present invention, for the Lock sequence designed for miR-21, its nucleotide sequence is CATAGTCAACATCAGTCTGATAAGCTA (as shown in SEQ ID NO.7); the nucleic acid aptamer for identifying target cells is designed or screened according to the target cells. In some embodiments of the present invention, the nucleic acid aptamer for identifying target cells uses E-AS1411, and the nucleotide sequence of E-AS 1411 is GGTGGTGGTGGTTGTGGTGGTGGTGGTTTTTTTTTTA ATTGATGCATTGTAATG (as shown in SEQ ID NO.5).

[0052] The nano - gold solidified substrate track is formed by three linear sequences and nano - gold particles through covalent bonding and partial base complementary pairing; the three linear sequences are two split - enzyme chains and a substrate chain, the substrate chain is modified with a fluorescent group and has a deoxyribozyme cleavage site. In some embodiments of the present invention, the two split - enzyme chains are SDzA and SDzB, the nucleotide sequence of the sequence SDzA is TAGGTCATC TCTTCTCCGAGCCTCAACA (as shown in SEQ ID NO.9); the nucleotide sequence of the sequence SDzB is AGTGTCATAGGGTCGAAATAGTGAGTCGCTC (as shown in SEQ ID NO.10). The fluorescent group on the substrate chain can be selected as needed. In some embodiments of the present invention, the fluorescent group is selected as FAM. Specifically, the substrate chain is Substrate - FAM, and the nucleotide sequence of Substrate - FAM is SH - TTTTTTTTTTGAGCGACTCACTAT / rA / GGAAGAGATGACCTA - FAM (as shown in SEQ ID NO.8). The first base T of the sequence Substrate - FAM is modified with a disulfide bond, the 24th base T is modified with RNA as a cleavage site, and the 39th base T is modified with a fluorescent group.

[0053] Self - assemble the three - drive DNA harvester and the nano - gold solidified substrate track in a buffer to obtain a signal system in which the three - drive DNA harvester is attached to the nano - gold solidified substrate track.

[0054] Furthermore, the present invention provides a preparation method for a signal system for continuously and autonomously moving a three - drive DNA harvester without derailment along a nano - gold solidified nucleic acid substrate track. The process is as Figure 2 shown and includes the following steps:

[0055] (1) Mix Sa, Sb, Sc, and Sd, perform the first heating denaturation and cooling renaturation to obtain a DNA tetrahedron;

[0056] (2) Mix the DNA tetrahedron with a nucleic acid aptamer for identifying target cells, and let it stand for incubation to obtain an aptamer - functionalized DNA tetrahedron;

[0057] (3) Mix the Wheel and the Lock, perform the second heating denaturation and cooling renaturation to obtain a locked foot chain;

[0058] (4) Mix the aptamer - functionalized DNA tetrahedron and the locked foot chain, and let it stand for incubation to obtain the three - drive DNA harvester;

[0059] (5) Reduce the substrate chain to obtain a reduced substrate chain;

[0060] (6) Mix the reduced substrate strand with gold nanoparticles, and sequentially and slowly add phosphate buffer solution and sodium chloride solution, then centrifuge, discard the supernatant and resuspend to obtain substrate-modified gold nanoparticles.

[0061] (7) Mix the substrate-modified gold nanoparticles with sequences SDzA and SDzB, and let it stand for incubation to obtain the gold nanoparticle-solidified substrate track.

[0062] (8) Mix the three-driven DNA harvester with the gold nanoparticle-solidified substrate track, and let it stand for incubation to obtain the signal system.

[0063] In the locked and activated states, the base information map of the three-driven DNA harvester in the signal system of the present invention is as Figure 3 shown.

[0064] The signal system provided by the present invention has the advantages of no cytotoxicity, resistance to nuclease degradation, three-driven autonomous continuous movement, avoiding deviation from the track, and sequential and precise recognition mediated by dual biomarkers. Its operating mechanism is as Figure 4 (A) shown, and as Figure 4 (B) shown, it can achieve precise cellular miRNA imaging.

[0065] The following are some specific embodiments of the present invention.

[0066] Example 1

[0067] A preparation method of an aptamer-functionalized DNA tetrahedron A-tetra is as follows:

[0068] Step 1: Sequentially add 2 μL of 10 μM Sa (shown in SEQ ID NO.1), Sb (shown in SEQ ID NO.2), Sc (shown in SEQ ID NO.3), and Sd (shown in SEQ ID NO.4) to 140 μL of Tris-HCl buffer solution and mix well. Then heat the obtained solution at 90 °C for 5 minutes and then cool it to room temperature to obtain the DNA nanomaterial DNA tetrahedron.

[0069] Step 2: Add 2 μL of 10 μM E-AS1411 (shown in SEQ ID NO.5) to the solution prepared in Step 1 and let it stand for incubation at room temperature for 2 hours to obtain the DNA nanomaterial A-tetra.

[0070] Characterize the stepwise assembly of DNA nanomaterial A-tetra using 12% polyacrylamide gel electrophoresis. First, prepare the sample for the gel running system: 8 μL of the sample solution + 2 μL of 6× Loading buffer + 2 μL of 6× SYBR Green I. After thorough mixing, pipette 10 μL for loading. Use 0.5× TBE as the electrophoresis buffer and run on the gel electrophoresis apparatus at a constant voltage of 60 V for 90 minutes, then image on the ChemiDOC XRS imaging system equipped with acquisition and analysis software (Image Lab).

[0071] The experimental results are as Figure 5 shown. As the assembly chains are added sequentially, the migration rates of the bands in lanes 4 and 5 decrease significantly, and the single-strand band of E-AS1411 disappears in lane 6, indicating the successful assembly of the aptamer-functionalized DNA tetrahedron A-tetra.

[0072] Example 2

[0073] Prepare the miRNA-stimuli-responsive triple-driven DNA harvester (TW-harvester) as follows:

[0074] Step 1: Sequentially add 2 μL of Wheel (shown in SEQ ID NO.6) and Lock (shown in SEQ ID NO.7) with a concentration of 10 μM to 46 μL of Tris-HCl buffer and mix thoroughly. Then heat the resulting solution at 90 °C for 5 minutes and then cool to room temperature to obtain Locked Wheel.

[0075] Step 2: Add 50 μL of the solution prepared in Step 1 above to the A-Tetra solution prepared in Example 1 and incubate at room temperature for 2 hours to obtain the triple-driven DNA harvester (TW-harvester).

[0076] Characterize the stepwise assembly of the triple-driven DNA harvester TW-harvester using 12% polyacrylamide gel electrophoresis in the same method as in Example 1.

[0077] The experimental results are as Figure 6 shown. As the component chains are added sequentially, even though the migration rate of the band in lane 5 only decreases slightly, the disappearance of the Locked Wheel in lane 3 indicates the successful assembly of the triple-driven DNA harvester TW-harvester.

[0078] Example 3

[0079] Prepare a gold nanoparticle-cured substrate track (AP-track) as follows:

[0080] Step 1: Add 50 mL of 1 mM chloroauric acid solution to a three-necked flask, heat it in an oil bath (120 °C) until condensation reflux occurs, and quickly add 7.5 mL of freshly prepared 1.5% sodium citrate solution. Continue heating for 20 minutes, then turn off the heating device and wait for it to cool to room temperature to obtain a gold nanoparticle solution.

[0081] Step 2: Thoroughly mix 31 μL of 100 μM Substrate-FAM (shown in SEQ ID NO.8) with 4 μL of 10 μM tris(2-carboxyethyl)phosphine hydrochloride and incubate at room temperature for 1 hour. Add 1 mL of 10 μM gold nanoparticle solution from the above Step 1 to the above solution and gently shake for 16 hours. Then, slowly add 0.2 M phosphate buffer to a final concentration of 0.01 M. Further, add 2 M NaCl solution at intervals of 8 hours to final concentrations of 0.2 and 0.3 M in sequence. Finally, remove the unbound Substrate-FAM by centrifugation, remove the supernatant, and resuspend it in 1 mL of Tris-HCl buffer to obtain AuNP-S.

[0082] Step 3: Sequentially add 5 μL of 10 μM SDzA (shown in SEQ ID NO.9) and SDzB (shown in SEQ ID NO.10) to 80 μL of the AuNP-S solution from the above Step 2, mix evenly, and let it stand at room temperature for 2 hours. Remove the unbound SDzA and SDzB by centrifugation, remove the supernatant, and resuspend it in 80 μL of Tris-HCl buffer to obtain a gold nanoparticle-immobilized substrate track (AP-track).

[0083] Characterize and analyze the morphology of AP-track using an atomic force microscope. First, drop 15 μL of the prepared AP-track onto the center of a mica sheet and leave it to adsorb for 15 minutes. Wash it twice with 100 μL of ddH2O and gently dry it from the nitrogen stream of a nitrogen blower. Collect the morphological images of the sample using a Multimode 8 atomic force microscope.

[0084] The experimental results are as Figure 7 shown. Well-dispersed, regularly spherical structures were observed, with average heights of 19.0 ± 0.4 nm and 46.4 ± 2.2 nm respectively.

[0085] Example 4

[0086] A signal system (TH-AT system) of a triple-driven DNA harvester attached to a gold nanoparticle-immobilized substrate track, the preparation method is as follows:

[0087] 100 μL of the TW-harvester prepared in Example 2 with a concentration of 66.7 nM was mixed evenly with 80 μL of the AP-track prepared in Example 3, and left to stand at room temperature for 2 hours. The unbound TW-harvester was removed by centrifugation. After removing the supernatant, it was resuspended in 80 μL of Tris-HCl buffer to obtain the signal system (TH-AT system) of the three-driven DNA harvester attached to the nano-gold solidified substrate track.

[0088] The TH-AT system was characterized and analyzed for its morphology by atomic force microscopy imaging using the same method as in Example 3.

[0089] The experimental results are as Figure 8 shown. Well-dispersed, regularly spherical structures were observed, with average heights of 21.5 ± 1.5 nm and 54.0 ± 2.1 nm respectively.

[0090] Example 5

[0091] miR-21 triggered the signal amplification of the TH-AT system. The experimental method is as follows

[0092] Step 1: The TH-AT system prepared in Example 4 was mixed evenly with 20 μL of MgCl2 with a concentration of 100 mM and 98 μL of Tris-HCl buffer. 2 μL of miR-21D with a concentration of 100 μM was added to the above solution.

[0093] Step 2: The sample was excited at a wavelength of 492 nm by a fluorescence spectrophotometer (Hitachi F-7000) and the fluorescence spectrum was measured.

[0094] The experimental results are as Figure 9 shown. Only sample iv triggered the release of a strong fluorescence signal under the stimulation of Mg 2+ and miRNA-21D.

[0095] Example 6

[0096] The TH-AT system was used for intracellular miR-21 imaging. The experimental method is as follows:

[0097] Step 1: The preparation method of the TH-AT system was as described in Example 4.

[0098] Step 2: MCF-7, HeLa and L02 cells were respectively seeded on coverslips in 24-well plates (the culture medium consisted of 10% (v / v) fetal bovine serum (FBS), 100 U / mL penicillin, 100 μg / mL streptomycin, and were cultured in an environment of 37 °C and 5% CO2). After 24 hours of culture, the TH-AT system prepared in Step 1 (at a concentration of 10 nM) was added, and then cultured in DMEM medium without fetal bovine serum and double antibodies (100 U / mL penicillin, 100 μg / mL streptomycin) in an environment of 37 °C and 5% CO2 for 4 hours. After that, the medium was removed, washed 3 times with PBS, fixed with 4% paraformaldehyde for 15 minutes, washed 3 times with PBS, stained with Hochest fluorescent dye for 10 minutes, washed 3 times with PBS, and after mounting, confocal laser scanning imaging was performed on a Leica SP8 laser scanning confocal microscope instrument in the dark.

[0099] The experimental results are as Figure 10 shown. The highest fluorescence intensity was observed in MCF-7 cells, the fluorescence intensity was medium in HeLa cells, and there was almost no fluorescence in L02 cells. It shows that the TH-AT system can not only distinguish cancer cells and normal cells by miR-21 imaging, but also accurately identify different types of cancer cells.

[0100] The above-disclosed are only the preferred embodiments of the present invention. Of course, the scope of the rights of the present invention cannot be limited thereby. Therefore, equivalent changes made according to the claims of the present invention still fall within the scope covered by the present invention.

Claims

1. A signal system for the continuous autonomous movement of a three - drive DNA harvester without derailment along a nucleic acid substrate track solidified with nano - gold, characterized in that: It includes a three-driven DNA harvester and a nucleic acid substrate track solidified with gold nanoparticles; the three-driven DNA harvester includes a DNA tetrahedron, a nucleic acid aptamer for identifying target cells is assembled at one apex vertex of the DNA tetrahedron, and locking foot chains are assembled at the other three vertices; the DNA tetrahedron is assembled from sequences Sa, Sb, Sc, and Sd, and the nucleotide sequence of Sa is shown in SEQ ID NO.1; the nucleotide sequence of Sb is shown in SEQ ID NO.2; the nucleotide sequence of Sc is shown in SEQ ID NO.3; the nucleotide sequence of Sd is shown in SEQ ID NO.4; The locking foot chain is formed by partial pairing of the sequence Wheel and the sequence Lock. The nucleotide sequence of Wheel is shown in SEQ ID NO.6, and the sequence Lock is a nucleotide sequence for miRNA recognition; The nucleic acid substrate track solidified with gold nanoparticles is formed by covalent bonding and partial base complementary pairing of three linear sequences and gold nanoparticles; the three linear sequences are two cleavage enzyme chains and a substrate chain. The substrate chain is modified with a fluorescent group and has a deoxyribozyme cleavage site; Part of the sequence of the three-driven DNA harvester is connected to the nucleic acid substrate track solidified with gold nanoparticles in a base complementary pairing manner, and the deoxyribozyme on the gold nanoparticle surface is in an inert state.

2. The signal system for continuous autonomous movement of the three-drive DNA harvester without derailment along the nucleic acid substrate track solidified with nano-gold according to claim 1, characterized in that: The nucleic acid aptamer for identifying target cells is E-AS1411, and the nucleotide sequence of E-AS1411 is shown in SEQ ID NO.

5.

3. The signal system for continuous autonomous movement of the three-drive DNA harvester without derailment along the nucleic acid substrate track solidified with nano-gold according to claim 1, characterized in that: The two cleavage enzyme chains are SDzA and SDzB. The nucleotide sequence of the sequence SDzA is shown in SEQ ID NO.9; the nucleotide sequence of the sequence SDzB is shown in SEQ ID NO.

10.

4. The signal system for continuous autonomous movement of the three-drive DNA harvester without derailment along the nucleic acid substrate track solidified with nano-gold according to claim 2, characterized in that: The substrate chain is Substrate-FAM. The nucleotide sequence of Substrate-FAM is shown in SEQ ID NO.

8. The first base T of the sequence Substrate-FAM is modified with a disulfide bond, the 24th base T is modified with RNA, and the 39th base T is modified with a fluorescent group.

5. The signal system for continuous autonomous movement of the three-drive DNA harvester without derailment along the nucleic acid substrate track solidified with nano-gold according to claim 1, characterized in that: The molar ratio of the three-driven DNA harvester to the substrate-modified gold nanoparticle track is 4:

1.

6. The signal system for continuous autonomous movement of the three-drive DNA harvester without derailment along the nucleic acid substrate track solidified with nano-gold according to claim 1, characterized in that: The molar ratio of Sa, Sb, Sc, Sd, the nucleic acid aptamer for identifying target cells, Wheel, and Lock is 1:1:1:1:1:3:

3.

7. The signal system for continuous autonomous movement of the three-drive DNA harvester without derailment along the nucleic acid substrate track solidified with nano gold according to claim 1, characterized in that: The molar ratio of the fluorescent group-modified substrate, SDzA, SDzB, and gold nanoparticles is 45:45:45:

1.

8. The preparation method of the signal system for the continuous autonomous movement of the three-drive DNA harvester without derailment along the nucleic acid substrate track solidified with nano-gold as described in any one of claims 1-7, characterized in that, It includes the following steps: (1) Mix Sa, Sb, Sc, and Sd, perform first heating denaturation and cooling renaturation to obtain a DNA tetrahedron; (2) Mix the DNA tetrahedron with the nucleic acid aptamer for identifying target cells, and incubate statically to obtain an aptamer-functionalized DNA tetrahedron; (3) Mix Wheel and Lock, perform second heating denaturation and cooling renaturation to obtain a locking foot chain; (4) Mix the aptamer-functionalized DNA tetrahedron and the locking foot strand, and let it stand for incubation to obtain the triple-driven DNA harvester; (5) Reduce the substrate strand to obtain the reduced substrate strand; (6) Mix the reduced substrate strand with gold nanoparticles, slowly add phosphate buffer solution and sodium chloride solution in sequence, centrifuge, remove the supernatant and resuspend to obtain substrate-modified gold nanoparticles; (7) Mix the substrate-modified gold nanoparticles with sequences SDzA and SDzB, and let it stand for incubation to obtain the gold nanoparticle-solidified nucleic acid substrate track; (8) Mix the triple-driven DNA harvester with the gold nanoparticle-solidified nucleic acid substrate track, and let it stand for incubation to obtain the signal system.

9. The preparation method according to claim 8, characterized in that: In step (1), the first heating denaturation temperature is 90 °C and the time is 5 min; in step (3), the second heating denaturation temperature is 90 °C and the time is 5 min; in step (6), the centrifugation speed is 8500 rpm and the time is 10 min.

10. Use of the signal system for the continuous autonomous movement of the triple-driven DNA harvester without derailment along the gold nanoparticle-solidified nucleic acid substrate track as described in any one of claims 1-7 in the preparation of a reagent for detecting miRNA.

Images