Acylase mutant and application thereof in synthesis of capryloyl glycine
By mutation of the amino acid sequence of Streptomyces, a acylase mutant with high catalytic activity and thermal stability was constructed, which solved the problems of low efficiency and environmental pollution in octanoyl glycine synthesis, and achieved efficient and environmentally friendly biocatalytic synthesis.
Patent Information
- Application Number
- CN202510502468.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-22
- Publication Date
- 2025-07-11
AI Technical Summary
In the prior art, the synthesis process of octanyl glycine has problems such as harsh reaction conditions, many by-products, and environmental pollution, and the catalytic efficiency of the acylase Sam-AA is low and the thermal stability is insufficient.
By mutation of amino acid sequences of acylase derived from Streptomyces, specific sites including E155D, Y160G, A330D and their combinations, a acylase mutant with high catalytic activity and thermal stability is constructed, and expressed in Rhodococcus, the biocatalytic synthesis of octanyl glycine is performed using genetically engineered bacteria.
It significantly improves the catalytic activity and thermal stability of the acylase, provides a solid foundation for the industrial production of octanyl glycine, reduces costs and reduces environmental pollution.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of enzyme engineering and biocatalysis, and particularly relates to an acyltransferase mutant with high catalytic activity, its encoding gene, recombinant engineering bacteria, and their application in catalyzing the synthesis of capryloylglycine from caprylic acid and glycine. Background Art
[0002] Capryloylglycine is a compound formed by connecting caprylic acid (C8 fatty acid) and glycine through an amide bond, with the chemical formula C 10 H 19 NO3, and it is an amphiphilic lipid amino acid.
[0003] Capryloylglycine is an active ingredient widely used in the fields of cosmetics, medicine, and food. Capryloylglycine is a good cosmetic functional ingredient and can be used as a conditioner, detergent, etc. in cosmetics. It has good affinity for the skin, can work efficiently, and can also efficiently transport other ingredients, so it can improve the use effect of other efficacy products. In addition, it has good antibacterial effects, has strong inhibitory effects on Staphylococcus aureus and Propionibacterium acnes, etc., and can also resist the excessive secretion of sebum, and has obvious effects on the prevention and treatment of acne. Capryloylglycine can effectively inhibit the activation of elastase, prevent the decomposition of elastin, and reduce skin wrinkles. It can regulate the self-repair function of the skin.
[0004] The traditional capryloylglycine synthesis process is mainly the acyl chloride method, and its steps are as follows: caprylic acid reacts with thionyl chloride to form capryl chloride, and then capryl chloride reacts with glycine under alkaline conditions (such as NaOH aqueous solution) to form capryloylglycine. In the post-treatment process, the reaction solution needs to be acidified, filtered, recrystallized, etc. to obtain the finished product. It has problems such as harsh reaction conditions (such as high temperature, strong acid / strong base), many by-products, and environmental pollution.
[0005] In recent years, the enzyme-catalyzed method has gradually become a new choice for synthesizing N-acyl amino acid compounds due to its low energy consumption and environmental friendliness. The inventor of the present invention screened through an enzyme library and found that the acyltransferase Sam-AA derived from a wild strain S. ambofaciens ATCC23877 has the ability to synthesize capryloylglycine, but it has problems such as low catalytic efficiency and insufficient enzyme thermal stability. Summary of the Invention
[0006] In order to overcome the above deficiencies, the present invention provides an acyltransferase mutant with high catalytic activity and excellent enzyme thermal stability, and solves the problems of low efficiency and high cost in the biosynthesis of capryloylglycine.
[0007] The present invention provides a Streptomyces - derived acylase mutant, whose amino acid sequence is as shown in SEQ ID NO.2 (NCBI accession number is WP_053128363.1), and there are mutations at one or more of the following sites based thereon: E155D, Y160G, A330D.
[0008] Furthermore, based on the amino acid sequence shown in SEQ ID NO.2, there are mutations at two or three of the following sites: E155D / Y160G, E155D / A330D, Y160G / A330D, E155D / Y160G / A330D.
[0009] The present invention also provides a nucleic acid encoding the acylase or its mutant.
[0010] The present invention provides a recombinant expression vector containing the nucleic acid, specifically with the pDD57 vector framework.
[0011] The present invention further provides a genetically engineered bacterium containing the nucleic acid or the recombinant expression vector.
[0012] Preferably, it is Rhodococcus.
[0013] The present invention provides the use of the acylase mutant or its encoding nucleic acid in the preparation of capryloylglycine compounds.
[0014] The present invention also provides a method for preparing capryloylglycine, which includes using the genetically engineered bacterium as a whole - cell catalyst and using caprylic acid and glycine as substrates to synthesize capryloylglycine.
[0015] Furthermore, the method specifically includes the following steps: centrifuging the fermented culture broth, discarding the supernatant, and collecting the precipitate to obtain wet bacterial cells; More specifically, a reaction system is composed of wet bacterial cells with a dosage of 5 - 30 g / L, caprylic acid with a concentration of 1.44 - 72 g / L, and 60% - 100% saturated amino acid solution; The reaction conditions are to carry out a biocatalytic reaction at a temperature of 35 - 65 °C, a pH of 5.5 - 8.5, and a stirring speed of 100 - 300 rpm to obtain capryloylglycine compounds.
[0016] The acylase mutant provided by the present invention has a significant improvement compared to the wild - type acylase and excellent enzyme thermal stability, providing a solid foundation for the industrial production of capryloylglycine by enzyme catalysis. Detailed implementation mode
[0017] The following further elaborates on the present invention through specific examples, in order to better understand the present invention, but does not constitute a limitation to the present invention.
[0018] The product detection method used in the examples is as follows: The product prepared in the present invention was detected by high performance liquid chromatography. Chromatographic column: C18, 4.6 mm × 250 mm, 5 μm; detection wavelength: ultraviolet (UV) = 200 nm; mobile phase: 35% acetonitrile and 65% 0.05% trifluoroacetic acid aqueous solution; column temperature: 30 °C; flow rate: 1 mL / min; detection time: 15 min.
[0019] Example 1. Obtaining of Sam-aa expression strain The Sam-aa gene fragment was synthesized by Nanjing Genscript Biotech Co., Ltd. and recombined onto the pDD57 vector. The recombination sites were NdeI and EcoRI. Its nucleotide sequence is shown in SEQ ID NO.1, and the encoded amino acid sequence is shown in SEQ ID NO.2. Its expression plasmid was named pDD57-Sam-aa.
[0020] The above Sam-aa red ball expression plasmid was electrotransformed into the competent cells of Rhodococcus sp. ATCC 12674 to obtain the Sam-aa expression strain.
[0021] Example 2. Protein expression of Sam-aa The Sam-aa expression strain obtained in Example 1 was inoculated into a TSB liquid medium containing 100 μg / ml kanamycin resistance (tryptone 17 g / L, soy peptone 3 g / L, sodium chloride 5 g / L, glucose 2.5 g / L, dipotassium hydrogen phosphate 2.5 g / L), and cultured at 30 °C and 200 rpm for 16 h. Then, it was inoculated into a fresh fermentation medium (glucose 5 g / L, yeast extract 3 g / L, tryptone 3 g / L, malt extract 3 g / L, dipotassium hydrogen phosphate 0.5 g / L, potassium dihydrogen phosphate 0.5 g / L, magnesium sulfate 1 g / L, urea 1 g / L, pH adjusted to 7) at an inoculation amount of 5% (v / v), and cultured at 30 °C and 200 rpm for 48 h. Centrifuged at 4 °C and 8000 rpm for 20 min, the supernatant was discarded, and the precipitate was collected to obtain wet bacterial cells.
[0022] Example 3. Construction of Sam-aa mutant library Using the plasmid pDD57-Sam-aa constructed in Example 1 as a template, error-prone PCR was carried out. Error-prone PCR was carried out under the action of primer 1 (attaagaaggagatatacatATGAGTGATTCAGGAACAGCT, SEQ ID NO.3) and primer 2 (ctggatccagctcgaattctcACGACGCATCGAT, SEQ ID NO.4). PCR reaction system (total volume 50 μL): 10×Taq DNA polymerase Buffer 5 μL, 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP and dTTP) 4 μL, 10 mM dCTP 0.8 μL, 10 mM dTTP 0.8 μL, 1 μL each of primer 1 and primer 2 with a concentration of 10 μM, plasmid template 2 μL, R-Taq enzyme 1 μL, Mg 2+ (25 mM) 4 μL, Mn 2+ (0.5 mM) 4 μL, made up to 50 μL with deionized water. The PCR amplification program was: pre-denaturation at 95 °C for 5 min; entering the cycle (denaturation at 95 °C for 30 s; annealing at 56 °C for 20 s; extension at 72 °C for 1 min), a total of 25 cycles, final extension at 72 °C for 10 min, to obtain the gene fragment.
[0023] Using pDD57 as a template, PCR amplification was carried out with primer 3 (CATCATCATCATCATCACTGAattcgagctggatccagctt, SEQ ID NO.5) and primer 4 (atgtatatctccttcttaattaagcatgc, SEQ ID NO.6) (PrimerStar 25 μL, ddH2O 20 μL, 1.5 μL each of upstream and downstream primers, template 2 uL. The PCR amplification program was: pre-denaturation at 98 °C for 2 min; entering the cycle (denaturation at 98 °C for 10 s; annealing at 56 °C for 15 s; extension at 72 °C for 30 s), a total of 25 cycles, final extension at 72 °C for 5 min), to obtain the vector fragment.
[0024] The above two fragments were subjected to homologous recombination using the Novoprotein One Step Recombination Kit. The reaction system was: gene fragment 1 μL, vector fragment 1 μL, 5×buffer 2 μL, recombinase 1 μL, H2O 5 μL. React at 37 °C for 30 min. The homologous recombination product was finally transferred into the competent cells of Rhodococcus sp. ATCC 12674 and cultured at 30 °C for 48 h to obtain the Sam-aa mutant library. Example 4, High-throughput screening of the Sam-aa mutant library Pick 500 monoclonal colonies from the Sam-aa mutant library obtained in Example 3, inoculate them into a 96-well plate to culture the monoclonal colonies, with each monoclonal colony containing 500 μL of TSB liquid medium, culture at 30 °C and 200 rpm for 16 h, then inoculate into fresh fermentation medium at an inoculation amount of 5% (v / v), and culture at 30 °C and 200 rpm for 48 h. Centrifuge at 5000 rpm for 5 min, discard the supernatant, and collect the precipitate to obtain 500 wet mutant cells.
[0025] Perform caproylglycine biosynthesis on the above wet cells. The final concentration composition and catalytic conditions of the catalytic system (200 μL) are as follows: add 2.88 mg of octanoic acid, 200 μL of saturated glycine, and pH 8.0 to the wet cells. Reaction conditions: temperature 37 °C, 800 rpm, reaction time 24 h. After the reaction is completed, shake and mix evenly, analyze the reaction solution using HPLC to obtain the caproylglycine synthase activity.
[0026] Analysis conditions: chromatographic column: C18, 4.6 mm × 250 mm, 5 μm; detection wavelength: ultraviolet (UV) = 200 nm; mobile phase: 65% acetonitrile and 35% 0.05% trifluoroacetic acid aqueous solution; column temperature: 30 °C; flow rate: 1 mL / min; detection time: 15 min.
[0027] By comparing the relative values of the enzyme activities of the mutants and the wild type, a total of 3 dominant mutants were screened, and the results are shown in Table 1.
[0028] Table 1. Information of acyltransferase mutants
[0029] As can be seen from the results shown in Table 1, single mutations of E155D, Y160G, or A330D can increase the caproylglycine synthase activity of the Sam-aa acyltransferase.
[0030] Example 5 Obtaining double-point and triple-point mutants of acyltransferase Using the recombinant plasmid pDD57-Sam-aa constructed in Example 1 as a template, whole plasmid PCR amplification was carried out. The addition amounts of each component in the PCR system (total volume 50 μL) were: PrimerStar 25 μL, ddH2O 20 μL, 1.5 μL of each primer corresponding to the mutation site, and 2 μL of the template. The PCR amplification program was: pre-denaturation at 98°C for 2 min; entering the cycle (denaturation at 98°C for 10 s; annealing at 56°C for 15 s; extension at 72°C for 70 s), a total of 25 cycles, and final extension at 72°C for 5 min. After the PCR reaction was completed, 1 μL of DpnI was added and digested at 37°C for 30 min. Then, it was transferred into the competent cells of Rhodococcus sp. ATCC 12674 to obtain the corresponding mutants. The acylase gene sequence was determined by DNA sequencing, and the mutants were obtained as wet cells by the method in Example 2.
[0031] The wet cells were assayed for caprylglycine synthase activity. The synthesis reaction system (10 mL) contained: 144 mg of octanoic acid, 10 mL of saturated glycine solution, 0.1 g of wet cells, and pH 8.0. The reaction was carried out at 37°C for 24 h. After the reaction was completed, the caprylglycine synthase activity was evaluated according to the method recorded in Example 4. The results of the relative enzyme activity values relative to the wild type are shown in Table 2.
[0032] Table 2. Information on acylase mutants
[0033] From the results shown in Table 2, it can be seen that the acylase mutants E155D / Y160G, E155D / A330D, Y160G / A330D, and E155D / Y160G / A330D can also improve the caprylglycine synthase activity of Sam-aa acylase.
[0034] Example 6. Detection of acylase thermal stability After incubating the wild-type acylase, E155D / Y160G, E155D / A330D, Y160G / A330D, and E155D / Y160G / A330D acylase at 60°C for 30 min, the caprylglycine synthase activity was evaluated according to the method recorded in Example 5. The results of the relative enzyme activity values relative to the wild type are shown in Table 3.
[0035] Table 3. Results of acylase thermal stability
[0036] According to the results in Table 3, it can be seen that E155D / Y160G, E155D / A330D, Y160G / A330D, and E155D / Y160G / A330D can all improve the thermal stability of the acylase.
Claims
1. An acyltransferase mutant derived from Streptomyces, characterized in that, There are substitution mutations at one or more of the following sites based on the amino acid sequence shown in SEQ ID NO.2: E155D, Y160G, A330D.
2. The Streptomyces - derived acylating enzyme mutant according to claim 1, characterized in that, There is any one of the following mutations: E155D, Y160G, A330D, E155D / Y160G, E155D / A330D, Y160G / A330D or E155D / Y160G / A330D.
3. Nucleic acid encoding the acylase mutant as claimed in claim 1 or 2.
4. A recombinant expression vector containing the nucleic acid as claimed in claim 3.
5. The recombinant expression vector according to claim 4, wherein It is based on the vector framework of pDD57.
6. A genetically engineered bacterium containing the nucleic acid as claimed in claim 3, or the recombinant expression vector as claimed in claim 4 or 5.
7. The genetically engineered bacterium according to claim 6, wherein It is Rhodococcus.
8. Use of the acylase mutant as claimed in claim 1 or 2, or its encoding nucleic acid in the preparation of capryloyl glycine compounds.
9. A method for preparing a capryloyl glycine compound, characterized in that, It includes using the genetically engineered bacterium as claimed in claim 6 or 7 as a whole cell catalyst, and using caprylic acid and glycine as substrates to synthesize capryloyl glycine.
10. The preparation method according to claim 9, characterized in that, With the wet cell dosage of 5 - 30 g / L, the caprylic acid concentration of 1.44 - 72 g / L, and 60% - 100% saturated glycine solution to form a reaction system; The reaction conditions are to carry out biocatalytic reaction at a temperature of 35 - 65 °C, pH 5.5 - 8.5, and a stirring speed of 100 - 300 rpm to obtain capryloyl glycine.
Citation Information
Cited By
Mutant of acylase and application of mutant in synthesis of sodium cocoyl glycinate
CN120843489A