Screening method of m6A functional site of Dnajb1 and application of m6A functional site in ischemic myocardial injury

Abstract

The invention provides a screening method of an m6A functional site of Dnajb1 and application of the Dnajb1 in ischemic myocardial injury, provides an m6A modified Dnajb1 specific primer, verifies that m6A regulatory protein acts on the m6A functional site of the Dnajb1, and perfects application of epigenetic modification in a myocardial infarction molecular mechanism. And a precise direction is provided for molecular diagnosis and treatment of m6A modified and mediated myocardial infarction.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and relates to a method for screening m6A functional sites of Dnajb1 and its application in ischemic myocardial injury. Background Art

[0002] Currently, there are 330 million cardiovascular disease patients in China, and the incidence and mortality rates are increasing year by year. Among them, about 1 million new myocardial infarction patients are added every year, and the prevention and control situation is not optimistic. N6-methyladenosine (m6A) is the methylation modification of the nitrogen atom at the 6th carbon of adenosine. As the most abundant epigenetic modification of mammalian mRNA, it plays an important role in cardiovascular diseases. The dynamic and reversible process of m6A is regulated by methyltransferases, demethylases, and methyl recognition proteins, and is involved in RNA processing, maturation, degradation, and translation, affecting various pathological processes such as inflammation, cell death, and proliferation.

[0003] Heat shock proteins (HSPs), also known as molecular chaperones, including sHSP (HSPB), HSP40 (DNAJ), HSP70 (HSPA), and HSP90 (HSPC), etc., are involved in the folding of newly synthesized polypeptides, the refolding of metastable proteins, the assembly of protein complexes, and the degradation of misfolded proteins to maintain cellular protein homeostasis and protect cells from stress damage. HSPs play a crucial role in protecting cardiomyocytes from hypoxia, ischemia, and infection, etc., indicating their potential for treating cardiovascular diseases. Currently, the regulatory application between m6A modification and HSPs related to myocardial infarction-induced cardiac ischemic injury is not yet perfect. Summary of the Invention

[0004] Based on the above, the purpose of the present invention is to provide a method for screening m6A functional sites of Dnajb1 and its application in ischemic myocardial injury.

[0005] To achieve the technical purpose, the technical solution adopted by the present invention is as follows:

[0006] An m6A functional site of Dnajb1 includes site1, site2, and site3. The nucleotide sequence of site1 is as shown in SEQ ID No.1, the nucleotide sequence of site2 is as shown in SEQ ID No.2, and the nucleotide sequence of site3 is as shown in SEQ ID No.3.

[0007] A method for screening m6A functional sites of Dnajb1 includes:

[0008] a. Jointly analyze the data of MeRIP-seq and RNA-seq, set the cut-off values of |Fold change| > 0.5 and p < 0.05, and clarify the changes in m6A modification and mRNA expression levels of RNA after myocardial infarction;

[0009] b. Predict the m6A modification sites of Dnajb1 by combining with the SRAMP database, select the sites with higher credibility and collect the corresponding sequence information, synthesize specific primers related to the m6A modification sites of Dnajb1 and verify them by MeRIP-qPCR, and screen for genes with stable differential m6A modification; Evaluate the protein expression levels regulating m6A modification during myocardial infarction by Western Blot.

[0010] Preferably, the m6A functional sites of Dnajb1 obtained by screening include site1, site2 and site3. The nucleotide sequence of site1 is shown in SEQ ID No.1, the nucleotide sequence of site2 is shown in SEQ ID No.2, and the nucleotide sequence of site3 is shown in SEQ ID No.3.

[0011] Preferably, the specific primers include:

[0012] site1-F: 5′-GAAAGTCCCTGGAGAAGGCC-3′,

[0013] site1-R: 5′-ATGGGAAGAACCTGCTCCAG-3′;

[0014] site2-F: 5′-GCTTTTGCTCTGCCGAATGT-3′,

[0015] site2-R: 5′-AGAGGGTGGGTCCATTCCAG-3′;

[0016] site3-F: 5′-GGAGCTAGCCTGGTGTTCTG-3′,

[0017] site3-R: 5′-CTGCTCCCCTGAGGTTTAGC-3′.

[0018] Preferably, it further includes: performing IGV visualization analysis on the m6A functional sites of Dnajb1 using the MeRIP-seq data after myocardial infarction.

[0019] Preferably, the above screening method further includes: performing dual-luciferase reporter gene on the m6A functional sites of Dnajb1 according to the preliminary verification results of MeRIP-qPCR to screen for specific sites that METTL3 can act on.

[0020] More preferably, pcDNA3.1 vector is selected for METTL3, and pmirGLO vector is selected for the plasmid. The wild-type plasmids WT1, WT2, WT3 of the m6A functional site of Dnajb1 and the mutant plasmids Mut1, Mut2 and Mut3 are constructed respectively. The nucleotide sequences of each plasmid are as follows:

[0021] WT1: ATTCCCGTCTCATCCAGAACCATCCTGGAGCAGGTT;

[0022] Mut1: ATTCCCGTCTCATCCAGAGCCATCCTGGAGCAGGTT;

[0023] WT2: GATAGGCAGGCGGTGGGAACAGCAGCCCTCCTGGAA;

[0024] Mut2: GATAGGCAGGCGGTGGGACCAGCAGCCCTCCTGGAA;

[0025] WT3: AGTGTGACAGCATTAAAGACTGATGCTAAACCTCAG;

[0026] Mut3: AGTGTGACAGCATTAAAGCCTGATGCTAAACCTCAG.

[0027] Use of the m6A functional site of the above-mentioned Dnajb1 in the preparation of a drug for treating cardiac ischemic injury.

[0028] Furthermore, the drug inhibits ferroptosis in ischemic and hypoxic cardiomyocytes through the m6A functional site of Dnajb1.

[0029] Furthermore, the drug participates in the expression of ferroptosis-related proteins in the process of myocardial infarction through Dnajb1 regulated by METTL3, reduces the accumulation of lipid peroxidation (MDA) and the depletion of reduced glutathione (GSH), controls the cardiac ischemic area, and affects the cardiac function injury induced by myocardial infarction.

[0030] The present invention clarifies the regulatory characteristics of m6A modification in ischemic heart injury, and reveals a regulatory mechanism of m6A modification-related HSPs in the pathological process of myocardial infarction. The present invention provides specific primers for m6A-modified Dnajb1 and verifies that m6A regulatory proteins act on the m6A functional site of Dnajb1, improving the research on the molecular mechanism of myocardial infarction related to epigenetic modification, and providing a precise direction for molecular diagnosis and treatment of myocardial infarction mediated by m6A modification. Brief Description of the Drawings

[0031] Figure 1 Results of the combined analysis of MeRIP-seq and RNA-seq in Example 1.

[0032] Figure 2 Results of screening Dnajb1 m6A modification sites using specific primers in Example 2. Among them, A represents the modification levels of three m6A sites of Dnajb1 in the heart tissues of myocardial infarction mice, MI 4w represents 4 weeks after ligation of the left anterior descending branch; B represents the modification levels of three m6A sites of Dnajb1 in hypoxic primary cardiomyocytes; C represents the IGV visualization analysis of Dnajb1 m6A modification peaks in MeRIP-seq.

[0033] Figure 3 Results of the functional m6A modification sites of Dnajb1 affected by the upstream regulatory protein of m6A modification in Example 3. Among them, A represents the expression of m6A regulatory proteins in hypoxic primary cardiomyocytes; B represents the modification levels of three m6A sites of Dnajb1 when METTL3 is knocked down; C represents the dual-luciferase reporter gene assay of the functional sites where METTL3 acts on Dnajb1 mRNA.

[0034] Figure 4 Results of the cardioprotective effect exerted by m6A-modified Dnajb1 in myocardial infarction ferroptosis in Example 4. Among them, A represents that overexpression of m6A-modified Dnajb1 can reduce the protein degradation rate of the ferroptosis effector protein GPX4; B represents that Dnajb1 mainly slows down the degradation of GPX4 through the autophagy-lysosome pathway; C represents the enhanced interaction between GPX4 and the autophagy-related protein LC3B under hypoxia and ferroptosis induction in primary cardiomyocytes; D represents that METTL3-regulated Dnajb1 can participate in the expression of ferroptosis-related proteins during myocardial infarction; E represents that METTL3-regulated Dnajb1 can reduce the accumulation of lipid peroxides (MDA) and the depletion of reduced glutathione (GSH); F represents that METTL3-regulated Dnajb1 can control the cardiac ischemic area; G represents that METTL3-regulated Dnajb1 can affect myocardial infarction-induced cardiac function injury. Detailed implementation manners

[0035] To illustrate the present invention more clearly, the present invention will be further described in detail below in conjunction with examples and with reference to the accompanying drawings. Those skilled in the art should understand that the specific content described below is illustrative rather than restrictive, and should not be used to limit the protection scope of the present invention.

[0036] For the specific method steps adopted in the following examples, if there is no special description, conventional technical means in the art can be used to implement them.

[0037] Example 1: Evaluation of the m6A modification level of genes after myocardial infarction

[0038] In this invention, the detection of the m6A modification level adopts the MeRIP-seq method. By using an antibody that specifically recognizes m6A modification to enrich the RNA fragments with m6A modification in the sample, combined with high-throughput RNA sequencing and bioinformatics analysis, the changes in m6A modification and mRNA expression levels during the pathological process of myocardial infarction are explored.

[0039] (1) Construction of a mouse myocardial infarction model: SPF-grade C57BL / 6J strain mice were selected for the experiment. While maintaining anesthesia, the four limbs of the mice were fixed in the supine position. The surface skin was disinfected with alcohol, and an oblique incision of 1-2 cm was made parallel to the costal arch on the left side of the xiphoid process. The anterior chest wall muscle layer was bluntly separated with straight and curved ophthalmic forceps. While gently pushing the curved hemostat between the fourth and fifth intercostal spaces, the left index finger and middle finger were used to squeeze the heart downward and leftward at the same time when the curved hemostat entered the heart cavity, so that the apex of the heart was exposed. The approximate position where the left anterior descending branch of the coronary artery was located was found at the junction of the continuation line of the left auricle to the apex of the heart and the upper middle 1 / 3 of the heart, and it was ligated with 6-0 silk thread. The depth of needle insertion was about 0.5-1 mm. After ligation, the gas in the thoracic cavity was fully evacuated and the pre-buried skin surface suture was tightened. After tying a knot, the anesthesia machine was turned off and the remaining gas in the thoracic cavity was evacuated again. Except for not ligating, the sham operation group performed the same operation steps as the myocardial infarction group.

[0040] (2) Quality control of RNA concentration, purity and integrity: Four weeks after ligation of the left anterior descending branch, the left ventricular tissues of myocardial infarction mice and sham operation group mice were taken and stored in a liquid nitrogen tank. After extracting total RNA, quantification and quality control were carried out. The ND-1000 was used to measure the RNA concentration of the samples and read the OD260 / OD280 value. The RNA with a purity in the range of 1.8-2.0 met the standard.

[0041] (3) Preparation and sequencing of MeRIP libraries: First, the m6A-specific antibody immunoprecipitation of mRNA was performed using the m6A RIP kit. Libraries were constructed for both Input samples and IP samples, and after detecting the integrity, purity and quality of the RNA, high-throughput sequencing was carried out.

[0042] (4) Joint analysis of sequencing data: The Input samples without immunoprecipitation reaction were used to analyze the differentially expressed mRNAs in each group, and cross-analysis was performed with the IP samples immunoprecipitated in each group. The genes with m6A modification and their m6A modification peaks in each group of samples were identified. The regulatory relationship between m6A modification and mRNA expression of genes was observed at the m6A modification level and mRNA level, and enrichment analysis such as GO and KEGG was carried out on the differentially m6A genes.

[0043] The results are as Figure 1As shown, the combined analysis of MeRIP-seq and RNA-seq showed that the m6A modification levels and expression levels of genes in the heart tissues of mice after myocardial infarction could have different changes, such as an increase in m6A modification and an upregulation of its expression level (6), an increase in m6A modification and a decrease in its expression level (6), a decrease in m6A modification and a decrease in its expression level (3), a decrease in m6A modification and an upregulation of its expression level (4), an increase in m6A modification but no obvious change in its expression level (392), a decrease in m6A modification but no obvious change in its expression level (256), no obvious change in m6A modification level but an upregulation of its expression level (125), no obvious change in m6A modification level but a decrease in its expression level (67), etc.

[0044] Example 2: Screening of Dnajb1 m6A modification sites using specific primers

[0045] The present invention predicts the Dnajb1 m6A modification sites using the SRAMP database (https: / / www.cuilab.cn / sramp), selects the sites with higher credibility and collects the corresponding sequence information. RRACH (R = A or G, H = A, C or U) is the characteristic motif of m6A modification. Specific primers related to the Dnajb1 m6A modification sites are synthesized and verified by MeRIP-qPCR.

[0046] The 3 screened Dnajb1 m6A modification sites are ( A are the bases where RNA methylation occurs):

[0047] site1:

[0048] CATCCCTGTTGTATTCAAAGATGTCATCAGGCCTGGTATGCGGCGGAAAGTCCCTGGAGAAGGCCTCCCTCTCCCCAAAACACCTGAGAAACGTGGAGACCTTGTTATCGAGTTTGAAGTGATCTTCCCGGAAAGGATTCCCGTCTCATCCAGA A CCATCCTGGAGCAGGTTCTTCCCATATAGCCACCTGCACTCCT(SEQ ID No.1)

[0049] site2:

[0050] AGACCGTTCCACTGGTTGCATACTGCGGGAGGGCCCAGGGAGGGCTTTTGCTCTGCCGAATGTTTTCCACAGAATATATTACAATCTTTCAAAGTCGCGCACTAGACTACAGTGGTTTTTCGAGCGATAGGCAGGCGGTGGGA A CAGCAGCCCTCCTGGAATGGACCCACCCTCTGCACCCCAGCTCCTGCCCAAGGGTGTGAGGCAGGCCTGCA(SEQID No.2)

[0051] site3:

[0052] CTGTGATGGGATCAGACCTGGGCGTGAAAGTATCTGTTCTTTGGAGCTAGCCTGGTGTTCTGACCATTCAACTCATTGTAAGTTGCCACTACCAACACAAGACCAAAGTGTGTGACTTGTCATTATGCAGTGTGACAGCATTAAAG A CTGATGCTAAACCTCAGGGGAGCAGTCCTTCGACTCTGTTTGAGGGCTTTGCTGGGGGGAGGAGCGGCATGGTTACTGTTCTCATTCTCAAAAGAAAGCTCTGTTTCCCTTCCTGGGACACATTGGTTTCCCGTTCAGGACCCCAGCATCACTGTGGTGACGGTTGGGGTAGGA(SEQ ID No.3)

[0053] (1) Preparation of experimental reagents and consumables: Magna MeRIP TM m6A Kit kit (main components are shown in the following table), 3M sodium acetate (pH 5.2), glycogen, absolute ethanol, RNase-free water; magnetic stand, 200 μL PCR reaction tubes, 96-well reaction plates and 1.5 mL EP tubes.

[0054]

[0055] (2) RNA collection and quality detection: Prepare mouse left ventricular tissue or primary cardiomyocytes, collect 300 μg of total RNA (about 300 mg of left ventricular tissue or primary cardiomyocytes from 75 neonatal mice are required), add 300 μL of RNase-free water to fully dissolve the RNA, and then pass through The concentration of RNA and OD260 / OD280 were measured by ND-1000. The quality of RNA and the presence or absence of genomic DNA residue were detected by agarose gel electrophoresis.

[0056] (3) RNA fragmentation treatment: The RNA was processed in batches into fragments of 100 nt. A total of 17 tubes of 18 uL (about 18 ug) RNA were aliquoted into 200 μL PCR tubes. After adding 2 μL of Fragmentation Buffer (10×), it was heated at 94 °C for 4 minutes on a common PCR instrument, and then immediately 2 μL of EDTA was added and placed on ice to terminate the fragmentation reaction.

[0057] (4) RNA precipitation: The fragmented RNA in each tube was collected into a new enzyme-free EP tube. After adding 1 / 10 volume of 3 M sodium acetate, glycogen (final concentration of 100 μg / mL), and 2.5 times volume of absolute ethanol, it was placed in an -80 °C refrigerator to precipitate overnight. After overnight, the RNA was taken out and transferred to a 4 °C centrifuge, centrifuged at 15000 g for 25 min. After discarding the supernatant, 75% ethanol was added to wash the RNA precipitate, centrifuged at 15000 g for 15 min at 4 °C. After discarding the supernatant, the precipitate was air-dried. 300 μL of RNase-free water was added to each tube to fully dissolve the RNA, and agarose gel electrophoresis was used to evaluate the length of the fragmented RNA. 10% of each sample was taken as input (30 μg) and stored at -80 °C for later use.

[0058] (5) Magnetic bead preparation: The magnetic beads were pretreated according to the ratio of total RNA (fragmented): m6A antibody: magnetic beads = 300 μg: 10 μg: 50 μL. For each sample, two 1.5 mL EP tubes were taken to incubate the m6A antibody and the IgG antibody of the same species respectively. After blowing and resuspending the magnetic beads, 50 μL was slowly aspirated, and the magnetic beads were washed 2 - 3 times with 10 times volume of 1×IP buffer using a magnetic stand. After discarding the supernatant, 4 times volume of 1×IP buffer (200 μL), 10 μg of m6A antibody or IgG antibody were added, and incubated with rotation at room temperature for 30 min. Subsequently, the magnetic beads were washed 2 - 3 times with 10 times volume of 1×IP buffer using a magnetic stand. After discarding the supernatant, the magnetic beads were placed on ice for later use.

[0059] (6) m6A-RNA immunoprecipitation (MeRIP): The reaction system for m6A RNA immunoprecipitation was prepared according to the following system. For each sample, 500 μL of the reaction system was added to the washed magnetic beads (m6A-binding magnetic beads and IgG-binding magnetic beads) in step (5). After gently mixing by rotation, it was incubated with rotation at 4 °C for 2 h. Subsequently, the magnetic beads were washed 2 - 3 times with 10 times volume of 1×IP buffer using a magnetic stand and then placed on ice.

[0060]

[0061] (7) Elution: Add the MeRIP product to 100 μL of Elution Buffer (elution system). The specific preparation method is shown in the following table. After gently rotating and mixing, incubate at 4 °C with rotation for 1 h. After brief centrifugation, place on a magnetic stand for 1 min. Transfer the supernatant containing the eluted RNA fragments to a new 1.5 mL EP tube. Add 100 μL of Elution Buffer to collect the eluate again. Finally, a total of 200 μL of eluate containing m6A RNA is obtained.

[0062]

[0063] (8) Purification: Select the TIANGEN (DP412) RNA purification kit. 100×β-mercaptoethanol needs to be added to the lysis solution RK solution before use (1 mL of RK solution + 10 μL of β-mercaptoethanol). The working solution of the washing solution RW solution needs to be diluted with absolute ethanol (RW solution + 4 volumes of absolute ethanol). Add 700 μL of RK working solution to 200 μL of RNA eluate and mix well. Then add 500 μL of absolute ethanol. After mixing well, transfer to an adsorption column and centrifuge at 4 °C, 12,000 rpm for 30 s. Discard the supernatant, add 500 μL of RW working solution, let stand at room temperature for 2 min, then centrifuge at 4 °C, 12,000 rpm for 30 s and discard the supernatant. Transfer the adsorption column to a new 1.5 mL collection tube, and dissolve the RNA on the adsorption column with 14 - 20 μL of RNase-free water. Let stand at room temperature for 2 min, then centrifuge at 12,000 rpm for 2 min to obtain purified RNA.

[0064] (9) Reverse transcription and fluorescence quantitative PCR reaction: Only random primers need to be added in the reverse transcription reaction. The qPCR primers used in this step are shown in the following table.

[0065]

[0066] The results are as Figure 2 shown. A shows an increase in the modification of three m6A sites of Dnajb1 in the heart tissue of myocardial infarction mice; B shows an up-regulation of the modification levels of three m6A sites of Dnajb1 in hypoxic primary cardiomyocytes; C shows the IGV visualization analysis of the m6A modification peaks of Dnajb1 in MeRIP-seq. Compared with the heart tissue of sham-operated mice, the modification peaks of three m6A sites of Dnajb1 are up-regulated in the myocardial infarction group.

[0067] Example 3: Screening for upstream regulatory proteins modified by m6A acting on the functional m6A modification sites of Dnajb1

[0068] The present invention evaluates the protein expression levels regulating m6A modification during myocardial infarction by Western Blot, and detects the Dnajb1 m6A functional sites bound by m6A modification regulatory proteins using a dual-luciferase reporter gene assay.

[0069] 3.1 Operating steps of Western Blot (WB): WB detection mainly includes steps such as gel preparation, electrophoresis, membrane transfer, blocking, antibody incubation, and development. The main reagents and experimental conditions required for each step are listed in the following table. After collecting images with an e-BLOT TouchImager contact chemiluminescence imaging system, Image J is used for gray value analysis.

[0070]

[0071]

[0072] 3.2 Dual-luciferase reporter gene assay

[0073] (1) Preparation of plasmids and cell lines: According to the preliminary verification results of MeRIP-qPCR, a dual-luciferase reporter gene is performed on 3 sites of Dnajb1 methylation modification to screen specific sites that METTL3 can act on. METTL3 is selected with the pcDNA3.1 vector, divided into a negative control group (NC) and an overexpression group (METTL3-OE); the plasmid is selected with the pmirGLO vector, and wild-type plasmids and mutant plasmids WT1, WT2, WT3, Mut1, Mut2, and Mut3 of 3 m6A modification sites (site1, site2, site3) of Dnajb1 are constructed respectively (sequence information is shown in the following table). The tool cell 293T (Cell Bank of the Chinese Academy of Sciences) is selected for this experiment.

[0074]

[0075] (2) Cell plating and transfection: In this experiment, 12-well plates are used to culture cells, inoculated at 15×10 4 cells / well. After the cells adhere for 4 - 6 h, observe the cell density and perform transfection. The transfection is divided into 12 groups: NC+WT1, METTL3-OE+WT1, NC+MUT1, METTL3-OE+MUT1, NC+WT2, METTL3-OE+WT2, NC+MUT2, METTL3-OE+MUT2, NC+WT3, METTL3-OE+WT3, NC+MUT3, and METTL3-OE+MUT3. The dosage of each plasmid in the 12-well plate is 1 μg. Observe the cell state 6 h after transfection and change the medium. Further detection can be carried out 36 - 48 h after transfection.

[0076] (3) Application of Dual-Luciferase Reporter Assay System: After cell transfection, wash the cells 2-3 times with 4°C PBS, dilute the 5× lysis buffer with sterile water and add 200 μL to each well. Incubate at room temperature with shaking for 30 min and then place in a -80°C refrigerator for overnight lysis. The next day, thaw the cell-lysis buffer suspension at room temperature and centrifuge at 4000 g for 10 min. Set 5 replicates for each group, take 30 μL of the supernatant for detection, add 50 μL of the prepared LAR II, and read the firefly luciferase activity value of each well on a fluorescence microplate reader. Subsequently, add 100 μL of the diluted Stop& Read the renilla luciferase activity value of each well again, and finally calculate the ratio of firefly luciferase to renilla luciferase (F / R) for analysis.

[0077] The results are as Figure 3 shown. A shows the expression of m6A regulatory proteins in hypoxic primary cardiomyocytes. It can be seen that the expression of the m6A methyltransferase METTL3 is upregulated, and the expression of other m6A-regulated enzymes shows little difference or no significant difference. B shows the modification levels of three m6A sites of Dnajb1 when METTL3 is knocked down. It can be seen that after knocking down METTL3, the modification levels of the three m6A sites of Dnajb1 all decrease to varying degrees. C shows the dual-luciferase reporter gene assay of the functional site of METTL3 acting on Dnajb1 mRNA. Compared with the NC group, the luciferase activities decreased after the METTL3 overexpression group was combined with the WT groups of Dnajb1 m6A modification sites site1 and site2. Among them, the luciferase activity decreased more significantly and was statistically significant after the METTL3 overexpression plasmid was combined with the WT group of site2, and there was no downward trend in the luciferase activity of the MUT group of site2, indicating that the binding effect of METTL3 to the Dnajb1 m6A modification site site2 is more specific, while there was no significant change in the luciferase activity of the WT group of site3.

[0078] Example 4: Application of METTL3-mediated Dnajb1 m6A modification in ischemic myocardial injury

[0079] The present invention clarifies the mode of action of Dnajb1 as a chaperone on effector molecules in the pathological process of myocardial infarction, clarifies the ferroptosis inhibitory effect of m6A-modified Dnajb1 in ischemic and hypoxic cardiomyocytes through liposome transfection, and uses an adeno-associated virus vector containing a cardiac-specific promoter to confirm the regulatory role of METTL3-mediated Dnajb1 m6A modification in myocardial infarction ferroptosis.

[0080] 4.1 Ferroptosis inhibitory effect of m6A-modified Dnajb1 in myocardial infarction

[0081] (1) Ferroptosis-related detection

[0082]

[0083] (2) The mode of action of Dnajb1 on the ferroptosis effector protein GPX4

[0084]

[0085] 4.2 Construction and application of adeno-associated virus vectors containing cardiac-specific promoters

[0086] Targeting cardiomyocytes, adeno-associated virus of serotype AAV9 was selected based on the cTnT promoter. Two virus vectors, pcAAV-cTnT-MCS-WPRE and pAAV-cTnT-3×FLAG-tWPA, were chosen to construct adeno-associated viruses with overexpression of Dnajb1 and co-overexpression of Dnajb1 and METTL3 respectively. After virus packaging and purification, the titers of adeno-associated viruses were detected. Mice were divided into 6 groups: Sham+AAV-NC, Sham+AAV-Dnajb1, Sham+AAV-Dnajb1+METTL3, MI+AAV-NC, MI+AAV-Dnajb1, and MI+AAV-Dnajb1+METTL3, with 12 mice in each group. Intravenous injection was performed via the tail vein at a total virus dose of 1E11 vg / animal. The volume of virus required for each mouse was calculated based on the virus titers of each group, and an appropriate amount of PBS was added according to the number of mice to be injected with the virus so that the total volume of intravenous injection for each mouse was approximately 150 μL.

[0087] As Figure 4As shown, A represents primary cardiomyocytes with overexpressed Dnajb1 treated with cycloheximide, and the results show that overexpression of m6A-modified Dnajb1 can reduce the protein degradation rate of the ferroptosis effector protein GPX4; B is the exploration of the Dnajb1-regulated GPX4 protein degradation pathway, where MG132 is an inhibitor of the ubiquitin-proteasome pathway and CQ (chloroquine) is an inhibitor of the autophagy-lysosome pathway. Dnajb1 mainly slows down the degradation of GPX4 through the autophagy-lysosome pathway; C is the detection of LC3B expression after immunoprecipitation of the GPX4 purified protein sample, indicating that the interaction between GPX4 and the autophagy-related protein LC3B is enhanced under hypoxia and ferroptosis induction in primary cardiomyocytes; D-G are the verifications of the regulatory mechanism of METTL3 / Dnajb1 in the expression of ferroptosis-related proteins, lipid peroxide accumulation, reduced glutathione (GSH) depletion, cardiac function injury after myocardial infarction, and myocardial fibrosis. The results show that Dnajb1 regulated by METTL3 can participate in the expression of ferroptosis-related proteins during myocardial infarction. Dnajb1 regulated by METTL3 can reduce lipid peroxide (MDA) accumulation and reduced glutathione (GSH) depletion. Dnajb1 regulated by METTL3 can control the cardiac ischemic area and affect cardiac function injury induced by myocardial infarction.

[0088] Obviously, the above-mentioned embodiments of the present invention are merely examples for more clearly illustrating the present invention, rather than limiting the implementation manners of the present invention. For those of ordinary skill in the art, based on the above description, other different forms of changes or variations can be made. It is impossible to enumerate all the implementation methods here. Any obvious changes or variations derived from the technical solutions of the present invention still fall within the protection scope of the present invention.

Claims

1. An m6A functional site of Dnajb1, including site1, site2, and site3. The nucleotide sequence of site1 is shown as SEQ ID No.1, the nucleotide sequence of site2 is shown as SEQ ID No.2, and the nucleotide sequence of site3 is shown as SEQ ID No.

3.

2. A screening method for the m6A functional site of Dnajb1, comprising: a. Jointly analyze the data of MeRIP-seq and RNA-seq, set the cut-off values of |Fold change| > 0.5 and p < 0.05, and clarify the changes in m6A modification and mRNA expression levels of RNA after myocardial infarction; b. Predict the m6A modification sites of Dnajb1 by combining with the SRAMP database, select sites with higher credibility and collect the corresponding sequence information, synthesize specific primers related to the m6A modification sites of Dnajb1 and verify them by MeRIP-qPCR to screen differentially stable m6A-modified genes; evaluate the protein expression levels regulating m6A modification during myocardial infarction by Western Blot.

3. The screening method according to claim 2, wherein The screened m6A functional sites of Dnajb1 include site1, site2, and site3. The nucleotide sequence of site1 is shown as SEQ ID No.1, the nucleotide sequence of site2 is shown as SEQ ID No.2, and the nucleotide sequence of site3 is shown as SEQ ID No.

3.

4. The screening method according to claim 3, wherein The specific primers include: Dnajb1-1-F: 5′-GAAAGTCCCTGGAGAAGGCC-3′, Dnajb1-1-R: 5′-ATGGGAAGAACCTGCTCCAG-3′; Dnajb1-2-F: 5′-GCTTTTGCTCTGCCGAATGT-3′, Dnajb1-2-R: 5′-AGAGGGTGGGTCCATTCCAG-3′; Dnajb1-3-F: 5′-GGAGCTAGCCTGGTGTTCTG-3′, Dnajb1-3-R: 5′-CTGCTCCCCTGAGGTTTAGC-3′.

5. The screening method according to claim 2, wherein It also includes: Performing IGV visualization analysis on the m6A functional sites of Dnajb1 using MeRIP-seq data after myocardial infarction.

6. The screening method according to claim 2, wherein It also includes: Performing dual-luciferase reporter gene on the m6A functional sites of Dnajb1 according to the preliminary verification results of MeRIP-qPCR to screen specific sites that METTL3 can act on.

7. The screening method according to claim 6, characterized in that, METTL3 uses the pcDNA3.1 vector, and the plasmid uses the pmirGLO vector. Wild-type plasmids WT1, WT2, WT3 and mutant plasmids Mut1, Mut2, and Mut3 of the m6A functional sites of Dnajb1 are constructed respectively. The nucleotide sequences of each plasmid are as follows: WT1: ATTCCCGTCTCATCCAGAACCATCCTGGAGCAGGTT; Mut1: ATTCCCGTCTCATCCAGAGCCATCCTGGAGCAGGTT; WT2: GATAGGCAGGCGGTGGGAACAGCAGCCCTCCTGGAA; Mut2: GATAGGCAGGCGGTGGGACCAGCAGCCCTCCTGGAA; WT3: AGTGTGACAGCATTAAAGACTGATGCTAAACCTCAG; Mut3: AGTGTGACAGCATTAAAGCCTGATGCTAAACCTCAG.

8. Use of an m6A functional site of Dnajb1 as described in claim 1 or an m6A functional site of Dnajb1 obtained by the screening method as described in any one of claims 2 to 7 in the preparation of a drug for treating cardiac ischemic injury.

9. The application according to claim 8, characterized in that, The drug inhibits ferroptosis in ischemic and hypoxic cardiomyocytes through the m6A functional site of Dnajb1.

10. The application according to claim 8, characterized in that, The drug participates in the expression of ferroptosis-related proteins during myocardial infarction through Dnajb1 regulated by METTL3, reduces the accumulation of lipid peroxide MDA and the depletion of reduced glutathione GSH, controls the cardiac ischemic area, and affects the cardiac function injury induced by myocardial infarction.

Images