Construction method and application of hMPV-infected OVA-induced asthma mouse model

Abstract

The invention discloses a construction method and application of an hMPV infected OVA induced asthma mouse model, and belongs to the technical field of animal models. According to the construction method, a construction mode of inducing the mouse to generate asthma disease characteristics and then performing hMPV infection is adopted, so that the possibility that the two disease characteristics counteract each other is avoided, the effect of hMPV on occurrence and development of the asthma disease can be confirmed, the experimental period is greatly shortened, death of the mouse is avoided, the working efficiency is improved, the experimental feasibility is improved, and the method is suitable for popularization and application. The wide application of the mouse model is facilitated; according to the invention, clinical pathological characteristics of an asthma patient infected with hMPV are simulated, and an experimental animal model is provided for research on development mechanisms and drug therapy of diseases infected by asthma and hMPV.

Description

Technical Field

[0001] The present invention relates to the technical field of animal models, and particularly relates to a method for constructing and applying an asthma mouse model induced by hMPV infection and OVA. Background Art

[0002] Asthma is the most common chronic disease in the pediatric population, affecting at least 5%-10% of children and adolescents worldwide. More and more evidence shows that respiratory virus infections can have serious adverse consequences for patients with diagnosed asthma. Human metapneumovirus (hMPV) is the second most important pathogen causing acute respiratory infections in infants after RSV, affecting 86% of children under 5 years old globally. Human metapneumovirus is a member of the pneumovirus subfamily and exhibits a seasonal infection pattern, with symptoms ranging from moderate to severe respiratory diseases. In previous studies, the viral infections in asthma animal models were basically completed by RV (rhinovirus), RSV (respiratory syncytial virus), and IV (influenza virus), and hMPV was rarely mentioned. However, the severity of lower respiratory tract disease (LRTI) caused by hMPV is considered to be similar to that of RSV.

[0003] Clinical evidence shows that hMPV is associated with acute exacerbations of asthma in children and adults and may play a role in the development of childhood asthma. Studies on hMPV and asthma also show that hMPV may preferentially affect asthma subjects. To deeply study the pathogenesis of asthma and screen effective therapeutic drugs, the establishment of animal models is crucial. Currently, commonly used asthma animal models include an asthma mouse model induced by ovalbumin (OVA), an asthma mouse model induced by house dust mite (HDM), etc. These models provide important tools for asthma research by simulating the pathophysiological process of human asthma. hMPV infection can exacerbate allergen-induced asthma symptoms, and allergen-induced immune responses can also affect the pathological process of hMPV infection. However, in the prior art, an asthma mouse model induced by hMPV infection combined with OVA has not been established, which to a certain extent limits the study of the relationship between hMPV infection and asthma. Therefore, establishing an asthma mouse model induced by hMPV infection combined with OVA has important scientific significance and clinical value for deeply studying the pathogenesis of hMPV infection and asthma and screening effective therapeutic drugs. Summary of the Invention

[0004] The object of the present invention is to propose a method for constructing and applying an asthma mouse model induced by hMPV infection and OVA in view of the problem that an asthma mouse model induced by hMPV infection combined with OVA has not been established in the prior art.

[0005] To achieve the above object, the present invention provides a method for constructing an asthma mouse model induced by hMPV infection and OVA, comprising the following steps:

[0006] (1) Select healthy female mice at 3 - 4 weeks of age, raise them under constant temperature and humidity conditions, and alternate day and night every 12 h; (2) On the 1st day, 8th day, and 15th day in sequence, after a total of 3 intraperitoneal injections of OVA solution to the mice, starting from the 22nd day, use OVA aerosol solution to aerosolize the mice for 30 min every day for 15 consecutive days to complete the establishment of the OVA asthma model;

[0007] (3) On the basis of the OVA asthma model, use hMPV drops to drip into the nasal cavity of the mice 1 - 2 times a day for nasal infection for 5 days to complete the establishment of the hMPV infection model;

[0008] (4) Evaluate the results of model establishment. If the evaluation results meet the requirements, the model establishment is completed; if the evaluation results do not meet the requirements, the model establishment fails, and steps (1) - (4) need to be repeated until the evaluation results meet the requirements and the model establishment is completed.

[0009] The construction method of an asthma mouse model induced by hMPV infection of OVA in the present invention adopts a construction mode of first inducing the appearance of asthma disease characteristics in mice and then performing hMPV infection, avoiding the possibility of mutual cancellation of the two disease characteristics. It can not only confirm the role of hMPV in the occurrence and development of asthma disease, but also greatly shorten the experimental period and avoid the death of mice, so as to speed up work efficiency, improve experimental feasibility, and facilitate the wide application of the mouse model; the present invention simulates the pathological characteristics of asthma patients infected with hMPV clinically, and provides an experimental animal model for the research on the development mechanism and drug treatment of diseases with asthma overlapping hMPV infection.

[0010] Among them, in step (1), preferably, the temperature of the constant temperature and humidity conditions is 24 °C, and the humidity is 55%; the preferred temperature and humidity are more suitable for the life of mice.

[0011] Among them, in step (2), preferably, the concentration of the OVA solution is 500 μg / ml; the preferred concentration of the OVA solution can better achieve the establishment of the asthma model and will not overly affect the normal metabolism of the mice.

[0012] Preferably, the amount of OVA solution for intraperitoneal injection is 1 - 2 ml; the preferred injection amount can ensure the success of model establishment and will not overly affect the normal metabolism of the mice.

[0013] Preferably, the concentration of the OVA aerosol solution is 5 wt%; the preferred concentration of the aerosol solution can better achieve the establishment of the asthma model.

[0014] Among them, in step (3), preferably, the titer of the hMPV drops is 1.0×10 8; The preferred titer can achieve hMPV infection while avoiding excessive impact on the normal metabolism of mice.

[0015] Preferably, the amount of hMPV drops instilled into the nasal cavity each time is 0.08 ml; the preferred instilled amount can achieve hMPV infection while avoiding excessive impact on the normal metabolism of mice.

[0016] Among them, in step (4), the evaluation methods for the modeling results include at least one of the airway inflammation detection experiment, airway hyperresponsiveness detection experiment, histopathological detection experiment, and inflammatory factor detection experiment.

[0017] Furthermore, the present invention also provides an application of a method for constructing an hMPV-infected OVA-induced asthma mouse model in screening drugs effective against asthma overlapping hMPV infection.

[0018] Furthermore, the present invention also provides an application of a method for constructing an hMPV-infected OVA-induced asthma mouse model in an experimental method for studying the pathological development of asthma overlapping hMPV infection.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0020] (1) The method for constructing the hMPV-infected OVA-induced asthma mouse model of the present invention combines the design characteristics of virus infection and asthma models, and adopts a construction mode of first inducing the characteristics of asthma disease in mice and then performing hMPV infection, avoiding the possibility of mutual cancellation of the two disease characteristics. It can not only confirm the role of hMPV in the occurrence and development of asthma disease, but also greatly shorten the experimental cycle and avoid the death of mice, so as to improve work efficiency, enhance experimental feasibility, and facilitate the wide application of the mouse model.

[0021] (2) The present invention simulates the pathological characteristics of clinically asthmatic patients infected with hMPV, and provides an experimental animal model for the research on the development mechanism and drug treatment of asthma overlapping hMPV infection. Description of the Drawings

[0022] Figure 1 It is a graph of the experimental results of airway hyperresponsiveness detection in Experimental Example 2 of the present invention;

[0023] Figure 2 It is a graph of the experimental results of histopathology (viral load) detection in Experimental Example 3 of the present invention;

[0024] Figure 3 It is a photograph of the morphological features of lung tissue cells in the observation experiment of histopathology (morphology of lung tissue cells) in Experimental Example 4 of the present invention. Detailed Embodiments

[0025] The present invention will be further described in detail below in conjunction with specific embodiments. However, it should not be understood that the scope of the above-mentioned subject matter of the present invention is limited to the following embodiments. Any technology implemented based on the content of the present invention belongs to the scope of the present invention.

[0026] In the following experimental methods of the examples, unless otherwise specified, they are all conventional methods; the reagents, biological materials, and detection kits used in the experiments, unless otherwise specified, can all be obtained from commercial channels.

[0027] Example 1

[0028] Construct an asthma mouse model induced by hMPV infection of OVA, which specifically includes the following steps:

[0029] (1) Select 40 healthy female mice at 4 weeks old and raise them under constant temperature and humidity (temperature 24°C, humidity 55%), with a 12-hour day-night cycle; randomly divide the 40 mice into a normal control group (Control group), an asthma group (OVA group), an hMPV infection group (hMPV group), and an hMPV infection OVA-induced asthma group (OVA + hMPV group);

[0030] (2) Sub-group modeling:

[0031] Asthma group: On the 1st, 8th, and 15th days, the mice were intraperitoneally injected with OVA solution (500 μg / m) once a day (1 ml each time), and then starting from the 22nd day, the mice were nebulized with OVA nebulizer solution (concentration 5 wt%) for 30 minutes every day for 15 consecutive days; then sterile PBS was dropped into the nasal cavity of the mice once a day (0.08 ml each time) for 5 days to complete the modeling of the asthma group;

[0032] hMPV infection group: On the 1st, 8th, and 15th days, the mice were intraperitoneally injected with sterile PBS once a day (1 ml each time), and then starting from the 22nd day, the mice were nebulized with sterile PBS for 30 minutes every day for 15 consecutive days; then an hMPV drop (titer 1.0×10 8 TCID 50 / mL) was dropped into the nasal cavity of the mice once a day (0.08 ml each time) for nasal infection for 5 days to complete the modeling of the hMPV infection group;

[0033] hMPV-infected OVA-induced asthma group: On the 1st, 8th, and 15th days successively, mice were intraperitoneally injected with OVA solution (500 μg / m) once a day (1 ml each time). Starting from the 22nd day, mice were nebulized with OVA nebulizer solution (concentration 5 wt%) for 30 min every day for 15 consecutive days to complete the OVA asthma model establishment. On the basis of the OVA asthma model, hMPV drops (titer 1.0×10 8 TCID 50 / mL) were dropped into the nasal cavity of mice once (0.08 ml each time) for nasal infection for 5 days to complete the model establishment of the hMPV-infected OVA-induced asthma group;

[0034] Normal control group: On the 1st, 8th, and 15th days successively, mice were intraperitoneally injected with sterile PBS once a day (1 ml each time). Starting from the 22nd day, mice were nebulized with sterile PBS for 30 min every day for 15 consecutive days, and then sterile PBS was dropped into the nasal cavity of mice once (0.08 ml each time) for 5 days to complete the model establishment of the normal control group;

[0035] (4) Evaluate the modeling results. If the evaluation results meet the requirements, the modeling is completed.

[0036] Example 2

[0037] The mouse model in Example 1 was detected by airway hyperresponsiveness detection experiment. The method is as follows:

[0038] Prepare 2% pentobarbital solution and anesthetize by intraperitoneal injection (0.4 ml). Disinfect the body surface skin with 75% alcohol. Gradiently dilute methacholine (Mech) with 0.9% NaCl solution to prepare methacholine solutions with concentrations of 3.125 mg / ml, 6.25 mg / ml, 12.5 mg / ml, 25 mg / ml, and 50 mg / ml respectively. First, nebulize 0.9% NaCl solution to stimulate the airway of mice. After the data is stable, observe and record the lung function data. Next, use 20 μl of methacholine with different concentrations for nebulization stimulation. After being stimulated by methacholine with different concentrations, the average values of lung resistance in the OVA and hMPV groups (nebulize and stimulate the airway of mice with methacholine for 1 min, record data for 4 min, and take the average value of lung resistance (LR) in the last 2 min as the test value) are both greater than 1, significantly higher than the average value of 0.66 in the normal control group, and the difference is statistically significant, indicating that after OVA induction and HMPV infection, the airway response is enhanced, indicating that the modeling is successful; The detection results are as Figure 1 shown.

[0039] When detected with 0.9% NaCl solution, the basal lung resistance values of each group were consistent, all lower than 1. With the increase in the concentration of MCH stimulant, the lung LR value in the OVA group increased significantly. When stimulated with medium and high concentrations (12.5 mg / ml, 25 mg / ml, 50 mg / ml) of MCH, the increase in LR value was particularly obvious, with P < 0.001 compared with the control group. However, the LR in the OVA group infected with hMPV decreased significantly, mainly occurring when stimulated with medium and high concentrations (12.5 mg / ml, 25 mg / ml, 50 mg / ml) of MCH.

[0040] Example 3

[0041] The mouse model in Example 1 was detected by a histopathological (viral load) detection experiment, and the method was as follows:

[0042] Take 20 mg of mouse lung tissue, extract its RNA and then reverse transcribe it into cDNA. The reverse transcription conditions are 37°C; 15 min; 85°C, 5 s; Use the Taqman probe method to detect the hMPV concentration. Before detection, the hMPV plasmid is serially diluted, the hMPV copy number is detected and a standard curve is drawn. The nucleotide sequence of the hMPV upstream primer is: GAGCAATAGCACTCGGTGTTG; the nucleotide sequence of the hMPV downstream primer is TCACAAATCTTTCAGCTCTCTCAC; the nucleotide sequence of the probe is: TTGCCAACACACGAACTCCATCCC; the reaction system is premix, which requires 2 μl, each primer is 0.5 μl, probe (probe) is 2 μl, and cDNA requires 2 μl. The reaction conditions are 95°C, 5 min; 95°C, 5 s; 60°C, 30 s; stored at 4°C, and the cycle is 39 times. The viral load (titer) that can be detected in the lung tissue of the OVA-induced asthma group infected with hMPV is greater than 5×10 4 TCID 50 / mL, indicating successful model establishment. The detection results are as Figure 2 shown (both the asthma group and the normal control group were 0 and not marked in the figure).

[0043] Example 4

[0044] The mouse model in Example 1 was detected by a histopathological (lung tissue cell morphology) observation experiment, and the method was as follows:

[0045] The intact left upper lobe of the mouse lung was placed in 4% paraformaldehyde for fixation for 24 hours, followed by dehydration, paraffin embedding, and trimming of the paraffin blocks after solidification overnight. Sections were made, stained with HE, and observed under a microscope at 400 magnification for pathological changes around the airways. In the normal control group, the structure of the lung bronchial wall was intact, the cilia were arranged in an orderly manner, the alveolar wall was not significantly damaged, and there was no obvious inflammatory reaction. After hMPV infection, the cilia were significantly reduced, the alveolar wall was extensively ruptured, and a large number of inflammatory cells mainly neutrophils infiltrated around the bronchi, indicating an exacerbation of the inflammatory reaction. The hMPV-infected OVA-induced asthma group was successfully modeled. Photographs of the cell morphology of the lung tissue are as Figure 3 shown.

[0046] HE staining of mouse lung tissue showed that obvious morphological changes were observed in the bronchi of the OVA group, with significant thickening of the tracheal smooth muscle, hyperplasia of goblet cells, the strongest airway mucus secretion, and infiltration of a large number of inflammatory cells mainly eosinophils, neutrophils, and lymphocytes. The alveolar wall was disrupted, and the pulmonary inflammatory reaction was relatively severe. The bronchial ciliary structure in the OVA+hMPV group was more intact than that in the OVA group, the mucus secretion was increased compared with the control group and the hMPV group, but lower than that in the OVA group. The alveolar wall was incomplete, and there was infiltration of some inflammatory cells, mainly eosinophils, and the inflammatory reaction was less severe than that in the OVA group.

Claims

1. A method for constructing an hMPV-infected OVA-induced asthma mouse model, characterized in that, It includes the following steps: (1) Select healthy female mice at 3 - 4 weeks old and raise them under constant temperature and humidity conditions with a 12 - hour day - night cycle; (2) On the 1st day, 8th day, and 15th day in sequence, inject the mice intraperitoneally with OVA solution three times in total. Starting from the 22nd day, use OVA aerosol solution to aerosolize the mice for 30 minutes every day for 15 consecutive days to complete the establishment of the OVA - induced asthma model; (3) On the basis of the OVA - induced asthma model, use hMPV drops to drip into the nasal cavity of the mice 1 - 2 times a day for nasal infection for 5 days to complete the establishment of the hMPV - infection model; (4) Evaluate the modeling results. If the evaluation results meet the requirements, the modeling is completed; if the evaluation results do not meet the requirements, the modeling fails and steps (1) - (4) need to be repeated until the evaluation results meet the requirements and the modeling is completed.

2. The construction method according to claim 1, characterized in that In step (1), the temperature of the constant - temperature and constant - humidity condition is 24 °C and the humidity is 55%.

3. The construction method according to claim 1, wherein In step (2), the concentration of the OVA solution is 500 μg / ml.

4. The construction method according to claim 1, wherein In step (2), the amount of OVA solution injected intraperitoneally is 1 - 2 ml.

5. The construction method according to claim 1, characterized in that In step (2), the concentration of the OVA aerosol solution is 5 wt%.

6. The construction method according to claim 1, characterized in that In step (3), the titer of the hMPV drops is 1.0×10 8 .

7. The construction method according to claim 1, characterized in that In step (3), the amount of hMPV drops dripped into the nasal cavity each time is 0.08 ml.

8. The construction method according to claim 1, characterized in that, In step (4), the evaluation method of the modeling results includes at least one of the airway inflammation detection experiment, airway hyperresponsiveness detection experiment, histopathological detection experiment, and inflammatory factor detection experiment.

9. Use of the method for constructing an asthma mouse model induced by hMPV - infected OVA according to any one of claims 1 - 8 in screening drugs effective against asthma complicated with hMPV infection.

10. Use of the method for constructing an asthma mouse model induced by hMPV - infected OVA according to any one of claims 1 - 8 in an experimental method for studying the pathological development of asthma complicated with hMPV infection.

Images