Tulasnella sp. QYM-1, culture method of dendrobium huoshanense and application of dendrobium huoshanense

Abstract

The invention relates to a Tulasnella sp. QYM-1, a culture method of dendrobium huoshanense and application of the Tulasnella sp. QYM-1, and belongs to the technical field of microorganisms. The invention provides the mucilaginoidea fungus QYM-1, and the mucilaginoidea fungus QYM-1 is separated from protocorm formed by symbiotic germination, can promote germination of dendrobium huoshanense seeds to form seedlings, has relatively strong specificity on culture of the dendrobium huoshanense seeds, can replace tissue culture to become a main technology for seedling culture of dendrobium huoshanense, and has a broad application prospect in the field of seedling culture of dendrobium huoshanense. And the method has extremely high application value in production. In addition, the mucilaginoidea fungus QYM-1 is low in production cost and suitable for large-area popularization and application, and has huge research potential in the aspects of regression of rare and endangered orchid plants, wild-imitating cultivation of medicinal orchid plants and the like.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbiology, and particularly relates to a fungus of the genus Tulasnella (Tulasnella sp.) QYM-1, a cultivation method and application of Dendrobium huoshanense. Background Art

[0002] Orchidaceae plants are one of the taxa with relatively rich species numbers among angiosperms. There are more than 800 genera and nearly 30,000 species in the whole family, which are widely distributed in various terrestrial ecosystems. The genus Dendrobium is the second largest genus in Orchidaceae, and more than half of the species have high medicinal and ornamental values and are highly favored by people. The survival and reproduction of Orchidaceae plants depend on symbiotic fungi and pollinating insects. Due to environmental damage and over-excavation by humans, the number of wild populations has greatly decreased. Currently, all wild Orchidaceae plants are included in the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES).

[0003] Dendrobium huoshanense C.Z.Tang et S.J.Cheng is an epiphytic orchidaceous plant, also known as "Mihu", named after its "shape like accumulated rice", and it is an endemic species in China. It often grows on the stones beside the water in valleys or on cliffs at an altitude of 300-900m, and is mainly distributed in Huoshan County, Anhui Province in the Dabie Mountain area. Dendrobium huoshanense is a traditional Chinese medicinal material in China. It is recorded in the Chinese Pharmacopoeia in 2020 that Dendrobium huoshanense uses fresh or dried stems as medicine, with the effects of benefiting the stomach and promoting fluid production, and nourishing yin and clearing heat. Modern pharmacology shows that Dendrobium huoshanense contains polysaccharides, alkaloids, flavonoids and various trace elements, and has multiple functional activities such as protecting the liver, antioxidant, regulating blood lipid, lowering blood sugar, anti-inflammatory and enhancing the intestinal physiological barrier, and has broad application value in the prevention and treatment of liver diseases. However, due to the over-excavation of its wild natural resources at present, the population number has decreased sharply and it is in an endangered state. It is urgent to protect the wild Dendrobium huoshanense resources. At present, Dendrobium huoshanense has been included in the List of Rare and Endangered Protected Plants in China and is a first-class rare and endangered protected plant endemic to China.

[0004] At present, the main way of artificial cultivation and seedling production of Dendrobium huoshanense is through the aseptic germination of seeds. From sowing the seeds to taking out the seedlings from the bottle, it takes about 9-12 months. Each step of subculture transfer in the middle requires manual transfer, which is time-consuming and laborious. A large amount of labor undoubtedly increases the production cost. Although a large number of tissue culture seedlings can also be obtained through tissue culture, Dendrobium huoshanense depends on mycorrhizal fungi to provide nutrients, and it is difficult for the artificially obtained tissue culture seedlings to re-establish a symbiotic relationship with fungi when they return to the wild. Therefore, obtaining an artificial cultivation method that enables Dendrobium huoshanense to quickly establish a symbiotic relationship with fungi is particularly important for the seedling production of Dendrobium huoshanense. Summary of the Invention

[0005] The object of the present invention is to provide a fungus of the genus Tulasnella (Tulasnella sp.) QYM-1, a cultivation method and application of Dendrobium huoshanense. The fungus of the genus Tulasnella QYM-1 of the present invention can form a symbiotic relationship with the seeds of Dendrobium huoshanense, promote the germination of Dendrobium huoshanense seeds, the formation of protocorms and the seedling development of Dendrobium huoshanense.

[0006] The present invention provides a strain of fungus of the genus Tulasnella (Tulasnella sp.) QYM-1, and the fungus of the genus Tulasnella QYM-1 is preserved in the China Center for Type Culture Collection, and the preservation number is CCTCC NO: M20242001.

[0007] The present invention also provides a cultivation method of the fungus of the genus Tulasnella QYM-1 described in the above technical solution, including the following steps: inoculating the fungus of the genus Tulasnella QYM-1 into a culture medium for cultivation to obtain the culture of the fungus of the genus Tulasnella QYM-1.

[0008] Preferably, the culture medium includes oat agar medium and / or PDA medium; the cultivation temperature is 23-27°C; the cultivation time is 7-10 days.

[0009] The present invention also provides an application of the fungus of the genus Tulasnella QYM-1 described in the above technical solution in symbiotic cultivation with Dendrobium huoshanense.

[0010] The present invention also provides an application of the fungus of the genus Tulasnella QYM-1 described in the above technical solution in promoting the germination of Dendrobium huoshanense seeds.

[0011] The present invention also provides an application of the fungus of the genus Tulasnella QYM-1 described in the above technical solution in promoting the formation of protocorms of Dendrobium huoshanense.

[0012] The present invention also provides an application of the fungus of the genus Tulasnella QYM-1 described in the above technical solution in promoting the seedling development of Dendrobium huoshanense.

[0013] The present invention also provides a method for symbiotic cultivation of a fungus of the genus Tulasnella QYM-1 and Dendrobium huoshanense, including the following steps: inoculating the seeds of Dendrobium huoshanense into a symbiotic germination medium containing the fungus of the genus Tulasnella QYM-1 for symbiotic germination cultivation.

[0014] Preferably, the symbiotic germination medium includes oat agar medium.

[0015] Preferably, the temperature of the symbiotic germination cultivation is 23-27°C; the light intensity of the symbiotic germination cultivation includes 5000 Lx; the photoperiod of the symbiotic germination cultivation includes L / D = 12 h / 12 h.

[0016] Compared with the prior art, the Tulasnella sp. QYM-1 strain of the present invention has the following prominent advantages:

[0017] 1. The Tulasnella sp. QYM-1 of the present invention can promote the germination of Dendrobium huoshanense seeds to form seedlings, has strong specificity, and can obtain high-quality symbiotic seedlings by symbiotically culturing the QYM-1 strain with Dendrobium huoshanense seeds, promoting the development of the Dendrobium huoshanense seedling industry.

[0018] 2. The Tulasnella sp. QYM-1 of the present invention can be used for the reintroduction of Dendrobium huoshanense into the wild, break through the direct seeding technology of Dendrobium huoshanense, replace tissue culture as the main technology for Dendrobium huoshanense seedling raising, and has extremely high application value in production.

[0019] 3. The present invention has low production cost and is suitable for large-scale popularization and application. It has great popularization value in aspects such as the reintroduction of rare and endangered Orchidaceae plants, the imitation of wild cultivation of medicinal Orchidaceae plants, and solving the bottleneck problems in the artificial cultivation industry of Dendrobium huoshanense.

[0020] Biological deposit information

[0021] Tulasnella sp.QYM-1 is deposited in the China Center for Type Culture Collection, abbreviated as CCTCC. The deposit date is September 18, 2024. The deposit address is: Wuhan University, Wuhan, China. The deposit number is: CCTCC NO: M 20242001. Brief description of the drawings

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0023] Figure 1 It is a result diagram of the promotion of Dendrobium huoshanense seed germination by Tulasnella sp. QYM-1 at 90d provided by the present invention;

[0024] Figure 2 It is a result diagram of the promotion of Dendrobium huoshanense seed germination by different fungal treatment plates at 90d provided by the present invention; among them, a is the OMA treatment; b is the QYM-1 fungal treatment; c is the Agp-1 fungal treatment; d is the JM fungal treatment; e is the SO fungal treatment. Detailed implementation manners

[0025] The present invention provides a strain of Tulasnella sp. fungus QYM-1, which is deposited in the China Center for Type Culture Collection with the deposit number of CCTCC NO: M20242001. The Tulasnella sp. fungus QYM-1 of the present invention is isolated from the protocorms formed by symbiotic germination; the Tulasnella sp. fungus QYM-1 of the present invention can promote the germination of Dendrobium huoshanense seeds to form seedlings. The Tulasnella sp. fungus QYM-1 of the present invention has a white, short villous and neatly growing colony on a PDA plate after being cultured for 7 days. Under the condition of dark inverted culture at 25±2°C for 10 days, the cover glass insertion culture method can be used to observe the microscopic morphological characteristics of the Tulasnella sp. fungus QYM-1 strain of the present invention. Take the inserted slice and prepare the slice according to the conventional preparation method. Under an optical microscope, it can be observed that the hyphae of the Tulasnella sp. fungus QYM-1 of the present invention have septa, with a diameter of 3.01-5.57 μm, the branches are nearly right-angled, the new hyphae are born at the top of the old hyphae, have more obvious septa and a larger number of septa, and the cell wall of the old hyphae has a thickening phenomenon. The nrDNA ITS characteristic sequence of the Tulasnella sp. fungus QYM-1 of the present invention is shown in SEQ ID NO.1:

[0026] GCGGAAGGATCATAGTAATCGTCTTTGACGTTCTATTCCGTCGTCCTCGGGACGTTAAGGCGCTCTGGTCGAGGATAAACGACCCCTCTGACCGAGGTTAAATGGTCGCTGCTGTGTTACCTCTTTCCCGAGGCACACGTTAAAGATCGTTCCGCGTTGTGAGTCTAACACCAGTTGTAACTTTTTACAACCGGCAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATTCCTTCGGGAGTCTTTCCTTGCGAAAGACCCGAGTTCGGAGTCCTCGGTCTTTGGATCGTGTTCTCTCAGATGCGTCGCGCCGATCGCCTGATGGGTACTCTAATGCCTGAGCGTGGAGTCCTTTCTGGGTTTGAGACGTGCTTGACCGGCCGTTGGGCTCGCGTCACCAAGTCCGCGTTCTTTGCGACGTCGGTACTACAACGCATGACCTCATCGGGGTAGGACAACCCGCTAGACTTAAGCATAT. The amplified product was sent to the Kunming Branch of Beijing Tsingke Biotechnology Co., Ltd. for sequencing. The sequenced sequence was aligned and analyzed in the National Center for Biotechnology Information database in the United States, and its taxonomic status was confirmed by combining morphological characteristics, and it was identified as a fungus of the genus Tulasnella.

[0027] The present invention also provides a cultivation method of the Tulasnella fungus QYM-1 described in the above technical solution, comprising the following steps: inoculating the Tulasnella fungus QYM-1 into a culture medium for cultivation to obtain a culture of the Tulasnella fungus QYM-1.

[0028] In a specific embodiment, the culture medium may include an oatmeal agar medium and / or a PDA medium; the culture temperature may be 23-27 °C; the culture time may be 7-10 d. In a specific embodiment, the culture of the Tulasnella fungus QYM-1 can be stored in a 4 °C refrigerator.

[0029] The present invention also provides the application of the Tulasnella fungus QYM-1 described in the above technical solution in symbiotic culture with Dendrobium huoshanense.

[0030] The present invention also provides the use of the Tulasnella sp. QYM-1 described in the above technical solution in promoting the germination of Dendrobium huoshanense seeds.

[0031] The present invention also provides the use of the Tulasnella sp. QYM-1 described in the above technical solution in promoting the formation of protocorms of Dendrobium huoshanense.

[0032] The present invention also provides the use of the Tulasnella sp. QYM-1 described in the above technical solution in promoting the seedling development of Dendrobium huoshanense.

[0033] The present invention also provides a method for symbiotic culture of Tulasnella sp. QYM-1 and Dendrobium huoshanense, comprising the following steps: inoculating Dendrobium huoshanense seeds into a symbiotic germination medium containing Tulasnella sp. QYM-1 for symbiotic germination culture.

[0034] In a specific embodiment, the Dendrobium huoshanense seeds can be disinfected. In a specific embodiment, the disinfection treatment can use 1% NaClO solution to fully contact with the seeds. In a specific embodiment, after the disinfection treatment, the Dendrobium huoshanense seeds can be rinsed with sterile water 3 to 5 times to obtain sterile Dendrobium huoshanense seeds. In a specific embodiment, the Dendrobium huoshanense seeds can also be a suspension of Dendrobium huoshanense seeds. In a specific embodiment, the suspension of Dendrobium huoshanense seeds can be prepared by mixing sterile seeds with 1 g·L -1 sterile agar solution.

[0035] In a specific embodiment, the symbiotic germination medium containing Tulasnella sp. QYM-1 can be obtained by inoculating a fungal block of the culture of Tulasnella sp. QYM-1 in the middle of the medium. In a specific embodiment, the symbiotic germination medium includes an oat agar medium. In a specific embodiment, the oat agar medium can include 4 g·L -1 oatmeal and 15 g·L -1 agar. In a specific embodiment, the pH of the oat agar medium can be 5.6 to 5.8.

[0036] After obtaining the Dendrobium huoshanense seeds and the symbiotic germination medium containing Tulasnella sp. QYM-1, the present invention inoculates the Dendrobium huoshanense seeds into the symbiotic germination medium containing Tulasnella sp. QYM-1 for symbiotic germination culture. In a specific embodiment, the temperature of the symbiotic germination culture is 23 to 27 °C; the light intensity of the symbiotic germination culture includes 5000 Lx; the photoperiod of the symbiotic germination culture includes L / D = 12 h / 12 h.

[0037] To further illustrate the present invention, the following describes in detail the Tulasnella sp. QYM-1, the cultivation method and application of Dendrobium huoshanense in combination with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0038] Example 1

[0039] Obtaining the Tulasnella sp. QYM-1 strain

[0040] 1. Ex situ symbiotic germination of seeds

[0041] (1) In May 2023, the substrate was collected from the Dendrobium huoshanense semi-wild cultivation base in Huoshan County, Anhui Province, and taken back to the laboratory and sub-packed into 20 plastic square boxes (20.5 cm × 12.5 cm × 6.0 cm), covered with a layer of nylon cloth with a mesh size of 45 μm, and sprayed with an appropriate amount of sterile water to make the nylon cloth fully contact with the native substrate.

[0042] (2) The stored Dendrobium huoshanense seeds were taken out from the -20°C refrigerator, poured into a disposable syringe, the contact surface between the syringe and the needle tube was blocked with a non-woven fabric with a diameter of 2 cm, soaked in 1% NaClO solution for 3 min for disinfection, and then rinsed 3 - 5 times with sterile distilled water. After that, the seeds and sterile distilled water were injected into a 0.1% agar suspension to make a seed suspension.

[0043] (3) The seed suspension was evenly transferred onto the nylon gauze with a 1000 μl pipette, sprayed with sterile water to keep the substrate in a moist state, placed in a constant temperature incubator, the cultivation temperature was 25 ± 2°C, the photoperiod was L / D = 12 h / 12 h, the seed germination was observed every two weeks, and the humidity of the substrate in the plastic box was maintained.

[0044] (4) After 50 d, protocorms were successively found in the box, and the symbiotic protocorms were picked out for fungal isolation.

[0045] 2. Isolation of the Tulasnella sp. QYM-1 strain

[0046] (1) Source of protocorms: Protocorms obtained from the ex situ symbiotic germination of Dendrobium huoshanense seeds.

[0047] (2) Isolation and purification of endophytic fungi in protocorms: Symbiotic protocorms gradually appeared after 50 days of ex situ symbiotic germination of Dendrobium huoshanense seeds. The protocorms were taken out and the substrate on the surface of the seedlings was rinsed 2 - 3 times with clean water. On the ultra-clean workbench, they were placed in a sterile petri dish containing 1% NaClO solution for disinfection. The petri dish was gently shaken, and after 3 minutes, they were rinsed 3 - 5 times with sterile water. The disinfected seedlings were cut into fragments about 0.5 mm in size with a sterile scalpel, and then they were transferred into a new PDA medium with forceps and cultured in the dark in an incubator at 25°C. After new mycelia grew from the edges of the plant tissue fragments, the mycelia were cut with a sterile scalpel and transferred to a new PDA medium for purification 3 - 5 times.

[0048] (3) Preservation of strain QYM-1: The purified fungi were preserved by the conventional test tube slant method. An appropriate amount of prepared PDA medium was poured into a glass test tube with a specification of 18×20 mm, and the amount of the poured medium was about 1 / 3 of the test tube volume. After plugging with a silica gel plug, it was placed in an autoclave for sterilization (121°C, 20 min). After sterilization, the test tube was placed in the ultra-clean workbench and arranged into a slant for standby. On the ultra-clean workbench, the purified strain was picked with a sterile inoculation needle to inoculate the edge mycelia on the PDA slant, and the strain name, number, and date were noted. The inoculated test tube was placed in an artificial climate chamber for cultivation at 25±2°C. When the mycelia were about to cover the PDA slant, the test tube was taken out and stored in a 4°C refrigerator in the laboratory.

[0049] The isolated strain QYM-1 was preserved in the fungal library of the Plant Germplasm Resources Conservation Group of Yunnan University in December 2023, and was deposited in the China Center for Type Culture Collection for biological preservation in September 2024. The deposit address is: Wuhan University, Wuhan, China. The deposit number is: CCTCC NO: M 20242001.

[0050] For the total fungal DNA extraction involved in the above-mentioned molecular biological identification, the CTAB method was used; the primers used for PCR amplification were the fungal universal primers ITS1 and ITS4; the PCR reaction system and conditions were referred to the corresponding product instructions; the amplified product was sent to the Kunming Branch of Beijing Tsingke Biotechnology Co., Ltd. for sequencing.

[0051] Specifically, the CTAB method was used to extract fungal DNA, and the primers used for PCR amplification were ITS1 and ITS4; the PCR reaction system (25 μl) included: 2.5 μl 10×PCR buffer, 0.4 μl dNTP, 1.5 μl Mg 2+, 1.5 μl of ITS1, 1.5 μl of ITS4, 0.2 μl of Taq enzyme, 15.4 μl of ddH2O, and 2 μl of DNA template; the amplification reaction was carried out on a PCR instrument (Perkin Elmer) with the following PCR cycle: pre-denaturation at 94 °C for 3 min, 1 cycle; denaturation at 94 °C for 1 min, annealing at 51 °C for 1 min, extension at 72 °C for 1 min, 30 cycles; finally, extension at 72 °C for 10 min; the PCR amplification product was sequenced by Beijing Tsingke Biotechnology Co., Ltd., Kunming Branch; the nrDNA ITS sequence of the Tulasnella sp. QYM-1 strain obtained by sequencing was submitted to the National Center for Biotechnology Information database (NCBI, http: / / www.ncbi.nlm.nih.gov / ) for preservation, and its Genbank number was: PQ008977; and BLAST alignment was performed. The identification results showed that this strain was most similar to the fungus Tulasnellaceae of MZ129307.1, with the maximum similarity reaching 99%. According to the results of morphological analysis, molecular biology methods, and phylogenetic analysis, strain QYM-1 belongs to the genus Tulasnella fungi.

[0052] Example 2

[0053] Experiment on promoting the seed germination of Dendrobium huoshanense by the Tulasnella sp. QYM-1 strain

[0054] The isolated strain and seeds were subjected to a symbiotic germination test in a symbiotic culture medium to examine the effectiveness of the obtained fungus in promoting the seed germination of Dendrobium huoshanense, and the effect of the strain QYM-1 isolated in the present invention in promoting the seed germination of Dendrobium huoshanense was compared with the effects of different fungi in promoting the seed germination of Dendrobium huoshanense, where the different fungi were:

[0055] Tulasnella sp. Agp-1 isolated from Arundinagraminifolia, NCBI accession number MK651837;

[0056] Tulasnella sp. JM isolated from Dendrobium officinale, NCBI accession number MN607232;

[0057] Serendipita officinale SO isolated from Dendrobium officinale, NCBI accession number MN173026; the isolation methods of Agp-1, JM, and SO were the same as that of QYM-1.

[0058] The specific experimental steps are as follows:

[0059] 1. Preparation of symbiotic culture medium: The symbiotic germination medium is oat agar medium (OMA), including 4 g·L -1 oatmeal and 15 g·L -1 agar, and the pH of the medium is 5.6 - 5.8. Prepare 3 L of the medium and 100 petri dishes. There are a total of 5 treatment groups, with 20 replicates for each treatment.

[0060] 2. Seed disinfection: Take out the preserved Dendrobium huoshanense seeds from the -20°C refrigerator and place them at room temperature for about 10 h. Weigh 0.0039 g of seeds and fold them in weighing paper. Pour the seeds into a disposable syringe on the ultra-clean workbench. Block the connection between the needle and the syringe barrel with sterilized non-woven fabric. Inhale 1% NaClO solution to fully contact the seeds, and shake the syringe barrel. After five minutes, drain the liquid, and inhale sterile water to rinse 3 - 5 times to obtain sterile seeds.

[0061] 3. Inoculation and sowing: Inoculate blocks (0.5 cm 3 ) of single fungal pure cultures of QYM-1, Agp-1, JM, and SO in the middle of OMA respectively, and inoculate PDA of the same size in the middle of the medium for the blank control. Mix the sterile seeds with 1 g·L -1 sterile agar solution to make a seed suspension. Then use a pipette gun to evenly transfer the seed suspension into the petri dishes containing oat agar medium, wrap the petri dishes with a sealing film in one circle, and then wrap another circle with plastic wrap.

[0062] 4. Symbiotic germination culture: Place the sown petri dishes in an artificial climate chamber and incubate them at a constant temperature of 25 ± 2°C, with a photoperiod of 12 / 12 h L / D and a light intensity of 5000 Lx.

[0063] 5. Count the seed germination situation at 30 d, 60 d, and 90 d after symbiotic culture. At each stage, randomly select the germinated protocorms or seedlings for different treatments for stereomicroscopic observation. At the same time, stain and observe the germinated protocorms and seedlings to confirm the situation of fungal infection of the seeds. A total of the following 4 stages are counted,

[0064] 1) Seeds that have not germinated;

[0065] 2) Seeds absorb water and swell, producing root-like structures (germination stage G);

[0066] 3) Seeds continue to swell, break through the seed coat, and show the primary meristem (protocorm development stage P);

[0067] 4) The first leaf grows out, and further grows, with roots growing out (seedling development and growth stage S).

[0068] According to the above definition, the seed germination rate G, protocorm formation rate P, and seedling development rate S were calculated. t represents the total number of seeds, g represents the number of germinated seeds, p represents the number of seeds forming protocorms, and s represents the number of seeds forming seedlings. The calculation formulas are as follows:

[0069] G = (g + p + s) / t, Equation I;

[0070] P = (p + s) / t, Equation II;

[0071] S = s / t, Equation III.

[0072] All data were summarized as mean ± standard error (SE).

[0073] After 90 days of symbiotic culture, the experiment was terminated, and the results of the germination of Dendrobium huoshanense seeds promoted by the fungus Tulasnella sp. QYM-1 of the present invention are shown in Figure 1 as follows, and the results of the germination of Dendrobium huoshanense seeds promoted by different fungal treatment plates are shown in Figure 2 as follows. The general linear model (GLMs) was used to compare the effects of different fungal inoculation treatments on stem diameter growth, and the least significant difference (LSD) was used to compare the means of each treatment, with P < 0.05. Dendrobium huoshanense seeds germinated in all treatments, but showed different germination efficiencies (Table 1).

[0074] Table 1 Effects of different fungal treatments on the germination of Dendrobium huoshanense seeds (statistics at 90 days)

[0075]

[0076] According to Table 1 and Figure 2 the results shown above, although the non-inoculated treatment could make Dendrobium huoshanense seeds germinate, it only caused the seeds to absorb water and swell and turn green, not enough to reach the protocorm stage. The Agp-1 strain isolated from the protocorms of Arundina graminifolia could promote the germination of Dendrobium huoshanense seeds to the protocorm stage, but could not promote seedling formation. The JM strain isolated from the protocorms of Dendrobium officinale also did not show any seedlings after co-culturing with Dendrobium huoshanense seeds for 90 days, indicating that it had no obvious promoting effect. A Sebacinales sp. SO isolated from the protocorms of Dendrobium officinale could promote the germination of Dendrobium huoshanense seeds to the seedling stage, and the seedling formation rate reached 14.03 ± 1.8% after 90 days of germination. The QYM-1 strain isolated from the protocorms of Dendrobium huoshanense could significantly promote the formation of protocorms (69.00 ± 3.1%) and seedling development (53.53 ± 2.2%) of Dendrobium huoshanense. Although the SO strain could also promote the germination of Dendrobium huoshanense seeds to the seedling stage, the germination rate, protocorm formation rate, and seedling development rate of the QYM-1 strain were significantly higher than those of the SO treatment, indicating that QYM-1 is an effective fungus for promoting the germination of Dendrobium huoshanense seeds and seedling growth.

[0077] Different fungal treatments have different effects on the germination of Dendrobium huoshanense seeds. All treatments can make the seeds germinate at the initial stage of symbiotic culture, but this only represents that the seeds absorb water and swell, the embryo breaks through the seed coat and grows, and meristem tissue begins to form, which cannot be used as a standard for practical application. A more important index is the seedling development rate. In the later stage of symbiotic culture, that is, the stage of forming seedlings, although the SO strain isolated from Dendrobium officinale can promote the formation of seedlings from Dendrobium huoshanense seeds to a certain extent, the QYM-1 strain obtained from the protocorms germinated ex situ symbiotically from Dendrobium huoshanense seeds has the best effect on promoting the germination of Dendrobium huoshanense seeds. The symbiotic seedlings can be obtained by symbiotically germinating the seeds of Dendrobium huoshanense with the QYM-1 strain of the genus Tulasnella fungi.

[0078] Through symbiotic germination experiments, the sterile seeds of Dendrobium huoshanense, different fungi and blank controls were cultured on oat medium respectively. By comparing the seed germination rate, protocorm formation rate and seedling development rate, the effective strains that can promote the development of Dendrobium huoshanense seeds into seedlings were successfully screened, thus opening up a new way for the efficient seedling raising, protection practice and population reconstruction of Dendrobium huoshanense.

[0079] The above are only some specific embodiments of the present invention (since the technical solution of the present invention involves a numerical range, the embodiments cannot be exhausted, and the protection scope recorded in the present invention is subject to the numerical range and other technical key points of the present invention). The specific content or common knowledge known in the solution is not described in detail here. It should be noted that the above embodiments do not limit the present invention in any way. For those skilled in the art, all technical solutions obtained by using equivalent substitution or equivalent transformation fall within the protection scope of the present invention. The protection scope required by the present invention should be based on the content of its claims, and the specific implementation manners and the like in the specification can be used to interpret the content of the claims.

Claims

1. A fungus of the genus Tulasnella (Tulasnella sp.) QYM-1, characterized in that, The fungus Tulasnella sp. QYM-1 is preserved in the China Center for Type Culture Collection (CCTCC) under the accession number CCTCC NO: M20242001.

2. The cultivation method of the fungus Tulasnella sp. QYM-1 according to claim 1, characterized in that, It includes the following steps: Inoculate the fungus Tulasnella sp. QYM-1 into a medium for cultivation to obtain the culture of the fungus Tulasnella sp. QYM-1.

3. The cultivation method according to claim 2, characterized in that, The medium includes oatmeal agar medium and / or PDA medium; the cultivation temperature is 23-27°C; the cultivation time is 7-10 days.

4. Use of the fungus Tulasnella sp. QYM-1 according to claim 1 in symbiotic cultivation with Dendrobium huoshanense.

5. Use of the fungus Tulasnella sp. QYM-1 according to claim 1 in promoting the germination of Dendrobium huoshanense seeds.

6. Use of the fungus Tulasnella sp. QYM-1 according to claim 1 in promoting the formation of protocorms of Dendrobium huoshanense.

7. Use of the fungus Tulasnella sp. QYM-1 according to claim 1 in promoting the development of seedlings of Dendrobium huoshanense.

8. A method for symbiotic cultivation of the fungus Tulasnella sp. QYM-1 and Dendrobium huoshanense, comprising the following steps: Inoculate the seeds of Dendrobium huoshanense into a symbiotic germination medium containing the fungus Tulasnella sp. QYM-1 for symbiotic germination cultivation.

9. The co-culture method according to claim 8, wherein The symbiotic germination medium includes oatmeal agar medium.

10. The co-culture method according to claim 8, wherein The temperature for symbiotic germination cultivation is 23-27°C; The light intensity for symbiotic germination cultivation is 5000 Lx; The photoperiod for symbiotic germination cultivation is L / D = 12 h / 12 h.

Images