Capture probe, kit containing the same and use thereof in detecting T cell and B cell immune repertoire at spatial resolution

Abstract

The present application belongs to the field of biological detection technology, and relates to a capture probe, a kit containing the same, and the use of the same in detecting T cell and B cell immune repertoires at spatial resolution. The capture probe comprises a transcript-specific sequence; the transcript-specific sequence is derived from the first 40 bp of the reverse complementary sequence of the J region transcript sequence and has a length of 20 bp to 35 bp. The advantages of using the capture probe to detect T cell and B cell immune repertoires at spatial resolution include: not all RNA with a poly A tail will be reverse transcribed, only the targeted RNA will be reverse transcribed, so the sequencing cost will be significantly reduced, and it is not limited by the degree of poly A degradation of the RNA in the sample.

Description

Technical Field

[0001] The present application relates to the field of biological detection technology, and in particular to a capture probe, a kit containing the same, and the use of the same in detecting T cell and B cell immune repertoires at spatial resolution. Background Art

[0002] Biological systems are inherently spatially organized, with cellular interactions and molecular processes occurring within specific spatial environments. Adaptive immune function relies on T and B cells in spatial environments, including antigen-stimulated expansion and cytotoxicity. Previous studies have attempted to sequence spatial immune receptors in fresh samples at a low resolution of 55 μm. However, the combined analysis of high-resolution spatial transcriptomes with TCR (T Cell Receptor) and BCR (B Cell Receptor) immune receptors has not been explored in depth. Furthermore, paraffin-embedded clinical samples cannot be captured using existing technologies. Simultaneously examining gene expression and the T / BCR immune receptor repertoire reflected by the spatial transcriptome in spatially high-resolution sections is of great value in studying spatial biology.

[0003] Existing methods for sequencing the CDR3 (complementarity-determining region 3) region use polymerase chain reaction (PCR)-based RNA-seq (RNA sequencing) technology, which captures mRNA using a poly A probe for reverse transcription, followed by nested PCR amplification on full-length cDNA, also known as RACE (rapid amplification of cDNA ends). These methods are limited to undegraded samples, in which the mRNA retains the poly A tail for universal reverse transcription. However, clinical samples are typically fixed with formalin and stored at room temperature, resulting in severe mRNA degradation, making sequencing impossible using any existing technology.

[0004] Existing technologies use a low resolution of 55 μm for capture, which makes it difficult to apply to the precise analysis of biological tissues with complex and variable structures such as tumors, as well as analysis with single cell resolution.

[0005] In addition, due to the limitations of next-generation sequencing (NGS), nested PCR after reverse transcription was designed to shorten the length of the cDNA library and construct a library starting close to the CDR3 region.

[0006] Therefore, there is an urgent need in this field to develop new methods for detecting T cell and B cell immune repertoires. Summary of the Invention

[0007] Based on this, it is necessary to provide at least one capture probe, a kit comprising the same, and the use of the same for detecting T cell and B cell immune repertoires at spatial resolution.

[0008] In a first aspect of the present application, there is provided a capture probe for detecting T cell and B cell immune repertoires at spatial resolution, the capture probe comprising a transcript-specific sequence;

[0009] The transcript-specific sequence is derived from the first 40 bp of the reverse complementary sequence of the transcript sequence of the J region or V region gene of TCR and BCR, and has a length of 20 bp to 35 bp;

[0010] The J region transcript sequence is derived from the Framework-4 (FR4) region;

[0011] The V region transcript sequence is derived from the Framework-2 (FR2) region and the Framework-3 (FR3) region.

[0012] In some embodiments, the J region transcript sequence is selected from the group consisting of 5863, 5864, 5865, 5866, 5867, 5868, 5869, 5719, 5720, 5721, 5722, 5723, 5532, 5533, 5534, 5535, 5536, 5536, 5537, 5538, 5538, 5539, 5540, 5540, 5540, 5540, 5540, 12277, 12278, 12279, 12280, 12281, 12283, 12284, 12285 80, 12281, 12257, 12258, 12259, 12260, 12162, 12163, 12164, 12165, 12166, 12167, 12167, 12168, 12169, 12170, 12171, 12172, 12173, 12174, 12175, 12037, 12038, 12039, 12040, 12041, 12041, 12042, 12043, 12044, 12044, 12045, 12046, 12047, 12048, 12049, 12050, 12051, 12051, 12052, 12053, 12054, 12055, 12055, 12056, 12057, 12058, 12059, 12060, 12061, 12062, 12063, 12064, 12065, 12066, 12067, 12067, 12068, 12069, 12069, 12070, 12 The group consisting of 071, 12072, 12072, 12073, 12073, 12074, 12075, 12075, 12076, 12077, 12078, 12079, 12080, 12081, 12082, 12083, 12084, 12085, 12086, 12087, 12088, 12089, 12090, 12091, 12092, 12093, 12094, 12095, 12096 and 12097.

[0013] In some embodiments, the V region transcript sequence is selected from the group consisting of the following: 5550, 5552, 5559, 5546, 5547, 5548, 5549, 5551, 5553, 5554, 5555, 5556, 5557, 5558, 5562, 49601, 38040, 5576, 5574, 5575, 5577, 49602, 5613, 5620, 5628, 5580, 5581, 5582, 5583, 5584, 5585, 5586, 5587, 5588, 5589, 5590, 5591, 5592, 5593, 5594, 5595, 5596, 5597 7, 5598, 5599, 5600, 5601, 5602, 5603, 5604, 50322, 5605, 5606, 5607, 5608, 5609, 5610, 5611, 5612, 5614, 5615, 5616, 5617, 49603, 5618, 5619, 5621, 5 622, 5623, 5624, 5625, 5626, 5627, 5652, 5645, 5647, 5648, 5649, 5650, 5657, 5651, 5653, 5654, 5655, 5656, 5661, 5659, 5660, 5662, 5665, 5663, 5664, 5665 666、5667、5669、5704、5671、5673、5676、5678、5683、5684、5685、5687、5688、5695、5703、5694、5698、5706、5709、5741、5742、5743、5744、5730、5731、 5732、5733、5734、5735、5736、5737、5738、5739、5740、5759、5746、5747、5748、5749、5750、5751、5752、5753、5754、5755、5756、5757、5758、5788、5776、 5777, 5778, 5780, 5781, 5782, 5783, 5784, 5785, 5789, 5792, 5793, 5794, 5797, 5798, 5799, 5800, 5801, 5804, 5821, 5815, 5816, 5817, 5818, 5819, 5820, 5829, 5823, 5824, 5825, 5834, 5835, 5836, 5837, 5838, 5839, 5876, 5877, 5878, 5879, 5880, 5881, 5882, 5894, 5895, 5887, 5888, 5889, 5890, 5891, 5892,5893、5896、5904、5915、5918、5897、5898、5899、5901、5903、5905、5906、5908、5910、5911、5912、5913、5914、5919、5920、5921、5922、5924、5925、5926、5927、5929、5930、5931、5933、5884、5885、5886、5936、5938、5940、5941、5943、5944、12101、12102、12116、12128、12140、12143、12144、12145、12146、12147、12148、12149、12150、12151、12152、12153、12154、12103、12104、12105、12106、12107、12108、12109、12110、12111、12112、12113、12114、12115、12117、12118、12119、12120、12121、12122、12123、12124、12125、12126、12127、12129、12130、12131、12132、12133、12134、12135、12137、12138、12139、12141、12142、12262、12263、12264、12176、12195、12212、12213、12215、12216、12217、12218、12219、12220、12221、12222、12223、12224、12225、12226、12227、12228、12229、12230、12231、12232、12233、12234、12235、12236、12237、12238、12239、12240、12241、12242、12243、12245、12246、12177、12178、12179、12180、12181、12182、12183、12184、12185、12186、12187、12188、12189、12190、12191、12192、12193、12194、12196、12198、12200、12201、12203、12205、12207、12208、12209、12210、12214、12284、12287、12288、12289、12290、12291、12292、12293、12294、12295、12285、12286、The group consisting of the sequences shown in 12296 and 12297.

[0014] In some embodiments, the transcript-specific sequence is shown in any one of SEQ ID NO: 2 to SEQ ID NO: 854.

[0015] In some embodiments, the capture probe further comprises a sequence required for high-throughput sequencing.

[0016] In some embodiments, the sequence required for high-throughput sequencing is connected to the 5' end or 3' end of the transcript-specific sequence.

[0017] In some embodiments, the length of the sequence required for high-throughput sequencing is 21 bp.

[0018] In some embodiments, the sequence required for high-throughput sequencing is shown as SEQ ID NO: 1.

[0019] In a second aspect of the present application, a probe composition is provided, which comprises the capture probe as described in the first aspect.

[0020] In some embodiments, the probe composition further comprises a whole transcriptome probe.

[0021] In a third aspect of the present application, a kit is provided, comprising one or more of the capture probes described in the first aspect and the probe composition described in the second aspect.

[0022] In some embodiments, the kit further comprises reagents for reverse transcription and reagents for adding a poly A tail.

[0023] In a fourth aspect of the present application, a method for constructing a sequencing library for detecting T cell and B cell immune repertoires at spatial resolution is provided, the method comprising:

[0024] Probe hybridization: mixing the tissue section and the probe composition according to the second aspect to prepare a tissue 1 after probe hybridization;

[0025] Reverse transcription: mixing the tissue 1 with the whole transcriptome probe to prepare tissue 2 to which the whole transcriptome probe is connected, and reverse transcribing the capture probe in the tissue 2 to prepare tissue 3 containing cDNA;

[0026] Adding a poly A tail: adding a poly A tail to the cDNA to prepare tissue 4 containing the cDNA with the poly A tail;

[0027] Chip hybridization: A chip carrying DNA oligonucleotides encoding spatial position information is mixed with the tissue 4 to capture the whole transcriptome probe and the cDNA with a poly A tail, and pre-amplification and amplification are performed successively to construct a sequencing library.

[0028] In some embodiments, the working concentrations of the capture probe and the human whole transcriptome probe in the probe composition are independently 1 nM to 100 nM.

[0029] In some embodiments, the tissue section is a preserved tissue section.

[0030] In some embodiments, the thickness of the tissue section is 1 μm to 50 μm.

[0031] In a fifth aspect of the present application, a method for detecting T cell and B cell immune repertoires at spatial resolution is provided, the method comprising:

[0032] Constructing a sequencing library: constructing a sequencing library using the method described in the fourth aspect;

[0033] Sequencing: The sequencing library is sequenced.

[0034] In some embodiments, in the sequencing step, sequencing is performed using next generation sequencing technology.

[0035] The direct targeted capture and reverse transcription used in the above method are superior to existing methods in at least the following aspects:

[0036] First, not all RNAs with poly A tails will be reverse transcribed, only the targeted RNA will be reverse transcribed, so the sequencing cost will be significantly reduced;

[0037] Second, even if the poly A tail has been degraded, the fragmented RNA remaining in formalin-fixed clinical samples can still be captured;

[0038] Finally, the region and length of the cDNA can be restricted to the target region, facilitating sequencing by NGS. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to more clearly illustrate the technical solutions in the implementation methods and examples of this application and to more completely understand the application and its beneficial effects, the following briefly introduces the drawings required for the description of the implementation methods or examples. Obviously, the drawings described below are only some embodiments of the present application. For those skilled in the art, other drawings can be obtained based on these drawings without creative work. It should also be noted that the drawings are all drawn in a simplified form and are only used to conveniently and clearly assist in explaining the present application.

[0040] Figure 1 This is a schematic diagram of the probe-based human immune receptor repertoire sequence capture sequencing in one embodiment of the present application.

[0041] Figure 2 A schematic diagram showing the mapping of spatial human immune receptor repertoire sequences to the human CDR3 region based on probe capture in one embodiment of the present application.

[0042] Figure 3 Shows the spatial visualization results of BCR sequence capture by specific probes in one embodiment of the present application.

[0043] Figure 4 Shows the spatial visualization results of TCR sequence capture by specific probes in one embodiment of the present application.

[0044] Figure 5 The comparison results of example BCR transcripts captured by specific probes in one embodiment of the present application are shown.

[0045] Figure 6 The comparison results of example BCR transcripts captured by specific probes in one embodiment of the present application are shown.

[0046] Figure 7 The spatial visualization result of capturing the CDR1 sequence of BCR by a specific probe in one embodiment of the present application is shown.

[0047] Figure 8 The spatial visualization result of capturing the CDR2 sequence of BCR by a specific probe in one embodiment of the present application is shown. DETAILED DESCRIPTION

[0048] To facilitate understanding of the present application, a more comprehensive description of the present application will be provided below with reference to the accompanying drawings. The accompanying drawings illustrate preferred embodiments of the present application. However, the present application may be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a more thorough and comprehensive understanding of the disclosure of the present application.

[0049] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this application pertains. The terms used herein in the specification of this application are for the purpose of describing specific embodiments only and are not intended to limit this application. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0050] In this application, unless otherwise specified, "one or more" refers to any one of the listed items or any combination of the listed items. Similarly, "one or more" and other similar expressions that refer to "one or more" are also understood in the same way unless otherwise specified.

[0051] The terms "combination thereof", "any combination thereof", "any combination thereof" and the like used in this application include all suitable combinations of any two or more of the listed items.

[0052] In this application, the word "suitable" in "suitable combination", "suitable method", "any suitable method", etc. shall be based on the ability to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.

[0053] In this application, the terms "further," "further," "particularly," "for example," "such as," "example," and "for example" are used for descriptive purposes to indicate that the preceding and following technical solutions are related in terms of the content covered, but should not be construed as limiting the preceding technical solution or the scope of protection of this application. In this application, unless otherwise specified, A (such as B) means that B is a non-limiting example of A, and it is understood that A is not limited to B.

[0054] In this application, the terms "optionally," "optional," and "optional" mean optional, that is, they refer to either option selected from the two parallel options of "yes" or "no." If multiple "options" appear in a technical solution, unless otherwise specified and there are no contradictions or mutual constraints, each "optional" is independent. Unless otherwise specified, the descriptions "optionally include," "optionally include," etc. in this application, taking "optionally include" as an example, mean "may include or not include."

[0055] As used herein, the terms "comprising," "including," and "include" are synonymous and are inclusive or open-ended, not excluding additional, unrecited members or features. Examples of members or features include materials or components, structures, elements, and instruments. Non-limiting examples of members or features include actions, conditions for the occurrence of actions, timing, and states.

[0056] In this application, the technical features or technical solutions described in open language include closed technical features or technical solutions composed of the listed contents, and also include open technical features or technical solutions containing the listed contents.

[0057] In this application, exemplary descriptions such as "in some embodiments (or examples)" and "in one embodiment (or example)" may include but are not limited to the following meanings: these solutions can be combined with other solutions in a suitable manner to form new technical solutions.

[0058] In this application, the terms "first," "second," "third," "fourth," etc. in "the first aspect," "the second aspect," "the third aspect," "the fourth aspect," etc. are used for descriptive purposes only and should not be understood as indicating or implying relative importance or quantity, nor should they be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first," "second," "third," "fourth," etc. serve only for the purpose of non-exhaustive enumeration and description, and should be understood not to constitute a closed-ended limitation on quantity.

[0059] In this application, when referring to a numerical interval (i.e., a numerical range), unless otherwise specified, the distribution of the optional numerical values ​​in the numerical interval is considered to be continuous and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical interval, and each numerical value between the two numerical endpoints. Unless otherwise specified, when a numerical interval only refers to an integer in the numerical interval, including the two endpoint integers of the numerical range and each integer between the two endpoints, is equivalent to directly enumerating each integer. When multiple numerical ranges are provided to describe a feature or characteristic, these numerical ranges can be merged. In other words, unless otherwise specified, the numerical range disclosed herein should be understood to include any and all subranges included therein. The "numerical value" in the numerical interval can be any quantitative value, such as a number, a percentage, a ratio, etc. "Numerical interval" allows broadly including numerical interval types such as percentage intervals, ratio intervals, and ratio intervals.

[0060] In this application, if a method flow involves multiple steps, unless otherwise specified herein, there is no strict order restriction on the execution of these steps, and they can be executed in an order other than the order described. Moreover, any step can include multiple sub-steps or multiple stages, and these sub-steps or stages do not necessarily need to be completed at the same time, but can be executed at different times, and their execution order is not necessarily sequential, but can be executed in turn, alternating, or simultaneously with other steps or parts of sub-steps or stages of other steps.

[0061] In a first aspect of the present application, there is provided a capture probe for detecting T cell and B cell immune repertoires at spatial resolution, the capture probe comprising a transcript-specific sequence;

[0062] The transcript-specific sequence is derived from the first 40 bp of the reverse complementary sequence of the transcript sequence of the J region or V region gene of TCR and BCR, and has a length of 20 bp to 35 bp;

[0063] The J region transcript sequence is derived from the Framework-4 (FR4) region;

[0064] The V region transcript sequence is derived from the Framework-2 (FR2) region and the Framework-3 (FR3) region.

[0065] In some embodiments, the J region transcript sequence is selected from the group consisting of 5863, 5864, 5865, 5866, 5867, 5868, 5869, 5719, 5720, 5721, 5722, 5723, 5532, 5533, 5534, 5535, 5536, 5536, 5537, 5538, 5538, 5539, 5540, 5540, 5540, 5540, 5540, 12277, 12278, 12279, 12280, 12281, 12283, 12284, 12285 80, 12281, 12257, 12258, 12259, 12260, 12162, 12163, 12164, 12165, 12166, 12167, 12167, 12168, 12169, 12170, 12171, 12172, 12173, 12174, 12175, 12037, 12038, 12039, 12040, 12041, 12041, 12042, 12043, 12044, 12044, 12045, 12046, 12047, 12048, 12049, 12050, 12051, 12051, 12052, 12053, 12054, 12055, 12055, 12056, 12057, 12058, 12059, 12060, 12061, 12062, 12063, 12064, 12065, 12066, 12067, 12067, 12068, 12069, 12069, 12070, 12 The group consisting of 071, 12072, 12072, 12073, 12073, 12074, 12075, 12075, 12076, 12077, 12078, 12079, 12080, 12081, 12082, 12083, 12084, 12085, 12086, 12087, 12088, 12089, 12090, 12091, 12092, 12093, 12094, 12095, 12096 and 12097.

[0066] In some embodiments, the V region transcript sequence is selected from the group consisting of the following: 5550, 5552, 5559, 5546, 5547, 5548, 5549, 5551, 5553, 5554, 5555, 5556, 5557, 5558, 5562, 49601, 38040, 5576, 5574, 5575, 5577, 49602, 5613, 5620, 5628, 5580, 5581, 5582, 5583, 5584, 5585, 5586, 5587, 5588, 5589, 5590, 5591, 5592, 5593, 5594, 5595, 5596, 5597 7, 5598, 5599, 5600, 5601, 5602, 5603, 5604, 50322, 5605, 5606, 5607, 5608, 5609, 5610, 5611, 5612, 5614, 5615, 5616, 5617, 49603, 5618, 5619, 5621, 5 622, 5623, 5624, 5625, 5626, 5627, 5652, 5645, 5647, 5648, 5649, 5650, 5657, 5651, 5653, 5654, 5655, 5656, 5661, 5659, 5660, 5662, 5665, 5663, 5664, 5665 666、5667、5669、5704、5671、5673、5676、5678、5683、5684、5685、5687、5688、5695、5703、5694、5698、5706、5709、5741、5742、5743、5744、5730、5731、 5732、5733、5734、5735、5736、5737、5738、5739、5740、5759、5746、5747、5748、5749、5750、5751、5752、5753、5754、5755、5756、5757、5758、5788、5776、 5777, 5778, 5780, 5781, 5782, 5783, 5784, 5785, 5789, 5792, 5793, 5794, 5797, 5798, 5799, 5800, 5801, 5804, 5821, 5815, 5816, 5817, 5818, 5819, 5820, 5829, 5823, 5824, 5825, 5834, 5835, 5836, 5837, 5838, 5839, 5876, 5877, 5878, 5879, 5880, 5881, 5882, 5894, 5895, 5887, 5888, 5889, 5890, 5891, 5892,5893、5896、5904、5915、5918、5897、5898、5899、5901、5903、5905、5906、5908、5910、5911、5912、5913、5914、5919、5920、5921、5922、5924、5925、5926、5927、5929、5930、5931、5933、5884、5885、5886、5936、5938、5940、5941、5943、5944、12101、12102、12116、12128、12140、12143、12144、12145、12146、12147、12148、12149、12150、12151、12152、12153、12154、12103、12104、12105、12106、12107、12108、12109、12110、12111、12112、12113、12114、12115、12117、12118、12119、12120、12121、12122、12123、12124、12125、12126、12127、12129、12130、12131、12132、12133、12134、12135、12137、12138、12139、12141、12142、12262、12263、12264、12176、12195、12212、12213、12215、12216、12217、12218、12219、12220、12221、12222、12223、12224、12225、12226、12227、12228、12229、12230、12231、12232、12233、12234、12235、12236、12237、12238、12239、12240、12241、12242、12243、12245、12246、12177、12178、12179、12180、12181、12182、12183、12184、12185、12186、12187、12188、12189、12190、12191、12192、12193、12194、12196、12198、12200、12201、12203、12205、12207、12208、12209、12210、12214、12284、12287、12288、12289、12290、12291、12292、12293、12294、12295、12285、12286、The group consisting of the sequences shown in 12296 and 12297.

[0067] In some embodiments, the transcript-specific sequence is derived from the first 40 bp, first 39 bp, first 38 bp, first 37 bp, first 36 bp, first 35 bp, first 34 bp, first 33 bp, first 32 bp, first 31 bp, first 30 bp, first 29 bp, first 28 bp, first 27 bp, first 26 bp or first 25 bp of the reverse complement sequence of the J region transcript sequence.

[0068] In some embodiments, the length of the transcript-specific sequence is 20 bp, 21 bp, 22 bp, 23 bp, 24 bp, 25 bp, 26 bp, 27 bp, 28 bp, 29 bp, 30 bp, 31 bp, 32 bp, 33 bp, 34 bp or 35 bp.

[0069] In some embodiments, the transcript-specific sequence is shown in any one of SEQ ID NO: 2 to SEQ ID NO: 854.

[0070] In some embodiments, the capture probe further comprises a sequence required for high-throughput sequencing, for example, a Read2S sequence.

[0071] In some embodiments, the sequence required for high-throughput sequencing is connected to the 5' end of the transcript-specific sequence.

[0072] In some embodiments, the sequence required for high-throughput sequencing is connected to the 3' end of the transcript-specific sequence.

[0073] In some embodiments, the length of the sequence required for high-throughput sequencing may be a conventional length in the art, such as 21 bp.

[0074] In some embodiments, the sequence required for high-throughput sequencing is shown as SEQ ID NO: 1.

[0075] In some embodiments, the sequence required for high-throughput sequencing is connected to the 5' end of the transcript-specific sequence, and the sequence required for high-throughput sequencing is shown as SEQ ID NO: 1, and the transcript-specific sequence is shown as any one of SEQ ID NO: 2 to SEQ ID NO: 854.

[0076] In a second aspect of the present application, a probe composition is provided, which comprises the capture probe as described in the first aspect.

[0077] In some embodiments, the probe composition further comprises a whole transcriptome probe.

[0078] In a third aspect of the present application, a kit is provided, comprising one or more of the capture probes described in the first aspect and the probe composition described in the second aspect.

[0079] In some embodiments, the kit further comprises reagents for reverse transcription and reagents for adding a poly A tail.

[0080] In a fourth aspect of the present application, a method for constructing a sequencing library for detecting T cell and B cell immune repertoires at spatial resolution is provided, the method comprising:

[0081] Probe hybridization: mixing the tissue section and the probe composition according to the second aspect to prepare a tissue 1 after probe hybridization;

[0082] Reverse transcription: mixing the tissue 1 with the whole transcriptome probe to prepare tissue 2 to which the whole transcriptome probe is connected, and reverse transcribing the capture probe in the tissue 2 to prepare tissue 3 containing cDNA;

[0083] Adding a poly A tail: adding a poly A tail to the cDNA to prepare tissue 4 containing the cDNA with the poly A tail;

[0084] Chip hybridization: A chip carrying DNA oligonucleotides encoding spatial position information is mixed with the tissue 4 to capture the whole transcriptome probe and the cDNA with a poly A tail, and pre-amplification and amplification are performed successively to construct a sequencing library.

[0085] In some embodiments, the working concentrations of the capture probe and the human whole transcriptome probe in the probe composition are independently 1 nM to 100 nM.

[0086] In some embodiments, the tissue section is a preserved tissue section.

[0087] In some embodiments, the tissue section is from a sample fixed with formalin and embedded in paraffin.

[0088] As an alternative to the formalin fixation described above, the sample can be fixed in any of a variety of other fixatives to preserve the biological structure of the sample prior to analysis. For example, the sample can be fixed by immersion in ethanol, methanol, acetone, paraformaldehyde (PFA), and combinations thereof.

[0089] As an alternative to the paraffin embedding described above, the sample can be embedded in any of a variety of other embedding materials to provide a structural base for the sample prior to sectioning and other processing steps. Generally, the embedding material is removed prior to analyzing the tissue sections obtained from the sample. Suitable embedding materials include, but are not limited to, waxes, resins (e.g., methacrylate resins), epoxy resins, and agar.

[0090] In some embodiments, the tissue section is from a sample fixed with 4% paraformaldehyde (PFA) and embedded in paraffin.

[0091] In some embodiments, the thickness of the tissue section is 1 μm to 50 μm.

[0092] In some embodiments, the thickness of the tissue section is 5 μm to 35 μm, for example, 5 μm, 10 μm, 15 μm, 20 μm, 25 μm, 30 μm, or 35 μm, or a value or range between any two values.

[0093] It will be appreciated that the capture probes described above target the fourth framework region (FR4) of TCR and BCR.

[0094] In a fifth aspect of the present application, a method for detecting T cell and B cell immune repertoires at spatial resolution is provided, the method comprising:

[0095] Constructing a sequencing library: constructing a sequencing library using the method described in the fourth aspect;

[0096] Sequencing: The sequencing library is sequenced.

[0097] In some embodiments, in the sequencing step, sequencing is performed using next generation sequencing technology.

[0098] In some embodiments, when constructing a sequencing library, Illumina read1 and read2 sequences are used for amplification.

[0099] In some embodiments, sequencing is performed on the Illumina Novaseq 6000 Xplus platform.

[0100] Some examples are provided below.

[0101] The embodiments of the present application will be described in detail below with reference to the examples. It should be understood that these examples are intended to illustrate the present application only and are not intended to limit the scope of the present application. The experimental methods for which the conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and may also be based on the experimental manuals or conventional conditions in this area, or on the conditions recommended by the manufacturer, or with reference to experimental methods known in the art.

[0102] The CDR3 region is the most variable region during TCR and BCR maturation due to somatic hypermutation. The CDR3 region of RNA transcripts is directly sequenced using a J region-specific probe, and cDNA is generated by reverse transcription. Subsequently, a 3' poly A tail is added to the reverse-transcribed cDNA using terminal transferase. The poly A-tailed cDNA containing the CDR3 region is then hybridized with a poly-T probe attached to a spatial barcode array. The sequence of the CDR3 region is then transferred to the spatial barcode probe and used to construct a spatial transcriptome library.

[0103] Reagents and materials are shown in Table 1.

[0104] Table 1

[0105]

[0106] Human FFPE-embedded tumor samples were fixed in 4% paraformaldehyde (PFA) (Servicebio Cat#G1101) for 48 hours and then embedded in paraffin. Tissues were cut into 5-μm-thick sections using a Leica HistoCore BIOCUT paraffin microtome (Leica Cat#14051756235) and mounted on Fisherbrand SuperFrost Plus slides (Fisherscientific Cat#12-550-15). Sections were then deparaffinized, stained with H&E, and imaged.

[0107] Direct capture probes designed to target the fourth framework region (FR4) of TCR and BCR were used during probe capture of mRNA, bridge ligation, probe release, and sequencing library construction. The released probes were then hybridized to 10× Genomics Visium HD oligonucleotide slides.

[0108] The library was constructed by amplification using Illumina read1 and read2 sequences, and the final constructed library was sequenced on the Illumina Novaseq 6000 Xplus platform.

[0109] The resulting FASTQ files were aligned to the mouse reference genome using Space Ranger v3.1.0 and analyzed in conjunction with known human immune repertoire transcript sequences from MIXCR. Finally, aligned histology images, gene barcode matrices, and TCR & BCR library matrices were generated on the same slide for further analysis.

[0110] Example 1 Probe Preparation

[0111] The probe sequence is divided into two parts: the transcript-specific sequence and the Read2S sequence required for Illumina high-throughput sequencing.

[0112] From the MIXCR database ( ) were downloaded from the human genome. The J region transcript sequences of all TCRs (including TRA, TRB, TRD, and TRG genes) and BCRs (including IGH, IGL, and IGK) corresponding to the human genome (a total of 122 sequences) were reverse-complemented. The first 25 bp after reverse complementation (e.g., as shown in SEQ ID NOs: 2-123, respectively) were used as the transcript-specific sequences for the TCR and BCR-targeting probes. The V region transcript sequences of 731 sequences were reverse-complemented, and the first 25 bp after reverse complementation (e.g., as shown in SEQ ID NOs: 124-854, respectively) were used as the transcript-specific sequences for the TCR and BCR-targeting probes. A 21-bp Read2S sequence (CCTTGGCACCCGAGAATTCCA, SEQ ID NO: 1) required for Illumina high-throughput sequencing was added to the 5' end of the transcript-specific region of the TCR and BCR-targeting probe to create the full-length sequence (46 bp) of the TCR and BCR-targeting probe.

[0113] All probe-specific transcripts are simultaneously synthesized into an oligonucleotide library (either by IDT (USA) or other oligonucleotide library synthesis companies, here IDT (USA) is used), with a minimum synthesis amount of 1 pmol.

[0114] Example 2 Probe Application - Exploring the Spatial Distribution of Immune Receptor Repertoire Sequences of Tumor-Infiltrating T&B Lymphocytes and Their Relationship with Tumor Cells after PD1 Treatment in Intestinal Cancer in Clinical Pathology

[0115] 2.1 Experimental Purpose

[0116] TCR & BCR sequences enriched in tumor regions of colorectal cancer patients receiving neoadjuvant therapy (Anti-PD-1) in the clinical pathology library.

[0117] 2.1 Experimental plan

[0118] 2.1.1 Acquisition of human tissue samples

[0119] 1) Patients who meet the ethical requirements for sampling undergo colorectal cancer tumor resection surgery.

[0120] 2) The sample is immersed in PFA for 2-7 days.

[0121] 3) The samples after PFA immersion were embedded in formalin.

[0122] 2.1.2 Spatial transcriptome sequencing combined with immunoreceptor repertoire sequencing

[0123] 1) Preparation of tissue sections:

[0124] Preparation of tissue sections: For FFPE-embedded tissue samples, slices (5 μm) were made using a Leica tissue slicer, and the samples were dewaxed, stained with HE, and imaged using a microscope.

[0125] 2) Probe hybridization

[0126] For H&E-stained samples, perform cross-link removal and probe hybridization within 1-2 days according to the 10x Visium HD spatial gene expression user guide (10x Genomics User Guide CG000685). For probe hybridization, mix the designed and synthesized TCR & BCR-targeted capture probes with the 10x Genomics human whole transcriptome probe kit (Visium Human Transcriptome Probe Kit v2 - Small, PN-1000466). The hybridization system is shown in Table 2 (x represents the number of samples).

[0127] Table 2

[0128]

[0129] 2) Reverse transcription

[0130] For tissues that have been probe-hybridized, perform post-probe cleanup according to the 10x Visium HD spatial gene expression user guide (10x Genomics User Guide CG000685). After cleanup, perform whole-transcriptome probe ligation (Human WT Probes v2) according to the 10x Visium HD spatial gene expression user guide (10x Genomics User Guide CG000685). For tissues that have been probe-ligated, reverse transcription of TCR and BCR probes is performed. The system is shown in Table 3.

[0131] Table 3

[0132]

[0133] The reaction conditions are shown in Table 4.

[0134] Table 4

[0135]

[0136] 3) Adding poly A tail

[0137] For tissues reverse-transcribed with TCR & BCR probes, follow the same post-ligation cleanup steps as described in the 10x Visium HD spatial gene expression user guide (10x Genomics User Guide CG000685). After cleanup, poly A tail the reverse-transcribed cDNA. The system is shown in Table 5.

[0138] Table 5

[0139]

[0140] The reaction conditions are shown in Table 6.

[0141] Table 6

[0142]

[0143] 4) Spatially encoded chips capture the full transcriptome probe while also capturing the cDNA products of TCR & BCR probe reverse transcription

[0144] For tissues where TCR & BCR probes have been reverse-transcribed and poly A-tailed, clean the probes following the same post-ligation cleanup steps as described in the 10x Visium HD spatial gene expression user guide (10x Genomics User Guide CG000685). After cleanup, microarray hybridization is performed according to the 10x Visium HD spatial gene expression user guide (10x Genomics User Guide CG000685) to transfer the DNA oligonucleotides encoding the spatial positional information on the microarray to the probe library. Probe library pre-amplification and post-amplification Illumina sequencing library construction are then performed according to the same protocol. At this point, the TCR & BCR probe cDNAs are constructed and sequenced alongside the rest of the normal whole transcriptome probe library, requiring no additional steps. Sequencing was performed on an Illumina Novaseq 6000 X plus instrument, using paired-end 150bp reads and an Illumina Trueseq library structure.

[0145] 2.1.3 Results Analysis

[0146] Paired-end Fastq files from Illumina sequencing (containing whole transcriptome reads, TCR reads, and BCR reads) were aligned to the human reference genome and whole transcriptome probe designs using 10x Genomics' Space Ranger (v3.1.0) software. Space Ranger decodes the spatial coordinates of probe sequences using the chip encoding sequences corresponding to known spatial coordinates, thereby accurately determining gene expression across the entire transcriptome. For TCR and BCR sequences contained in the same sequencing file, all reads that are likely to be cDNAs corresponding to the target TCR and BCR were first extracted using the probe design library sequence. A similar Space Ranger alignment was then performed, and their spatial coordinates were output in the aligned Bam file. TCR and BCR clonotypes corresponding to different reads were then aligned using the RNA-seq pre-configured module of MIXCR software. Following the principle of identical read names, the spatial coordinate information for each read was combined with the spatial coordinate information for the same read name to form a TCR and BCR clonotype expression matrix.

[0147] Figure 1 This figure shows the process of capturing TCR and BCR transcripts using specific probes. In the first step, a gene-specific probe (containing Illumina Read 2 and nucleic acid sequence 1) binds to the transcript, generating a nucleic acid sequence 2 product through reverse transcription as described above. This product is then terminally tailed to produce a poly A product. In the second step, in situ hybridization of the probe-generated product at the spatially defined nucleotide coordinates is performed to generate a spatially encoded product library. In the third step, the library is then coupled to Illumina high-throughput sequencing adapters via PCR.

[0148] Figure 2 Displays the alignment results for an example BCR transcript captured using specific probes, including the V, CDR3, and J region sequences of the BCR transcript. Target0 represents the sequence obtained by sequencing. LQTE represents the amino acid sequence of the BCR. Quality represents the alignment quality, where 88888 indicates a perfect score.

[0149] Figure 3 This visualization shows the spatial location of BCR sequences captured using specific probes. Using the analysis method described in the previous example, the BCR sequencing product library is aligned back to the spatial coordinates of colorectal tumors, revealing the spatial locations corresponding to different BCR sequences.

[0150] Figure 4This visualization shows the spatial location of TCR sequences captured using specific probes. Using the analysis method described in the previous example, the TCR sequencing product library is aligned back to the spatial coordinates of a colorectal tumor, revealing the spatial locations corresponding to different TCR sequences.

[0151] Figure 5 Displays the alignment results for an example BCR transcript captured using a specific probe, including the V region and CDR1 region sequences of the BCR transcript. Target0 represents the sequence obtained by sequencing. LQTE represents the amino acid sequence of the BCR. Quality represents the alignment quality, where 88888 indicates a perfect score.

[0152] Figure 6 Displays the alignment results for an example BCR transcript captured using a specific probe, including the V region and CDR2 region sequences of the BCR transcript. Target0 represents the sequence obtained by sequencing. LQTE represents the amino acid sequence of the BCR. Quality represents the alignment quality, where 88888 indicates a perfect score.

[0153] Figure 7 This visualization shows the spatial location of BCR CDR1 sequences captured using specific probes. Using the analysis method described in the previous example, the BCR sequencing product library is aligned back to the spatial coordinates of human colorectal tumors, revealing the spatial locations corresponding to different BCR sequences.

[0154] Figure 8 This visualization shows the spatial location of BCR CDR2 sequences captured using specific probes. Using the analysis method described in the previous example, the BCR sequencing product library is aligned back to the spatial coordinates of human colorectal tumors, revealing the spatial locations corresponding to different BCR sequences.

[0155] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0156] The above-described embodiments merely represent several implementation methods of the present application. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art could make various modifications and improvements without departing from the spirit of the present application, all of which fall within the scope of protection of the present application. Therefore, the scope of protection of the patent in this application shall be determined by the appended claims, and the specification and drawings shall serve to interpret the claims.

Claims

1. A capture probe for detecting T cell and B cell immune repertoires at spatial resolution, characterized in that: The capture probe contains a transcript-specific sequence and a Read2 sequence required for Illumina high-throughput sequencing; The transcript-specific sequence is shown in SEQ ID NO: 2 to SEQ ID NO: 854, and the Read2 sequence required for the Illumina high-throughput sequencing is connected to the 5' end of the transcript-specific sequence.

2. The capture probe according to claim 1, wherein The length of the Read2 sequence required for the Illumina high-throughput sequencing is 21 bp.

3. The capture probe according to claim 2, wherein The Read2 sequence required for the Illumina high-throughput sequencing is shown in SEQ ID NO:

1.

4. A probe composition, characterized in that It comprises the capture probe according to any one of claims 1 to 3.

5. The probe composition according to claim 4, wherein The probe composition also includes a 10×Genomics human whole transcriptome probe.

6. A kit, characterized in that It comprises the capture probe according to any one of claims 1 to 3 or the probe composition according to claim 4 or 5.

7. The kit according to claim 6, wherein The kit also contains reagents for reverse transcription and reagents for adding poly A tails.

8. A method for constructing a sequencing library for detecting T cell and B cell immune repertoires at spatial resolution, characterized in that The method comprises: Probe hybridization: mixing a tissue section and the probe composition according to claim 4 or 5 to prepare a tissue 1 after probe hybridization; Reverse transcription: mixing the tissue 1 with the 10× Genomics human whole transcriptome probe to prepare tissue 2 ligated with the 10× Genomics human whole transcriptome probe, and reverse transcribing the capture probe in the tissue 2 to prepare tissue 3 containing cDNA; Adding a poly A tail: adding a poly A tail to the cDNA to prepare tissue 4 containing the cDNA with the poly A tail; Chip hybridization: A chip carrying DNA oligonucleotides encoding spatial location information was mixed with the tissue 4 to capture the 10× Genomics human whole transcriptome probe and the cDNA with a poly A tail, and pre-amplification and amplification were performed successively to construct a sequencing library.

9. The method according to claim 8, wherein The working concentrations of the capture probe and the 10×Genomics human whole transcriptome probe in the probe composition are independently 1 nM to 100 nM; and / or, The tissue sections are preserved tissue sections.

10. The method according to claim 9, wherein The thickness of the tissue section is 1 μm to 50 μm.

11. A method for detecting T cell and B cell immune repertoires at spatial resolution, characterized in that: The method comprises: Constructing a sequencing library: constructing a sequencing library using the method according to any one of claims 8 to 10; Sequencing: The sequencing library is sequenced.

12. The method according to claim 11, wherein In the step sequencing, next generation sequencing technology is used for sequencing.

Images