Oligodendrocyte precursor cell line, method, kit and application

Abstract

The invention provides an oligodendrocyte precursor cell line, a method, a kit and application. Specifically, the cell line comprises a first gene sequence and a second gene sequence; the first gene sequence and the second gene sequence are separated from each other; wherein the first gene sequence comprises a Sirt2 gene and a first subsequence; the second gene sequence comprises a nuclear localization signal gene and a second subsequence; wherein peptide chains independently expressed by the first subsequence and the second subsequence are free of fluorescence and can be spontaneously combined to form fluorescent protein when meeting. The cell line can be used for high-throughput screening of drugs or molecules for promoting differentiation of oligodendrocyte precursor cells, and has the advantages of low cost and high efficiency.

Description

Technical Field

[0001] The present disclosure relates to the field of biomedical technologies, and particularly to an oligodendrocyte progenitor cell line, a method, a kit, and an application thereof. Background Art

[0002] In the central nervous system, oligodendrocytes form myelin sheaths that wrap around neuronal axons, providing nutritional support and protection, and serving as the structural basis for the saltatory conduction of nerve signals. Oligodendrocytes are differentiated from oligodendrocyte progenitor cells. However, with aging, the differentiation ability of oligodendrocyte progenitor cells decreases, leading to myelin sheath aging and a decline in the myelin sheath repair ability in the central nervous system of demyelinating diseases. Therefore, screening for drugs or molecules that promote the differentiation of oligodendrocyte progenitor cells has very important application prospects for delaying myelin sheath aging and brain aging, and treating neurodegenerative diseases caused by demyelination. Summary of the Invention

[0003] In view of this, the purpose of the present disclosure is to provide an oligodendrocyte progenitor cell line, a method, a kit, and an application thereof.

[0004] Based on the above purpose, the present disclosure provides an oligodendrocyte progenitor cell line, which includes a first gene sequence and a second gene sequence; the first gene sequence and the second gene sequence are separated from each other; wherein,

[0005] the first gene sequence includes the Sirt2 gene and a first subsequence; the second gene sequence includes a nuclear localization signal gene and a second subsequence; wherein,

[0006] the peptide chains independently expressed by the first subsequence and the second subsequence are non-fluorescent, and when the two meet, they can spontaneously combine to form a fluorescent protein.

[0007] Based on the same inventive concept, the embodiments of the present disclosure also provide a method for constructing an oligodendrocyte progenitor cell line, including:

[0008] Constructing a first plasmid including the Sirt2 gene and a first subsequence; constructing a second plasmid including a nuclear localization signal gene and a second subsequence;

[0009] Transfecting the first plasmid and the second plasmid into an oligodendrocyte progenitor cell line; wherein, the peptide chains independently expressed by the first subsequence and the second subsequence are non-fluorescent, and when the two meet, they can spontaneously combine to form a fluorescent protein.

[0010] Based on the same inventive concept, the embodiments of the present disclosure also provide a kit for screening drugs or molecules that promote the differentiation of oligodendrocyte progenitor cells, and the kit includes the cell line described in any one of the above or the cell line obtained by any one of the construction methods.

[0011] Based on the same inventive concept, embodiments of the present disclosure further provide a method for screening a drug or molecule that promotes the differentiation of oligodendrocyte precursor cells, including:

[0012] Treating the cell line obtained by any of the aforementioned cell lines or any of the construction methods with the drug to be screened or performing molecular manipulation;

[0013] Performing nuclear staining on the treated cell line;

[0014] Detecting and analyzing the fluorescence of the cell nucleus using a high-content imaging analysis system; wherein, the fluorescence is emitted by the fluorescent protein.

[0015] Based on the same inventive concept, embodiments of the present disclosure further provide the use of the cell line obtained by any of the aforementioned cell lines or any of the construction methods in the screening of a drug or molecule that promotes the differentiation of oligodendrocyte precursor cells.

[0016] As can be seen from the above, the oligodendrocyte precursor cell line, method, kit, and application provided by the present disclosure combine the Sirt2 gene and the nuclear localization signal gene with the first subsequence and the second subsequence respectively; using the characteristics that the peptide chains independently expressed by the first subsequence and the second subsequence are non-fluorescent and can spontaneously bind to form a fluorescent protein when they meet, to detect whether the Sirt2 protein enters the nucleus, and can perform high-throughput screening on drugs or molecules that promote the differentiation of oligodendrocyte precursor cells, having the advantages of low cost and high efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the present disclosure or related technologies, the following will briefly introduce the drawings required for use in the embodiments or related technology descriptions. Obviously, the drawings in the following description are only embodiments of the present disclosure, and those of ordinary skill in the art can obtain other drawings based on these drawings without creative efforts.

[0018] Figure 1 A schematic flowchart of a method for screening a drug or molecule that promotes the differentiation of oligodendrocyte precursor cells provided by the related technology;

[0019] Figure 2 Another schematic flowchart of a method for screening a drug or molecule that promotes the differentiation of oligodendrocyte precursor cells provided by the related technology;

[0020] Figure 3 A schematic flowchart of a method for screening a drug or molecule that promotes the differentiation of oligodendrocyte precursor cells provided by the embodiments of the present disclosure;

[0021] Figure 4This disclosure provides a plasmid map of 17448-NLS-GFP1-10 for an embodiment;

[0022] Figure 5 This disclosure provides a plasmid map of 17447-GFP11-sirt2 for an embodiment;

[0023] Figure 6 This is the identification diagram of MO3.13 positive cells provided by an embodiment of this disclosure;

[0024] Figure 7 This is the schematic diagram of GFP expression detection of MO3.13 positive cells provided by an embodiment of this disclosure;

[0025] Figure 8 This is the schematic diagram of the results of high-content imaging analysis of the cell line provided by an embodiment of this disclosure. Detailed implementation manners

[0026] To make the objectives, technical solutions, and advantages of this disclosure clearer and more understandable, the following further describes this disclosure in detail with reference to specific embodiments and the accompanying drawings.

[0027] It should be noted that unless otherwise defined, the technical terms or scientific terms used in the embodiments of this disclosure should have the ordinary meanings understood by those of ordinary skill in the field to which this disclosure belongs. The "first", "second", and similar terms used in the embodiments of this disclosure do not denote any order, quantity, or importance, but are only used to distinguish different components. The terms such as "including" or "comprising" mean that the elements or objects appearing before this term cover the elements or objects listed after this term and their equivalents, without excluding other elements or objects. The terms such as "connected" or "coupled" are not limited to physical or mechanical connections, but may include electrical connections, whether direct or indirect. The terms such as "upper", "lower", "left", and "right" are only used to represent relative positional relationships, and when the absolute position of the object being described changes, the relative positional relationship may also change accordingly.

[0028] To facilitate the understanding of the technical solutions of this disclosure, some technical terms involved in this disclosure are introduced below.

[0029] Silent information regulator 2 (Sirtuin2, abbreviated as Sirt2) is a member of the Sirtuins protein family, which includes SIRT1 to SIRT7. They are a well-known class of longevity proteins in mammals that can regulate metabolism and lifespan.

[0030] Split Green fluorescent protein (split GFP) is to split GFP into two peptide segments, GFP1-10 and GFP11. These two peptide segments do not produce fluorescence when they exist alone, but green fluorescence will appear when the two peptide segments approach each other.

[0031] The Nuclear localization signal (NLS) is a domain of a protein, usually composed of a short amino acid sequence, which can interact with the nuclear import carrier to transport the protein into the nucleus. These signal sequences can be continuous or segmented in different parts of the nucleophilic protein and are not excised after guiding nuclear import. NLS is composed of 4-8 amino acids and contains basic amino acids such as Pro, Lys, and Arg.

[0032] H3K18 refers to the 18th lysine (Lysine) of histone H3. In biological research, histones are the basic proteins that make up chromatin, and specific amino acid residues of histones (such as lysine) can be modified by various modifying enzymes. These modifications are crucial for regulating gene expression and cell functions. Modifications of H3K18 include acetylation (H3K18Ac), lactylation (H3K18la), etc. These modification states can affect the structure and accessibility of chromatin, thereby affecting gene transcriptional activity.

[0033] Myelin basic protein (MBP) is a strongly basic membrane protein synthesized by oligodendrocytes in the central nervous system and Schwann cells in the peripheral nervous system of vertebrates.

[0034] As described in the background art section, screening for drugs or molecules that promote the differentiation of oligodendrocyte precursor cells has very important application prospects for delaying myelin aging and brain aging and treating neurodegenerative diseases caused by demyelination. Here, molecules refer to biological macromolecules such as nucleic acids, proteins, and polypeptides.

[0035] Figure 1 It is a schematic flow chart of screening for drugs or molecules that promote the differentiation of oligodendrocyte precursor cells provided by the related technology. As Figure 1 shown, the primary cultured oligodendrocyte precursor cells are seeded into a 96-well plate, treated with different drugs to be screened for 4 days or certain molecules are manipulated. On the 5th day, the cells are fixed, and then immunofluorescence staining is performed to label MBP, which is a marker of differentiated and mature oligodendrocytes. Finally, photos are taken under a fluorescence microscope and the total fluorescence intensity of each cell is analyzed to represent the expression level of MBP, that is, the differentiation degree of oligodendrocyte precursor cells.

[0036] Figure 2Schematic diagram of another process for screening drugs or molecules that promote the differentiation of oligodendrocyte progenitor cells for related technologies. As Figure 2 shown, this technology uses a special 96-well plate with regularly arranged silica cones at the bottom. Primary cultured oligodendrocyte progenitor cells are seeded into this 96-well plate, and the processes of oligodendrocytes will wrap around the cones. Treat with different drugs to be screened for 3 days or perform operations on certain molecules, then fix the cells, label the differentiated and mature oligodendrocytes with MBP antibody (labeled with red fluorescence), label the undifferentiated oligodendrocyte progenitor cells with platelet-derived growth factor receptor α (PDGFRα) antibody (labeled with green fluorescence), image and analyze the images under a confocal microscope. Rings can be seen in the images. The red fluorescence rings are the differentiated and mature oligodendrocytes, and the green fluorescence rings are the undifferentiated oligodendrocyte progenitor cells. Count the rings of different fluorescence to obtain data on the differentiation degree of oligodendrocyte progenitor cells.

[0037] In related technologies, it is necessary to culture primary oligodendrocyte progenitor cells, and culturing primary oligodendrocyte progenitor cells requires taking the brain tissue of neonatal mice, increasing animal loss; culturing primary oligodendrocyte progenitor cells takes a long time and has a high technical difficulty. In addition, the number of primary oligodendrocyte progenitor cells obtained from a single mouse is limited. The need to purchase neonatal mice and special culture media required for culturing oligodendrocyte progenitor cells for large-scale screening significantly increases the screening cost. After drug treatment or molecular operation, immunofluorescent staining is used to label MBP and PDGFRα on the cells. A large amount of drug screening or molecular operation requires a large amount of antibodies, further increasing the screening cost. Finally, since the screening process involves immunofluorescent staining and has many steps, the number of drugs or molecules that can be screened by a single person at a single time is limited, and multiple people or multiple batches of screening are required. In addition, after imaging, it is necessary to manually import the images into image analysis software for analysis and statistics, which is time-consuming and laborious.

[0038] Sirt2 is a deacetylase. Related studies have found that the nuclear entry of sirt2 can inhibit the transcription of inhibitor of DNA binding 4 (ID4) by deacetylating H3K18, thereby enhancing the expression of myelin-related proteins such as Myelin basic protein (MBP) and promoting the differentiation of oligodendrocyte progenitor cells.

[0039] For screening drugs or molecules that promote the differentiation of oligodendrocyte progenitor cells by promoting the nuclear entry of sirt2, if the screening method of related technologies is adopted, the animal loss is high, the technical difficulty is high, and the economic cost and labor cost are both very high.

[0040] In view of this, embodiments of the present disclosure provide an oligodendrocyte progenitor cell line, method, kit and application, which can visualize the nuclear localization of sirt2, and can very conveniently detect the regulation of sirt2 nuclear localization by candidate drugs (i.e., its effect on the differentiation of oligodendrocyte progenitor cells). Specifically, the Sirt2 gene and the nuclear localization signal gene are respectively combined with the first subsequence (such as the gene sequence of GFP11) and the second subsequence (such as the gene sequence of GFP1-10) and transferred into oligodendrocyte progenitor cells; by using the characteristics that the peptide chains independently expressed by the first subsequence and the second subsequence are non-fluorescent and can spontaneously bind to form a fluorescent protein when they meet, the detection of whether the Sirt2 protein enters the nucleus can be carried out, and drugs or molecules that promote the differentiation of oligodendrocyte progenitor cells can be screened by high-throughput. The screening process does not require sacrificing animals, has low technical difficulty and low cost, and significantly improves the screening efficiency.

[0041] In some embodiments, two vectors are constructed. The first one fuses and expresses a nuclear localization signal at the N-terminus of GFP1-10, and the second one fuses and expresses GFP11 and sirt2. Then both vectors are stably transfected into oligodendrocyte progenitor cells. Since GFP1-10 carries NLS, it is localized in the nucleus after expression. The localization of GFP11 fused with sirt2 is the same as that of sirt2. When sirt2 enters the nucleus, GFP11 also enters the nucleus. At this time, GFP11 and GFP1-10 are close to each other, generating green fluorescence; when sirt2 is localized in the cytoplasm, GFP11 is also localized in the cytoplasm. At this time, GFP11 and GFP1-10 cannot be close to each other, and no green fluorescence is generated. Therefore, when green fluorescence is detected in oligodendrocyte progenitor cells, it means that the sirt2 of this cell is in the nucleus, that is, it means that the oligodendrocyte progenitor cells have differentiated. The stronger the green fluorescence, the higher the degree of differentiation; on the contrary, when there is no green fluorescence in oligodendrocyte progenitor cells, it means that the sirt2 of this cell is in the cytoplasm, that is, the cells are undifferentiated.

[0042] Optionally, the oligodendrocyte progenitor cells can be human oligodendrocyte progenitor cells, such as MO3.13 cells. Human oligodendrocyte progenitor cells are derived from the human body and can fully simulate the state of drugs or molecules acting on the human body, which helps to improve the accuracy of drug or molecule screening for human diseases. The oligodendrocyte progenitor cells can also be from other species, such as mammals such as mice and rats.

[0043] The length of GFP1-10 is greater than that of GFP11, and the length of NLS is shorter. Fusing GFP1-10 and NLS, and fusing GFP11 and sirt2 can ensure the normal expression of GFP1-10 and sirt2, and avoid affecting the normal expression of GFP1-10 and sirt2 due to fusion.

[0044] To make the technical solutions of the present disclosure clearer and easier to understand, the following will, in combination with the accompanying drawings and specific embodiments, provide a detailed description of the oligodendrocyte progenitor cell line and the construction method provided by the present disclosure.

[0045] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods, carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.

[0046] Figure 3 It is a schematic flow chart of screening drugs or molecules that promote the differentiation of oligodendrocyte progenitor cells provided by an embodiment of the present disclosure. As Figure 3 shown, the process includes four steps: plasmid construction, cell line construction, drug or molecule treatment, and imaging analysis. The following will provide a detailed description of the above four steps in sequence.

[0047] I. Plasmid construction

[0048] The plasmids used in the experiment were purchased from addgene, with catalog numbers #17448, #17447, #70219, and #70218. Among them, #17448 is a lentiviral expression vector carrying Puro, specifically pLenti CMV GFP Puro, #17447 is a lentiviral expression vector carrying Neo, specifically pLenti CMV GFP Neo, #70219 is a vector carrying GFP1-10, specifically pcDNA3.1-GFP(1-10), and #70218 is a vector carrying GFP11, specifically pACUH-GFP11x7.

[0049] 1. Construction of the 17448-NLS-GFP1-10 plasmid:

[0050] 1) Digest the 17448 plasmid to obtain a linearized 17448 vector. The system is as follows:

[0051]

[0052]

[0053] Digest at 37°C for 2 hours. Perform 1.5% agarose gel electrophoresis, cut the gel under a gel imager after 180V for 15 minutes, and take the band around 8000bp.

[0054] 2) Amplify the NLS-GFP1-10 sequence. The system is as follows:

[0055]

[0056] The PCR procedure is as follows:

[0057]

[0058] Perform agarose gel electrophoresis with 1.5% agarose. After 15 minutes at 180V, cut the gel under a gel imager and take a band around 750bp.

[0059] 3) Use Tiangen's gel extraction kit (#DP214) to extract the gel strips obtained in 1) and 2), to obtain purified NLS-GFP1-10 and linearized 17448 vector.

[0060] 4) Connect the NLS-GFP1-10 obtained in step 3) with the linearized 17448 vector by homologous recombination to obtain the 17448-NLS-GFP1-10 plasmid. The homologous recombination system is as follows:

[0061]

[0062] Incubate the above system in a 37°C water bath for 30 minutes to obtain the recombinant 17448-NLS-GFP1-10 plasmid.

[0063] 5) Screen, amplify and sequence the recombinant plasmid. The map of the 17448-NLS-GFP1-10 recombinant plasmid is shown in Figure 4 .

[0064] Among them, the NLS-GFP1-10 sequence (corresponding to sequence 1, where positions 1-21 are the NLS sequence; positions 22-687 are the GFP1-10 sequence) is as follows:

[0065] 1cccaagaaga agaggaaggt gatgtccaaa ggagaagaac tgtttaccgg tgttgtgcca

[0066] 61attttggttg aactcgatgg tgatgtcaac ggacataagt tctcagtgag aggcgaagga

[0067] 121gaaggtgacg ccaccattgg aaaattgact cttaaattca tctgtactac tggtaaactt

[0068] 181cctgtaccat ggccgactct cgtaacaacg cttacgtacg gagttcagtg cttttcgaga

[0069] 241tacccagacc atatgaaaag acatgacttt tttaagtcgg ctatgcctga aggttacgtg

[0070] 301caagaaagaa caatttcgtt caaagatgat ggaaaatata aaactagagc agttgttaaa

[0071] 361tttgaaggag atactttggt taaccgcatt gaactgaaag gaacagattt taaagaagat

[0072] 421ggtaatattc ttggacacaa actcgaatac aattttaata gtcataacgt atacatcact

[0073] 481gctgataagc aaaagaacgg aattaaagcg aatttcacag tacgccataa tgtagaagat

[0074] 541ggcagtgttc aacttgccga ccattaccaa caaaacaccc ctattggaga cggtccggta

[0075] 601cttcttcctg ataatcacta cctctcaaca caaacagtcc tgagcaaaga tccaaatgaa

[0076] 661aaaggaacag gtggcggcgg aagttag——Sequence 1.

[0077] 2. Construct the 17447-GFP11-sirt2 plasmid

[0078] 1) Digest the 17447 plasmid to obtain the linearized 17447 vector. The system is as follows:

[0079]

[0080] Digest at 37°C for 2 hours. Perform 1.5% agarose gel electrophoresis, cut the gel under the gel imager after 15 minutes at 180V, and take the band around 8000bp.

[0081] 2) Amplify the sirt2 sequence. The system is as follows:

[0082]

[0083] It should be noted that the method for extracting human cDNA can adopt the conventional cDNA extraction methods in the art, and the present disclosure does not limit this.

[0084] The PCR procedure is as follows:

[0085]

[0086] Perform electrophoresis using 1.5% agarose gel. After 15 minutes at 180 V, cut the gel under a gel imager and take the band around 1000 bp.

[0087] 3) Amplify the GFP11 sequence. The reaction system is as follows:

[0088]

[0089] The PCR procedure is as follows:

[0090]

[0091] Perform electrophoresis using 1.5% agarose gel. After 15 minutes at 180 V, cut the gel under a gel imager and take the band around 400 bp.

[0092] 4) Use the Tiangen Gel Extraction Kit (#DP214) to extract the gel strips obtained in 1), 2) and 3) to obtain the purified linearized 17447 vector, GFP11 and sirt2.

[0093] 5) Connect GFP11 and sirt2 obtained in step 4) with the linearized 17447 vector by homologous recombination to obtain the 17447-GFP11-sirt2 plasmid. The homologous recombination reaction system is as follows:

[0094]

[0095] Incubate the above reaction system in a water bath at 37 °C for 30 minutes to obtain the recombinant 17447-GFP11-sirt2 plasmid.

[0096] 6) Screen, amplify and sequence the recombinant plasmid. The map of the 17447-GFP11-sirt2 recombinant plasmid is shown in Figure 5 .

[0097] Among them, the GFP11-sirt2 sequence (corresponding to Sequence 2, where positions 1-438 are the GFP11 sequence; positions 439-1608 are the Sirt2 sequence) is as follows:

[0098] 1cgtgaccaca tggtccttca tgagtatgta aatgctgctg ggattacagg tggctctgga

[0099] 61ggtagagatc atatggttct ccacgaatac gttaacgccg caggcatcac tggcggtagt

[0100] 121ggaggacgcg accatatggt actacatgaa tatgtcaatg cagccggaataaccggaggg181tccggaggcc gggatcacat ggtgctgcat gagtatgtga acgcggcgggtataactggt241gggtcgggcg gacgagacca tatggtgctt cacgaatacg taaacgcagctggcattact301ggcggatcag gtggcaggga tcacatggta ctccatgagt acgtgaacgctgctggaatc361acaggcggta gcggcggtcg ggaccatatg gtcctgcacg aatatgtcaatgctgccggt421atcaccggcg gcaaattcat ggcagagcca gacccctctc accctctggagacccaggca481gggaaggtgc aggaggctca ggactcagat tcagactctg agggaggagccgctggtgga541gaagcagaca tggacttcct gcggaactta ttctcccaga cgctcagcctgggcagccag601aaggagcgtc tgctggacga gctgaccttg gaaggggtgg cccggtacatgcagagcgaa661cgctgtcgca gagtcatctg tttggtggga gctggaatct ccacatccgcaggcatcccc721gactttcgct ctccatccac cggcctctat gacaacctag agaagtaccatcttccctac781ccagaggcca tctttgagat cagctatttc aagaaacatc cggaacccttcttcgccctc841gccaaggaac tctatcctgg gcagttcaag ccaaccatct gtcactacttcatgcgcctg901ctgaaggaca aggggctact cctgcgctgc tacacgcaga acatagataccctggagcga961atagccgggc tggaacagga ggacttggtg gaggcgcacggcaccttctacacatcacac1021tgcgtcagcg ccagctgccg gcacgaatac ccgctaagct ggatgaaagagaagatcttc1081tctgaggtga cgcccaagtg tgaagactgt cagagcctgg tgaagcctgatatcgtcttt1141tttggtgaga gcctcccagc gcgtttcttc tcctgtatgc agtcagacttcctgaaggtg1201gacctcctcc tggtcatggg tacctccttg caggtgcagc cctttgcctccctcatcagc1261aaggcacccc tctccacccc tcgcctgctc atcaacaagg agaaagctggccagtcggac1321cctttcctgg ggatgattat gggcctcgga ggaggcatgg actttgactccaagaaggcc1381tacagggacg tggcctggct gggtgaatgc gaccagggct gcctggcccttgctgagctc1441cttggatgga agaaggagct ggaggacctt gtccggaggg agcacgccagcatagatgcc1501cagtcggggg cgggggtccc caaccccagc acttcagctt cccccaagaagtccccgcca1561cctgccaagg acgaggccag gacaacagag agggagaaac cccagtga——Sequence 2.

[0101] 3. The primer sequences used above are as follows:

[0102]

[0103] II. Construction and identification of the double-plasmid stable transfection MO3.13 cell line

[0104] 1. Culture of MO3.13 cells and 293T cells

[0105] The cells were cultured in a 5% CO2 incubator, and the culture medium consisted of: DMEM (Gibco, #11965092) + 10% fetal bovine serum (Biological Industries, #04-001-1ACS) + 1% penicillin / streptomycin (Gibco, #15140163). When the cell confluence reached over 90%, the cells were digested with 0.25% trypsin (Gibco, #25200056) for passage.

[0106] 2. Package lentivirus with 293T cells

[0107] Seed 293T cells into two 6-cm culture dishes. When the cell density reaches 70%, transfect the psPAX2 plasmid, pMD2.G plasmid, and 17448-NLS-GFP1-10 or 17447-GFP11-sirt2 plasmid into 293T cells at a ratio of 4:3:1. The transfection system is as follows:

[0108]

[0109] After mixing, let it stand at room temperature for 5 minutes, then add it dropwise into the culture dish and mix gently. Replace the fresh medium after 8 hours, and collect the supernatant after 48 hours. Filter it through a 0.22 μM filter to remove cell debris, and the culture medium containing NLS-GFP1-10 or GFP11-sirt2 lentivirus is obtained.

[0110] 3. Infect MO3.13 cells with NLS-GFP1-10 lentivirus

[0111] Seed MO3.13 cells into a 6-well plate. When the cell confluence reaches 50%, add the culture medium containing NLS-GFP1-10 lentivirus obtained in the previous step.

[0112] 4. Enrichment of puromycin-resistant MO3.13 positive cells

[0113] After 48 hours of infection, add puromycin (Beyotime, #ST551) for screening at a concentration of 2 μg / ml. Then replace the culture medium containing 2 μg / ml puromycin every two days for a total of 4 days, and then replace it with the culture medium without puromycin.

[0114] 5. Infect MO3.13 cells with GFP11-sirt2 lentivirus

[0115] Seed the cells screened with puromycin in the previous step into a 6-well plate. When the cell confluence reaches 50%, add the culture medium containing GFP11-sirt2 lentivirus.

[0116] 6. Enrichment of neomycin-resistant MO3.13 positive cells

[0117] After 48 hours of infection, G418 (Beyotime, #ST081) was added for screening at a concentration of 600 μg / ml. Thereafter, the medium containing 600 μg / ml G418 was changed every two days for a total of 8 days. During this period, when the cell confluence reached 90%, the cells were passaged, and after 8 days, the medium was changed to a medium without G418.

[0118] 7. Sub-cloning of MO3.13 positive cells

[0119] When the cell density reached 80%, the cells were digested with trypsin, centrifuged and collected at 300 g for 5 minutes, resuspended with 1 ml of medium, and cell counting was performed. According to the counting results, the cells were diluted to 10 cells / ml, then seeded into a 96-well plate, 100 μl per well, that is, 1 cell per well. After 10 days, the cells forming monoclonal colonies were selected, half of the cells were taken for gene identification, and the other half of the cells were seeded into a 24-well plate for further expansion culture.

[0120] 8. Identification of MO3.13 positive cells

[0121] The genomic DNA of the monoclonal cells to be identified was extracted and amplified with 2 pairs of identification primers. The amplification system was as follows:

[0122]

[0123] The PCR program was as follows:

[0124]

[0125] Electrophoresis was performed on a 1.5% agarose gel and observed under a gel imager after 15 minutes at 180 V. The PCR results were as Figure 6 shown. Positive cells could obtain a 733-bp band with the GFP11-sirt2 identification primers (identification primer 1-F / R) and a 635-bp band with the NLS-GFP1-10 identification primers (identification primer 2-F / R), while WT cells did not have bands when amplified with the 2 pairs of primers.

[0126] The sequences of the identification primers were as follows:

[0127]

[0128] III. Drug treatment or molecular manipulation

[0129] When performing drug screening, the MO3.13 positive cells can be treated with the drug to be screened.

[0130] β-Nicotinamide mononucleotide (hereinafter referred to as β-NMN) is known to enhance the differentiation of oligodendrocyte progenitor cells by promoting the nuclear entry of sirt2. Here, β-nicotinamide mononucleotide was selected to treat MO3.13 positive cells to verify whether the nuclear entry of sirt2 could result in green fluorescence expression in the nuclei of MO3.13 positive cells, that is, whether the screening system was reliable. The positive stable transfection cell line was treated with β-NMN (Bangtai, #BTO5) at a concentration of 1 mM, and the same volume of phosphate buffer (PBS) was added to the control group.

[0131] Here, after treating the cells for 48 hours, the culture medium was discarded, and the cells were washed 3 times with PBS buffer. Then, Hoechst 33342 (Beyotime, #C1025) live cell nuclear staining solution was added. After ten minutes, the staining solution was discarded, and the cells were washed 3 times with PBS buffer. Observation and photography were performed under an inverted fluorescence microscope. As Figure 7 shown, only a few sparse cells in the PBS group had green fluorescence, while the proportion of green fluorescent cells in the β-NMN treatment group increased significantly, and the green fluorescence was all in the cell nuclei, confirming the reliability of this system for drug screening. The constructed cell line can also be used to manipulate certain molecules to screen for molecules that promote or inhibit the differentiation of oligodendrocyte progenitor cells, with the same principle as above.

[0132] IV. Detection by high-content and other high-throughput imaging analysis systems

[0133] To enable high-throughput and rapid drug screening, a high-content imaging analysis system was selected for detection.

[0134] Exemplarily, the above-mentioned MO3.13 positive cells were seeded in a 96-well plate at 8000 cells per well. After 12 hours, the cells were treated with PBS or β-NMN at a concentration of 1 mM, and the same volume of PBS was added to the control group, with 6 replicates in each group. After treating the cells for 48 hours, the culture medium was discarded, and the cells were washed 3 times with PBS buffer. Then, Hoechst 33342 (Beyotime, #C1025) live cell nuclear staining solution was added. After ten minutes, the staining solution was discarded, and the cells were washed 3 times with PBS buffer. Finally, 100 μl of PBS was added to each well, and detection was performed using a confocal high-content imaging analysis system (manufacturer: Molecular Devices, model: ImageXpress). Nine pictures were set to be taken per well, as Figure 8 shown in A of the figure. After imaging, the analysis parameters were set, and the system would automatically analyze the images to obtain the results. As Figure 8 shown in B of the figure, it is the proportion of cells with GFP fluorescence among all cells, Figure 8Here, C is the average fluorescence intensity of GFP in the cell nucleus of each cell. It can be seen that β-NMN treatment can increase the proportion of GFP-positive cells and also increase the average fluorescence intensity of GFP in the cell nucleus. The above results indicate that the cell line provided in the embodiments of the present disclosure is adapted to high-throughput imaging analysis systems such as high-content imaging analysis systems, and the cells after drug treatment can meet the requirements of rapid imaging and precise analysis. The whole process takes a short time and is easy to operate, which is very suitable for high-throughput drug or molecule screening and can greatly improve the efficiency of drug or molecule screening.

[0135] Based on the same inventive concept, the embodiments of the present disclosure further provide a kind of oligodendrocyte progenitor cell line, and the cell line includes a first gene sequence and a second gene sequence; the first gene sequence and the second gene sequence are separated from each other; wherein, the first gene sequence includes the Sirt2 gene and a first subsequence (such as sequence 2); the second gene sequence includes a nuclear localization signal gene and a second subsequence (such as sequence 1); wherein, the peptide chains independently expressed by the first subsequence and the second subsequence have no fluorescence and can spontaneously bind to form a fluorescent protein when they meet. Optionally, the first subsequence is connected to the Sirt2 gene; the nuclear localization signal gene is connected to the second subsequence.

[0136] In some embodiments, the length of the first subsequence is less than the length of the second subsequence.

[0137] In some embodiments, the cell line is a human oligodendrocyte progenitor cell line, such as the MO3.13 cell line.

[0138] In some embodiments, the peptide chain expressed by the first subsequence is GFP11; the peptide chain expressed by the second subsequence is GFP1-10.

[0139] Based on the same inventive concept, the embodiments of the present disclosure further provide a method for constructing an oligodendrocyte progenitor cell line, including:

[0140] Construct a first plasmid including the Sirt2 gene and a first subsequence, such as 17447-GFP11-Sirt2; construct a second plasmid including the nuclear localization signal gene and a second subsequence, such as 17448-NLS-GFP1-10;

[0141] Transfect the first plasmid and the second plasmid into the oligodendrocyte progenitor cell line; wherein, the peptide chains independently expressed by the first subsequence and the second subsequence have no fluorescence and can spontaneously bind to form a fluorescent protein when they meet.

[0142] It should be noted that the first plasmid and the second plasmid can be constructed using plasmids other than 17447 and 17448, and the present disclosure does not limit this. It should be understood that the characteristics of the first plasmid and the second plasmid here are adapted to the subsequent transfection method, and the present disclosure does not limit this.

[0143] In some embodiments, the steps of constructing the first plasmid including the Sirt2 gene and the first subsequence include:

[0144] Digest the lentiviral overexpression vector with an enzyme to obtain a linearized vector;

[0145] Amplify the sirt2 gene sequence of human cDNA and amplify the first subsequence;

[0146] Perform homologous recombination on the linearized vector, the sirt2 gene sequence, and the first subsequence to obtain a recombinant plasmid;

[0147] Screen the recombinant plasmid to obtain the first plasmid.

[0148] Furthermore, the transfection method is selected from liposome-mediated transfection or virus-mediated transfection. Such transfection methods help to obtain a genetically stable cell line, which can be used for drug or molecule screening.

[0149] It should be noted that the above construction method is only exemplary, and other methods such as the crispr / cas9 technology can also obtain the cell line of the present disclosure. Specifically, crispr / cas9 mediates the knocking-in of sequence 1 and sequence 2 into the genome of the cell. Among them, cas9 is a nuclease that can be located at the target position under the guidance of sgRNA, recognize a specific sequence and cut. By adding sequences homologous to the genome at both ends of the cut site to both ends of sequence 1 and sequence 2, the foreign fragment can be inserted into the genome through homologous recombination.

[0150] The embodiments of the present disclosure also provide a kit for screening drugs or molecules that promote the differentiation of oligodendrocyte precursor cells, and the kit includes the cell line provided in any one of the foregoing embodiments or the cell line obtained by the construction method of any one of the embodiments.

[0151] In some embodiments, the kit further includes:

[0152] Identification primer 1-F: gag tac gtg aac gct gct gg (corresponding to sequence 9);

[0153] Identification primer 1-R: ctt tca tcc agc tta gcg ggt att c (corresponding to sequence 10);

[0154] Identification primer 2-F: agaggaaggtgatgtccaaagga (corresponding to sequence 11);

[0155] Identification primer 2-R: gctcaggactgtttgtgttgaga (corresponding to sequence 12).

[0156] The embodiments of the present disclosure also provide the use of the cell line provided in any of the foregoing embodiments or the cell line obtained by the construction method of any of the embodiments in the screening of drugs or molecules that promote the differentiation of oligodendrocyte progenitor cells. The drugs or molecules screened using the cell line of the embodiments of the present disclosure can delay myelin aging and brain aging, promote myelin repair, and treat neurodegenerative diseases caused by demyelination, including multiple sclerosis, Alzheimer's disease, Parkinson's syndrome, amyotrophic lateral sclerosis, and Huntington's disease, etc.

[0157] Those of ordinary skill in the art should understand that: the discussion of any of the above embodiments is only exemplary, and is not intended to imply that the scope of the present disclosure (including the claims) is limited to these examples; under the concept of the present disclosure, the technical features in the above embodiments or different embodiments can also be combined, the steps can be implemented in any order, and there are many other variations in different aspects of the embodiments of the present disclosure as described above, and they are not provided in detail for the sake of brevity.

[0158] The embodiments of the present disclosure are intended to cover all such substitutions, modifications, and variations that fall within the broad scope of the appended claims. Therefore, any omission, modification, equivalent substitution, improvement, etc. made within the spirit and principle of the embodiments of the present disclosure shall be included in the protection scope of the present disclosure.

Claims

1. An oligodendrocyte progenitor cell line, characterized in that, The cell line includes a first gene sequence and a second gene sequence; the first gene sequence and the second gene sequence are separated from each other; wherein, The first gene sequence includes the Sirt2 gene and a first subsequence; the second gene sequence includes a nuclear localization signal gene and a second subsequence; wherein, The peptide chains independently expressed by the first subsequence and the second subsequence are non-fluorescent, and when they meet, they can spontaneously combine to form a fluorescent protein.

2. The cell line according to claim 1, wherein The length of the first subsequence is less than the length of the second subsequence; and / or The cell line is a human oligodendrocyte progenitor cell line.

3. The cell line according to claim 1, characterized in that, The peptide chain expressed by the first subsequence is GFP11; the peptide chain expressed by the second subsequence is GFP1-10.

4. The cell line according to claim 1, characterized in that, The first gene sequence includes the sequence shown in Sequence 2; and / or the second gene sequence includes the sequence shown in Sequence 1.

5. A method for constructing an oligodendrocyte progenitor cell line, characterized in that, Comprising: Construct a first plasmid including the Sirt2 gene and a first subsequence; construct a second plasmid including a nuclear localization signal gene and a second subsequence; Transfect the first plasmid and the second plasmid into an oligodendrocyte progenitor cell line; wherein, the peptide chains independently expressed by the first subsequence and the second subsequence are non-fluorescent, and when they meet, they can spontaneously combine to form a fluorescent protein.

6. The construction method according to claim 5, wherein The transfection method is selected from liposome-mediated method or virus-mediated method.

7. The construction method according to claim 5, characterized in that The steps of constructing the first plasmid including the Sirt2 gene and a first subsequence include: Digest the lentiviral overexpression vector to obtain a linearized vector; Amplify the sirt2 gene sequence of human cDNA and amplify the first subsequence; Homologous recombine the linearized vector, the sirt2 gene sequence and the first subsequence to obtain a recombinant plasmid; Screen the recombinant plasmid to obtain the first plasmid.

8. A kit for screening drugs or molecules that promote the differentiation of oligodendrocyte progenitor cells, characterized in that, The kit includes the cell line according to any one of claims 1 to 4 or the cell line obtained by the construction method according to any one of claims 5 to 7.

9. A screening method for a drug or molecule that promotes the differentiation of oligodendrocyte progenitor cells, characterized in that, Comprising: Treat the cell line according to any one of claims 1 to 4 or the cell line obtained by the construction method according to any one of claims 5 to 7 with a drug to be screened or perform molecular manipulation; Perform nuclear staining on the treated cell line; Use a high-content imaging analysis system to detect and analyze the fluorescence of the nucleus; wherein, the fluorescence is emitted by the fluorescent protein.

10. Use of the cell line according to any one of claims 1 to 4 or the cell line obtained by the construction method according to any one of claims 5 to 7 in screening for drugs or molecules that promote the differentiation of oligodendrocyte progenitor cells.

Images