Establishment and application of rapid detection method for cattle and sheep intestinal small RNA viruses

Abstract

The invention provides establishment and application of a rapid detection method for cattle and sheep intestinal small RNA viruses, and belongs to the technical field of biological products. The primer composition for detecting the cattle and sheep intestinal small RNA viruses only comprises an inner primer pair and an outer primer pair, the visual LAMP detection kit for the cattle and sheep intestinal small RNA viruses is formed, an LAMP detection method is established, and the process from nucleic acid extraction to result analysis and judgment can be completed within 2 h; the components of the reaction premixed solution are optimized, the color developing solution is added, closed LAMP detection can be carried out after sample adding, the detection result can be visually interpreted by naked eyes, and pollution caused by cover opening in LAMP detection is avoided; the LAMP detection operation is simple, the detection result specificity is high, the lowest detection limit can reach 4.63 * 10 <-8 > ng / mu L, and the sensitivity is high. Visual LAMP detection established in the invention provides powerful technical support for detection of cattle and sheep intestinal small RNA viruses.

Description

Technical Field

[0001] The present invention relates to the technical field of biological products, and particularly relates to a rapid detection method for detecting bovine and ovine enteric picornavirus, especially a visual LAMP detection method for bovine and ovine enteric picornavirus and its application. Background Art

[0002] In 2020, a new genus of the Picornaviridae family was discovered in diarrheic calf fecal samples through high-throughput sequencing technology. Since it is derived from bovine and ovine Sapelo-Entero-like picornavirus, the International Committee on Taxonomy of Viruses (ICTV) named it bovine and ovine enteric picornavirus (Boosepivirus, abbreviated as BooV). Bovine and ovine enteric picornavirus (BooV) has the common characteristics of the Picornaviridae family: a non-enveloped, icosahedral single-stranded positive-strand RNA virus. Most of them are important human and animal pathogens and can cause diseases of the central nervous system, respiratory tract, gastrointestinal tract, heart, and liver. Currently, bovine and ovine enteric picornavirus (BooV) is considered to be one of the potential pathogens causing diarrhea in cattle and sheep and can be transmitted across species. However, its pathogenicity, pathogenesis, and epidemiology are not clear and all require further in-depth research and analysis. In order to provide a scientific basis for the basic research of this newly emerging virus, it is imperative to establish a sensitive and accurate detection method. However, there is still a lack of a mature in vitro cell culture model and rapid detection methods (such as immunoassay, colloidal gold, immunochromatographic strip, etc.). Currently, only the PCR detection method (CN118996013A, 20241122) has a detection limit of 4.85×10 -7 ng / μL, but it is complex to operate and time-consuming (completed within 3 hours), and is not suitable for rapid detection in on-site epidemiological investigations. Therefore, there is an urgent need to develop an efficient and convenient rapid detection method for detecting bovine and ovine enteric picornavirus.

[0003] Loop-mediated isothermal amplification (LAMP) is a new nucleic acid amplification technology that can amplify target genes under isothermal conditions. It has the advantages of being convenient, rapid, specific, and sensitive. The principle is to design four primers for six regions on the target gene. Generally, a pair of loop primers is also designed to improve the amplification efficiency and shorten the reaction time. Using strand displacement DNA polymerase to carry out the amplification reaction under isothermal conditions (60-65°C), the amplification can be completed within 15-60 minutes, with the characteristics of being fast, simple, and sensitive, and has been used for the rapid identification of various pathogens. Compared with the PCR detection method, this method does not require expensive instruments, only needs a water bath or incubator, and has the characteristics of simple operation and rapidity. However, due to the extremely high amplification efficiency of LAMP (up to 10 9 copies), it is easy to produce aerosol pollution, resulting in false positives and environmental pollution, which also become the bottleneck hindering the application of this technology. Therefore, how to avoid environmental pollution while using LAMP to rapidly detect bovine and ovine enteric picornavirus (BooV) is the technical problem that this invention continues to solve. Summary of the Invention

[0004] The purpose of the present invention is to at least partially overcome the deficiencies of the prior art and provide a LAMP detection method capable of rapidly detecting bovine and ovine enteric picornavirus.

[0005] The purpose of the present invention is also to provide that the LAMP detection method of bovine and ovine enteric picornavirus can avoid environmental pollution.

[0006] To achieve the above purpose or one of the purposes, the present invention provides the following technical solutions:

[0007] In the first aspect, the present invention provides a primer composition for LAMP detection of bovine and ovine enteric picornavirus, including inner primers and outer primers. The inner primers consist of a BooV-FIP and a BooV-BIP to form an inner primer pair, and the outer primers consist of a BooV-F3 and a BooV-B3 to form an outer primer pair. The nucleotide sequences of BooV-FIP, BooV-BIP, BooV-F3, and BooV-B3 are shown in SEQ ID NO.1-SEQ ID NO.4 respectively.

[0008] According to a preferred embodiment of the present invention, in the primer composition, the molar ratio of the inner primers to the outer primers is 3:1 to 12:1, or the final concentration of the inner primers is 0.8-2.4 μmol / L and the final concentration of the outer primers is 0.1-0.3 μmol / L.

[0009] According to a preferred embodiment of the present invention, in the primer composition, when the molar ratio of the inner primer to the outer primer is 8:1, the final concentration of the inner primer is 1.6 μmol / L and the final concentration of the outer primer is 0.2 μmol / L.

[0010] In a second aspect, the present invention provides a LAMP detection kit for bovine and ovine enteric picornavirus, which includes a negative control and a reaction premix containing the primer composition; it also includes a sealing liquid capable of blocking the LAMP detection, and a color developing agent for visualizing the determination of the LAMP detection result.

[0011] According to a preferred embodiment of the present invention, in the LAMP detection kit for bovine and ovine enteric picornavirus, in addition to the primer composition, the reaction premix further includes 10×Bst buffer, 8 U / μL of Bst polymerase, 10 mM of dNTP, 100 mM of MgSO4 solution, 5 M of betaine, and RNase-Free water; the sealing liquid is paraffin oil, and the color developing agent is 2 mM of HNB solution; it also includes a positive control.

[0012] According to a preferred embodiment of the present invention, in the LAMP detection kit for bovine and ovine enteric picornavirus, the primer composition is first prepared into a primer mixture, and then the primer mixture is added to the reaction premix; wherein, the preparation of the primer mixture is: equal volumes of BooV-FIP, BooV-BIP, BooV-F3, and BooV-B3 are taken and mixed.

[0013] Preferably, the BooV-FIP, BooV-BIP, BooV-F3, and BooV-B3 are first diluted to 100 μmol / L as the primer stock solution, the primer stock solution is diluted by a certain multiple to obtain the primer working solution, and then equal volumes of the primer working solutions corresponding to BooV-FIP, BooV-BIP, BooV-F3, and BooV-B3 are taken and mixed to prepare the primer mixture.

[0014] According to a preferred embodiment of the present invention, in the LAMP detection kit for bovine and ovine enteric picornavirus, the reaction premix containing the primer composition is pre-loaded in each reaction tube, and the addition amounts of the components of the reaction premix are: 2.5 μL of 10×Bst buffer, 1 μL of 8 U / μL of Bst polymerase, 3.5 μL of 10 mM of dNTP, 0.8 μL of 100 mM of MgSO4 solution, 4 μL of 5 M of betaine, 7 μL of RNase-Free water; after equal volumes of BooV-FIP, BooV-BIP, BooV-F3, and BooV-B3 are prepared into the primer mixture, 2 μL is added.

[0015] Preferably, the reaction premix containing the primer composition pre-loaded in each reaction tube further includes a 2 mM HNB solution with an addition amount of 1.5 μL.

[0016] In a third aspect, the present invention provides a method for detecting small RNA virus in cattle and sheep intestines by LAMP. Using the above-mentioned LAMP detection kit for small RNA virus in cattle and sheep intestines, a closed and visual LAMP detection is performed on the sample to be tested. The detection steps include template pretreatment, LAMP reaction, and result determination; among them, template pretreatment: first extract the RNA of the sample to be tested, and then reverse transcribe the RNA into cDNA; LAMP reaction: after sequentially adding cDNA and 50 μL of paraffin oil to cover the liquid surface in the reaction premix, place it in a closed LAMP reaction at 64 °C for at least 45 minutes; result determination: if the LAMP reaction solution changes from light purple to cyan blue, the detection result is judged as positive; if the LAMP reaction solution remains light purple all the time, the detection result is judged as negative; this detection method does not include methods for diagnosing and treating diseases.

[0017] According to a preferred embodiment of the present invention, when the reaction premix does not include a chromogenic solution, in the LAMP reaction step, it is necessary to sequentially add 1.5 μL of 2 mM HNB solution, 2 μL of cDNA of the sample to be tested, and 50 μL of paraffin oil to the reaction premix, and then place it in a closed LAMP reaction at 64 °C for at least 45 minutes.

[0018] In a fourth aspect, the present invention provides the application of the above-mentioned primer composition, the above-mentioned LAMP detection kit for small RNA virus in cattle and sheep intestines, and the above-mentioned method for detecting small RNA virus in cattle and sheep intestines by LAMP in the rapid detection of small RNA virus in cattle and sheep intestines.

[0019] According to a preferred embodiment of the present invention, the application is on-site epidemiological investigation.

[0020] Advantages of the present invention:

[0021] The present invention provides a primer composition, a kit and a detection method for LAMP detection of small RNA virus in the intestines of cattle and sheep, which can perform rapid LAMP detection of small RNA virus in the intestines of cattle and sheep in a closed and visual manner for the sample to be tested, and is suitable for on-site epidemiological investigation. Compared with the traditional PCR detection, the LAMP detection is simple to operate. From nucleic acid extraction to result analysis and determination, it can be completed within 2 hours, and the detection time is shortened by 1 hour; only a water bath that can adjust the temperature is required for the LAMP detection process, without the need to be equipped with expensive PCR instruments, and the detection cost is low; the detection result can be judged by the visual end-point judgment method, that is, the negative or positive of the detection result can be directly distinguished only by the naked eye; during the detection process, a closed reaction can be carried out after sample addition and operation, that is, it does not involve toxic reagents and does not need to open the lid, thus avoiding aerosol contamination and overcoming the problem of open lid contamination in traditional LAMP. In terms of the performance indicators of this LAMP detection platform, there is no cross-reaction with 6 common viruses of cattle and sheep other than the small RNA virus in the intestines of cattle and sheep, and the detection specificity is high; the lowest detection limit can reach 4.63×10 -8 ng / μL, the detection sensitivity is high, which is 10 times higher than the publicly reported PCR method (4.85×10 -7 ng / μL); the repeat detection accuracy and stability of the same sample are good; the detection results of clinical samples are consistent with the detection rate of small RNA virus in the intestines of cattle and sheep, and it is suitable for on-site epidemiological investigation and analysis.

[0022] The present invention provides a primer composition, a kit and a detection method for rapid LAMP of small RNA virus in the intestines of cattle and sheep suitable for on-site epidemiological investigation. Since the kit is prepared with a reaction premix containing the primer composition, during detection, only the cDNA obtained by reverse transcription of the nucleic acid extracted from the sample to be tested and 50 μL of paraffin oil need to be added in sequence, and then the reaction tube can be placed at 64°C for a closed LAMP reaction. The operation is simple, and since HNB is added as a chromogenic solution in the kit, the detection result can be visually distinguished by the naked eye. It not only has low requirements for equipment cost and short detection time, but also has strong specificity and high sensitivity through experimental verification compared with traditional PCR detection, achieving remarkable progress. The primer composition for LAMP detection of small RNA virus in the intestines of cattle and sheep provided by the present invention only includes inner primers and outer primers, avoiding the traditional method of adding loop primers to improve the detection sensitivity and enhance the reaction efficiency. The present invention not only has a simple primer composition, but also can increase the detection sensitivity of the LAMP reaction by 10 times by optimizing the molar ratio of the inner primers and outer primers and their final concentrations in the reaction system, and does not affect the detection specificity, achieving unexpected technical effects.

[0023] The present invention combines the visualization and the closed-loop mediated isothermal amplification detection technology synergistically, that is, 50 μL of paraffin oil is added to the loop-mediated isothermal amplification system to cover the liquid surface to prevent the escape of aerosol. On the premise that the lid does not need to be opened during the detection process of the present invention, it can further avoid problems such as false positives and environmental pollution caused by the escape of aerosol. The entire detection reaction process of the present invention does not require opening the lid, does not require gel electrophoresis operation, and cooperates with the added color reagent. The detection result is visually judged by the naked eye according to the color change of the reaction solution, that is, the LAMP detection result also truly realizes lid-free detection. The color reagent of the present invention is preferably a hydroxy-naphthol blue (HNB) solution. HNB is a metal indicator with the molecular formula: C 20 H 11 N2Na3O 11 S3, molecular weight: 620.47. HNB is easily soluble in water and ethanol. The aqueous solution of HNB is blue at pH 7-12 and can be directly added as a component of the LAMP reaction. HNB can combine with Mg 2+ in the reaction system to form a complex, which shows a light purple color when observed directly with the naked eye. If LAMP amplification does not occur, there will be no color change during the entire reaction process, and the detection result is still light purple, which is equivalent to a negative reaction result. If LAMP amplification occurs, due to the generation of a large amount of pyrophosphate, this pyrophosphate can chelate Mg 2+ in the reaction system, which causes the color change of the HNB solution to its original color, that is, cyan blue. The detection result is that the color changes from light purple before the reaction to cyan blue, which is equivalent to a positive reaction result. The sealing liquid of the present invention is preferably paraffin oil. The sealing liquid can be directly added to the reaction tube to cover the liquid surface. Simple operation can physically isolate the reaction system from the external environment and reduce the risk of false positive contamination caused by opening the tube. Among them, paraffin oil, as a mineral oil-based sealing liquid, is safe and low-cost, can withstand the isothermal condition (63 °C) of the LAMP reaction, and the present invention preferably adds 50 μL of paraffin oil, and the thickness of the sealing layer is appropriate and does not affect the temperature conduction efficiency.

[0024] The present invention can achieve a minimum detection limit of up to 4.63×10 -8The sensitivity detection of ng / μL depends on the optimization screening of the reaction system and reaction conditions by preliminary experiments and reaction condition optimization screening experiments. For example, in the reaction system, compared with DMSO, the addition of betaine not only helps to reduce the interference of secondary structure, but also partially neutralizes the interference of impurities introduced by complex fecal samples. In addition, betaine can reduce the energy required for chain displacement, so that the Bst enzyme can more efficiently unwind the double chain, enhance the LAMP amplification efficiency and improve the detection sensitivity. Using 100mM MgSO4 solution as the source of magnesium ions will not only not affect the pH value of the color development reaction of the colorimetric solution, but also the appropriate amount after optimization can provide sufficient free Mg 2+ , used to chelate the pyrophosphate produced by the LAMP reaction, causing HNB to appear blue. In addition, in order to better meet the needs of on-site epidemiological investigation, the present invention prepares the necessary components of the reaction system such as primer combination, enzyme, buffer, magnesium ion, etc. into a LAMP reaction premix solution, and prepares it into a ready-to-use kit, which can effectively reduce the operation threshold and the convenience of detection, and further improve the detection efficiency of on-site detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The figure is a closed, visualized optimization result diagram of the reaction temperature of the bovine and sheep enteric small RNA virus LAMP detection of the present invention; wherein 1 to 4 represent the curve diagram of the LAMP reaction results monitored by the real-time turbidity instrument when the reaction temperatures are 63°C, 64°C, 65°C and 66°C, respectively; 5 represents the negative control; the abscissa is the reaction time; and the ordinate is the real-time change intensity of the turbidity of the reaction solution;

[0026] Figure 2 The figure is a specificity verification result diagram of the closed and visualized bovine and sheep enteric small RNA virus LAMP detection platform of the present invention; A is a visualized endpoint judgment result, wherein 1-8 represent different samples to be tested: 1 is bovine and sheep enteric small RNA virus, 2 is bovine coronavirus, 3 is bovine enterovirus, 4 is bovine viral diarrhea virus, 5 is bovine parainfluenza virus type 3, 6 is bovine astrovirus, 7 is bovine rotavirus, and 8 is a negative control; B is a curve diagram of the specificity result monitored by the real-time turbidity meter;

[0027] Figure 3 Figure 1 is a sensitivity verification result diagram of the closed, visualized bovine and sheep enteric small RNA virus LAMP detection platform of the present invention; A is a visualized endpoint judgment result, wherein 1-10 represent a series of concentrations of standard products, and the specific concentrations are: 1 is 4.63×10 0 ng / μL, 2 is 4.63×10 -1 ng / μL, 3 is 4.63×10 -2 ng / μL, 4 is 4.63×10 -3 ng / μL, 5 is 4.63×10-4 ng / μL, 6 is 4.63×10 -5 ng / μL, 7 is 4.63×10 -6 ng / μL, 8 is 4.63×10 -7 ng / μL, 9 is 4.63×10 -8 ng / μL, 10 is 4.63×10 -9 ng / μL, 11 is the negative control; B is the curve graph of monitoring the specific results by a real-time turbidimeter;

[0028] Figure 4 This is a comparison graph of the detection results of clinical samples by the closed and visual LAMP detection platform for bovine and ovine enteric picornavirus of the present invention. A is the visual end-point interpretation result graph of the present invention, and B is the electrophoresis graph of the detection results by the PCR method. Among them, 1-6 respectively represent 6 clinical samples, 7 is the positive control, 8 is the negative control, and M is Marker D2000. Detailed implementation manners

[0029] The exemplary embodiments of the present invention will be described in detail below with reference to the accompanying drawings, where the same or similar reference numerals represent the same concept, such as bovine and ovine enteric picornavirus = Boosepivirus = BooV.

[0030] In the following detailed description, for the sake of explanation, many specific details are set forth to provide a comprehensive understanding of the embodiments disclosed herein. The following embodiments are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention.

[0031] The experimental methods used in the following examples are all conventional methods unless otherwise specified. The materials, reagents, etc. used can be obtained from commercial sources unless otherwise specified. Among them, the primer compositions were all synthesized by BGI Tech Solutions (Guangzhou) Co., Ltd.; Bovine and ovine enteric picornavirus (BooV), Bovine coronavirus, Bovine enterovirus, Bovine viral diarrhea virus, Bovine parainfluenza virus type 3, Bovine kobuvirus, Bovine rotavirus, Bovine astrovirus, and Escherichia coli were all preserved by the Guangxi Key Laboratory of Veterinary Biotechnology; The EasyPure Viral DNA / RNA Extraction Kit was purchased from TransGen Biotech Co., Ltd. Beijing and was used to extract the test samples containing the above viruses. The extracted DNA samples were directly stored in a -70°C refrigerator or directly subjected to LAMP detection; The extracted RNA samples were reverse transcribed into cDNA using a reverse transcription kit and then stored in a -70°C refrigerator or directly subjected to LAMP detection; Among them, the reverse transcription kit (HiFiScript cDNA Synthesis Kit; product number: CW2569M) was purchased from CW Biotech Co., Ltd. Beijing; The Bst buffer (10×) and Bst enzyme (8U / μL) were purchased from New England Biolabs; The real-time turbidimeter was purchased from Eiken Chemical Co., Ltd. Japan (model LA-320, Tokyo, Japan). However, obviously, one or more embodiments can also be implemented without these specific details. For those not specified in the examples, they are carried out according to the conventional conditions or the conditions recommended by the manufacturer's instructions.

[0032] The molecular biology experimental methods not specifically described in the following examples were all carried out with reference to the specific methods listed in "Molecular Cloning: A Laboratory Manual" (Third Edition) by J. Sambrook, or according to the kit and product instructions. The test object of the present invention is the test sample, that is, the biological sample to be detected, which can be any body fluid or excrement (for example, but not limited to blood, urine, feces, saliva, tears, bile, or cerebrospinal fluid), which may or may not contain host or pathogen cells, cell components, or nucleic acids, and this biological sample is an in vitro and lifeless sample. The direct purpose of the detection of the present invention is to detect whether the bovine and ovine enteric picornavirus described in the present invention exists in this biological sample (preferably feces in the present invention), and the detection result corresponds to a qualitative result of negative or positive, and there is no process of directly obtaining a disease diagnosis result or a health status. The intended use of the detection kit described in the present invention is for the qualitative detection of bovine and ovine enteric picornavirus in the test biological sample by closed visual LAMP. Therefore, the present invention does not belong to a disease diagnosis method and meets the basic requirements of the Patent Law for patent protection objects.

[0033] The present invention combines the LAMP technology with a color indicator, provides a reaction tube containing a reaction premix, and only needs to add a sample to be tested and a sealing liquid for a closed LAMP reaction during detection, avoiding contamination introduced by multiple open-cap pipetting, and is suitable for on-site rapid detection. The end-point reading detection combining color reaction visualization replaces the real-time monitoring process, avoiding secondary contamination caused by opening the cap during the monitoring process. The present invention only contains 4 necessary LAMP primers, optimizes the molar ratio, final concentration, reaction system, reaction conditions, etc. of the inner primers and outer primers, and finally establishes a highly sensitive, highly specific, strongly anti-interference, pollution-free, and visual LAMP rapid detection method through performance evaluation. The specific embodiments of the present invention are described in detail as follows:

[0034] Example 1: Sequence design of primer compositions

[0035] According to the 5' UTR gene of the enteric picornavirus NX20-1 strain sequence (GenBank accession number: OP554215) of cattle and sheep published in GenBank, three sets of LAMP primer compositions were designed using the PrimerExplorer design software. Each set of LAMP primer compositions respectively includes the corresponding outer primer pair F3, B3 and inner primer pair FIP, BIP. Preliminary comparative analysis shows that the Tm values (60-65 °C), GC contents (40-65%), and secondary structures of the three sets of LAMP primer compositions meet the requirements, and the length of the amplified target fragment is 200 ± 40 bp. The verification results of the primers commissioned for synthesis through specific experiments are: the detection limits of the 3 sets of primers are 10 -3 ng / μL, 10 -5 ng / μL and 10 -7 ng / μL. Among them, the sequence of the preferred LAMP primer composition with a detection limit reaching 10 -7 ng / μL is shown in Table 1, and the length of the corresponding amplified target fragment is 192 bp.

[0036] Table 1 Sequence list

[0037] Primer Name Sequence (5’ to 3’) SEQ ID NO. BooV-FIP CAGGGTCCTGGAGGAAACACAATGCACGCGAAAACCTTGAA SEQ ID NO.1 BooV-BIP ATGCGGCTAAACCTAACCCGCCGCAACTTGCGCATTACG SEQ ID NO.2 BooV-F3 AAGGTGAGGCCGTGAGAG SEQ ID NO.3 BooV-B3 GGAACACCAAAGTAGTCGGT SEQ ID NO.4

[0038] Example 2: Establishment of a closed and visual LAMP detection platform

[0039] Template pretreatment: It includes two steps of nucleic acid extraction and reverse transcription. The samples to be tested are the fecal samples of cattle and sheep with diarrhea symptoms. The total RNA of the samples to be tested is extracted using the EasyPure Viral DNA / RNA Extraction Kit. The extracted total RNA is reverse transcribed into cDNA using a reverse transcription kit as the template for the subsequent LAMP reaction.

[0040] LAMP reaction system: Based on a set of optimized LAMP primer compositions verified in preliminary experiments, a 25 μL reaction system was established, including a reaction premix containing the primer composition. The components of the reaction premix further included 2.5 μL of Bst buffer (10×), 1 μL of Bst polymerase (8 U / μL), 3.5 μL of dNTP (10 mM), 0.8 μL of MgSO4 solution (100 mM), 4 μL of betaine (5 M), and 1.5 μL of HNB solution (2 mM). Among them, since it is a closed reaction, the four LAMP primers in the reaction premix were prepared as a primer mixture in advance. The preparation method was as follows: Equal volumes of primers BooV-FIP, BooV-BIP, BooV-F3, and BooV-B3 were taken, and the final concentrations in the 25 μL reaction system were: the final concentration of the inner primer pair was 0.8 - 2.4 μmol / L (the final concentration of BooV-FIP and BooV-BIP was 0.4 - 1.2 μmol / L each), the final concentration of the outer primer pair was 0.1 - 0.3 μmol / L (the final concentration of BooV-F3 and BooV-B3 was 0.05 - 0.15 μmol / L each). The equal-volume addition amount was selected from 0.5 - 1.5 μL. After addition, the molar ratio of the inner primer to the outer primer was 3:1 - 12:1.

[0041] 1 - 3 μL of the pretreated template was added to the reaction premix, and a negative control was set up, that is, water was taken as the template and added to the reaction premix. RNase-Free water was added to make up to 25 μL, and the preparation of the LAMP reaction system was completed. Finally, 50 μL of paraffin oil was added to cover the liquid surface to prevent aerosol escape for closed LAMP reaction without opening the lid.

[0042] To facilitate the epidemiological detection of a small number of clinical samples, when preparing the primer mixture, the synthesized primers BooV-FIP, BooV-BIP, BooV-F3, and BooV-B3 were diluted to 100 μmol / L as the primer stock solution. According to the need, the primer stock solution was diluted by a certain multiple to obtain the primer working solution, and then equal volumes of the primer working solutions corresponding to BooV-FIP, BooV-BIP, BooV-F3, and BooV-B3 were taken to prepare the primer mixture. The preferred equal-volume addition amount was 0.5 μL, that is, the volume of both the inner primer pair and the outer primer pair was 1 μL. As a result, the preferred volume of the primer mixture in each LAMP reaction system was 2 μL.

[0043] The LAMP reaction conditions are as follows: water bath reaction at 63 - 66 °C for 30 min - 1 h. Observe the color change process during the closed LAMP reaction. If more accurate quantitative analysis is required, a real-time turbidimeter can also be used to record the LAMP reaction results. Color changes in different concentrations of the samples to be tested generally start around 30 min after the LAMP reaction begins.

[0044] Preparation of standard products: Take a sample of small RNA virus in bovine and ovine intestines that has been confirmed to be strongly positive by the existing PCR detection method in the laboratory. First, use the EasyPure Viral DNA / RNA Extraction Kit to extract the total RNA of this sample, then use the reverse transcription kit to reverse transcribe the extracted total RNA into cDNA. Then, use a nucleic acid detector to measure its concentration as 46.3 ng / μL, which is used as the starting concentration for preparing the standard product. Dilute this cDNA with RNA-Free Water in a 10-fold ratio successively until 4.63×10 -10 ng / μL, obtaining a series of standard products with concentrations. The specific concentrations from large to small are: 4.63×10 0 ng / μL, 4.63×10 -1 ng / μL, 4.63×10 - 2 ng / μL, 4.63×10 -3 ng / μL, 4.63×10 -4 ng / μL, 4.63×10 -5 ng / μL, 4.63×10 -6 ng / μL, 4.63×10 - 7 ng / μL, 4.63×10 -8 ng / μL, 4.63×10 -9 ng / μL, 4.63×10 -10 ng / μL. Store the diluted series of standard products at -70 °C for later use.

[0045] Optimization and screening of LAMP reaction conditions. Prepare the above 25 μL LAMP reaction system: Prepare a primer mixture according to the molar ratio of inner primer: outer primer of 4:1, where the final concentration of the inner primer pair is 1 μmol / L and the final concentration of the outer primer pair is 0.25 μmol / L. Therefore, when preparing the primer mixture, first dilute the primer stock solutions corresponding to BooV-FIP and BooV-BIP 4-fold to a working solution concentration of 25 μmol / L, and dilute the primer stock solutions of primers BooV-F3 and BooV-B3 16-fold to a primer working solution concentration of 6.25 μmol / L. Then, take 0.5 μL of the primer working solutions of BooV-FIP, BooV-BIP, BooV-F3, and BooV-B3 to prepare the primer mixture. Prepare the reaction premix: Sequentially add 2.5 μL of Bst buffer (10×), 2.5 μL, 1 μL of Bst polymerase (8 U / μL), 3.5 μL of dNTP (10 mM), 0.8 μL of MgSO4 solution (100 mM), 4 μL of betaine (5 M), 1.5 μL of HNB solution (2 mM), and 2 μL of the prepared primer mixture (where the inner primer: outer primer = 4:1), and the preparation of the reaction premix is completed, totaling 15.3 μL. Take 3 μL of the standard product with a dilution concentration of 4.63×10 -2 ng / μL as the template, supplement 6.7 μL of RNase-Free water to complete the preparation of the LAMP reaction system, add 50 μL of paraffin oil to cover the liquid surface, cover the reaction tube lid, and place it in a water bath at 63 °C, 64 °C, 65 °C, and 66 °C respectively to seal the reaction for 1 h. Use a real-time turbidimeter to record the LAMP reaction results. The results of optimizing and screening the LAMP reaction temperature are as Figure 1 shown. Since 3 μL of the standard product with a concentration of 4.63×10 -2 ng / μL is used as the template, when the LAMP reaction reaches 40 minutes, the turbidity value can reach 0.2 (regarded as the LAMP reaction plateau phase), so the reaction time is preferably 45 minutes (40 + 5) to 60 minutes.

[0046] Figure 1 It can be seen that: When performing the LAMP reaction at different temperatures, the LAMP turbidity curves recorded by the real-time turbidimeter are all relatively steep, proving that efficient LAMP amplification reactions can be carried out at all 4 temperatures. However, the start time of the LAMP reaction is slightly different. The order of the LAMP reaction start is 63 °C, 64 °C, 65 °C, and 66 °C in sequence. Although the LAMP reaction starts earliest at 63 °C, when performing the LAMP reaction at 64 °C, the real-time change intensity curve of the solution turbidity is steeper than that at 63 °C, proving that this temperature is the relatively preferred condition for the LAMP reaction.

[0047] Referring to the above optimization and screening experiment of the LAMP reaction temperature, on the basis of the LAMP reaction conditions (enzyme concentration, magnesium ion concentration, reaction solution components, chromogenic solution) determined in the preliminary experiment, with 64°C as the preferred reaction temperature for the LAMP reaction, the reaction conditions such as the molar ratio of the inner primer to the outer primer, the final concentrations of the inner primer and the outer primer, and the template dosage were further optimized and screened. The optimization and screening results showed that the optimal molar ratio of the inner primer to the outer primer was 8:1. Among them, the preferred final concentration of the inner primer was 1.6 μmol / L, and the preferred final concentration of the outer primer was 0.2 μmol / L; the preferred supplementary volume of RNase-Free water was 7 μL; the preferred added volume of the template was 2 μL. That is, during LAMP detection, only 2 μL of the template after extraction and reverse transcription of the sample to be tested needs to be added to the reaction premix, and then 50 μL of paraffin oil is added to cover the liquid surface. The reaction tube lid is covered and placed at 64°C for at least 45 minutes for a closed and visual LAMP reaction.

[0048] Closed and visual LAMP detection kit: According to the above optimized and screened reaction system, a closed and visual LAMP detection kit for bovine and ovine enteric picornavirus was constructed. The components of the kit include a negative control, a positive control, a sealing liquid, a chromogenic agent, and a reaction premix pre-loaded with a primer composition in a reaction tube.

[0049] Preferably, the reaction premix includes 10×Bst buffer, 8 U / μL of Bst polymerase, 10 mM of dNTP, 100 mM of MgSO4 solution, 5 M of betaine, RNase-Free water, chromogenic solution, and primer composition; among them, the primer composition can be prepared by mixing the four primers BooV-FIP, BooV-BIP, BooV-F3, and BooV-B3 according to the above preferred molar ratio and final concentration to form a primer mixture. In addition, the sealing liquid is paraffin oil, the chromogenic agent is 2 mM HNB solution, the negative control is RNase-Free water, and the positive control is a standard product in the range of 4.63×10 -2 ng / μL to 4.63×10 -5 ng / μL.

[0050] Further preferably, the specific components of the reaction premix containing the primer composition pre-loaded in each reaction tube are: 2.5 μL of Bst buffer (10×), 1 μL of Bst polymerase (8 U / μL), 3.5 μL of dNTP (10 mM), 0.8 μL of MgSO4 solution (100 mM), 4 μL of betaine (5 M), 7 μL of RNase-Free water, 2 μL of primer mixture and / or 1.5 μL of HNB solution (2 mM). During LAMP detection, only 2 μL of the template, RNase-Free water, and positive control after extracting and reverse transcribing the sample to be tested need to be taken as templates and added separately to the reaction tubes pre-loaded with the reaction premix, and then 50 μL of paraffin oil is added to cover the liquid surface. After covering the reaction tube lid, the LAMP reaction is carried out at 64 °C. Alternatively, in order to maintain the stability of the chromogenic agent, the reaction premix may not contain the pre-added chromogenic solution. During LAMP detection, 1.5 μL of HNB solution (2 mM), 2 μL of template, and 50 μL of paraffin oil are added to each reaction tube in sequence.

[0051] Closed and visual LAMP detection method: The closed and visual LAMP detection method for small RNA virus in bovine and sheep intestines established in the present invention mainly includes two core detection steps: template pretreatment and LAMP reaction after obtaining the sample to be tested.

[0052] Template pretreatment: The templates are cDNA of the sample to be tested, RNase-Free water, and positive control respectively. Among them, the sample to be tested is a fecal sample collected from cattle or sheep suspected of having diarrhea symptoms. First, the total RNA of the fecal sample is extracted using the EasyPure Viral DNA / RNA Extraction Kit for about 30 minutes, and then the extracted total RNA is reverse transcribed into cDNA using the reverse transcription kit for about 30 minutes; this cDNA is the template for the subsequent LAMP reaction of the sample to be tested.

[0053] LAMP reaction: 2 μL of cDNA of the sample to be tested, RNase-Free water, and / or positive control are taken and added to the reaction tubes pre-loaded with the reaction premix respectively, and then 50 μL of paraffin oil is added to cover the liquid surface. After covering the lid, the LAMP reaction is carried out at 64 °C. A water bath or a real-time turbidimeter is used to maintain the reaction temperature at a constant 64 °C, and the detection result is judged visually at the end point or the LAMP reaction process is monitored in real time.

[0054] The visual end-point judgment criterion is that if the LAMP reaction solution changes from light purple to cyan blue, the sample to be tested contains small RNA virus in bovine and sheep intestines, and the detection result is positive; if the LAMP reaction solution remains light purple without color change, the sample to be tested does not contain small RNA virus in bovine and sheep intestines, and the detection result is negative.

[0055] If a real-time turbidimeter is used to monitor the LAMP reaction at 650 nm, the monitoring results can be plotted as a turbidity curve of the LAMP reaction. The abscissa is the reaction time, and the ordinate is the real-time change intensity of the turbidity of the reaction solution. Compared with the negative control, the turbidity value of the test sample higher than 3 times the fluctuation range of the negative control is set as the threshold (Tt value). The highest turbidity value of the negative control in the present invention is 0.0032, so the threshold is set to 0.01 (Tt value = 0.01). If the LAMP reaction shows a turbidity curve with a significant increase in turbidity value and the turbidity value is higher than the threshold at 45 minutes of the LAMP reaction, the test result can be determined to be positive. If the content concentration of bovine and sheep enteric picornavirus in the test sample is higher, the turbidity curve is steeper, and the start time of the LAMP reaction curve is earlier; if the content concentration of bovine and sheep enteric picornavirus in the test sample is lower, the turbidity curve is flatter, and the start time of the LAMP reaction is later; if the turbidity value rises and is higher than 0.01 at the latest 45 minutes of the LAMP reaction, it can be determined to be weakly positive.

[0056] Finally, the preferred closed and visual LAMP detection platform of the present invention at least includes the above-mentioned constructed closed and visual LAMP detection kit for bovine and sheep enteric picornavirus, and the above-mentioned established closed and visual LAMP detection method for bovine and sheep enteric picornavirus.

[0057] Example 3. Performance verification of the closed and visual LAMP detection platform for bovine and sheep enteric picornavirus

[0058] Performance verification was carried out on the above-mentioned closed and visual LAMP detection platform. The verification contents included: specificity, sensitivity, accuracy, stability, and clinical samples.

[0059] 1) Specificity

[0060] The test samples for specificity verification were respectively derived from bovine and sheep enteric picornavirus, bovine coronavirus, bovine enterovirus, bovine viral diarrhea virus, bovine parainfluenza virus type 3, bovine astrovirus, and bovine rotavirus (all from the Veterinary Research Institute of Guangxi Zhuang Autonomous Region). A negative control (water, preferably RNase-Free water) was set, and the above-mentioned closed and visual LAMP detection platform was used for detection. The detection results are as Figure 2 shown.

[0061] Figure 2It is clearly visible that whether using the end-point reading by naked-eye visualization or the LAMP turbidity curve graph monitored and plotted by a real-time turbidimeter, it can be clearly distinguished that: when the sample to be tested is the small RNA virus in bovine and ovine intestines, the reaction solution can be seen to change from light purple to cyan blue with the naked eye, and an obvious turbidity curve of LAMP amplification can be seen, that is, the result of the closed and visual LAMP detection is positive; if the samples to be tested are bovine coronavirus, bovine enterovirus, bovine viral diarrhea virus, bovine parainfluenza virus type 3, bovine astrovirus, bovine rotavirus and negative control respectively, the color change cannot be distinguished with the naked eye, and no LAMP amplification curve appears, that is, the result of the closed and visual LAMP detection is negative. Therefore, the closed and visual LAMP detection platform described in the present invention can only show specific LAMP amplification results for the small RNA virus in bovine and ovine intestines, that is, it has good specificity.

[0062] 2) Sensitivity

[0063] The samples to be tested for sensitivity verification are the standard products with the series of concentrations prepared above. The specific concentrations of the standard products from large to small are as follows: 4.63×10 0 ng / μL, 4.63×10 -1 ng / μL, 4.63×10 -2 ng / μL, 4.63×10 -3 ng / μL, 4.63×10 -4 ng / μL, 4.63×10 -5 ng / μL, 4.63×10 -6 ng / μL, 4.63×10 -7 ng / μL, 4.63×10 -8 ng / μL, 4.63×10 -9 ng / μL. A negative control (water, preferably RNase-Free water) is set, and the above-mentioned closed and visual LAMP detection platform is used for detection. The detection results are as Figure 3 shown.

[0064] Figure 3 It is clearly visible that whether using the end-point reading by naked-eye visualization or the LAMP turbidity curve graph monitored and plotted by a real-time turbidimeter, it can be clearly distinguished that: when the samples to be tested are the standard product with a concentration of 4.63×10 -9 ng / μL and the negative control, the color change cannot be distinguished with the naked eye, and no LAMP amplification curve appears, that is, the result of the closed and visual LAMP detection is negative. When the samples to be tested are from 4.63×10 0 ng / μL to 4.63×10 -8When using the standard products within the concentration range of ng / μL, it is clearly visible to the naked eye that the reaction solution changes from light purple to cyan blue, and an obvious turbidity curve of LAMP amplification can be seen. That is, the closed and visual LAMP detection result is positive, and it can also be seen that the sensitivity of this closed and visual LAMP detection can reach a minimum detection limit of 4.63×10 -8 ng / μL, which is nearly 10 times higher than the publicly disclosed PCR method (CN118996013A, 4.85×10 -7 ng / μL).

[0065] 3) Accuracy and stability

[0066] The samples to be tested for accuracy and stability are the standard products of the above-prepared series of concentrations. The specific concentrations of the standard products from large to small are as follows: 4.63×10 0 ng / μL, 4.63×10 -1 ng / μL, 4.63×10 -2 ng / μL, 4.63×10 -3 ng / μL, 4.63×10 -4 ng / μL, 4.63×10 -5 ng / μL, 4.63×10 -6 ng / μL, 4.63×10 -7 ng / μL, 4.63×10 -8 ng / μL, 4.63×10 -9 ng / μL and 4.63×10 -10 ng / μL. Using the above closed and visual LAMP detection platform, the standard products of the series of concentrations are repeatedly detected respectively. Each concentration of the standard product is detected 3 times. The detection results show that whether using the end-point reading of visual inspection by the naked eye or using the LAMP turbidity curve diagram monitored by a real-time turbidimeter, the negative and positive detection results of the 3 repeated detections of the standard product of the same concentration are the same. That is, only when the standard product is within the concentration range of 4.63×10 0 ng / μL to 4.63×10 - 8 ng / μL, the detection results are all positive. When the LAMP reaction is carried out for 45 minutes, the average turbidity value and coefficient of variation of the 3 repeated detections of each concentration of the standard product are shown in Table 2. It can be seen that within the range of 4.63×10 0 ng / μL to 4.63×10 - 8 ng / μL, the stability of this LAMP detection is good, and the detection accuracy of the corresponding turbidity value is within the specified range (CV% is less than 10%). At the same time, within the range of 4.63×10 -9 ng / μL to 4.63×10 -10The test results were all negative within the concentration range of ng / μL. It can be seen that the end-point interpretation results of the closed LAMP test visualization described in the present invention are consistent and stable with the results recorded by the real-time turbidimeter, and the accuracy and stability of the LAMP test platform are good.

[0067] Table 2 BooV LAMP test results

[0068] Concentration (ng / μL) Average Turbidity Coefficient of Variation (%) <![CDATA[4.63×10 0 > 0.3059±0.0014 4.58 <![CDATA[4.63×10 -1 > 0.2669±0.0016 5.60 <![CDATA[4.63×10 -2 > 0.2265±0.0015 6.62 <![CDATA[4.63×10 -3 > 0.1852±0.0012 6.48 <![CDATA[4.63×10 -4 > 0.1716±0.0012 6.99 <![CDATA[4.63×10 -5 > 0.1656±0.0013 7.85 <![CDATA[4.63×10 -6 > 0.1530±0.0012 7.84 <![CDATA[4.63×10 -7 > 0.1133±0.0009 7.94 <![CDATA[4.63×10 -8 > 0.0660±0.0006 9.09

[0069] 4) Clinical sample verification

[0070] Six breeding cattle suspected of having diarrhea symptoms were selected, and intestinal tissue samples or fecal samples of the six cattle were collected respectively. Among them, the pretreatment process of the intestinal tissue samples also included: adding 1 mL of PBS buffer to the intestinal tissue samples and then homogenizing, freezing and thawing repeatedly 3 times after sufficient homogenization, and then centrifuging at 13,000 g for 10 min to take the supernatant as the test sample; the pretreatment process of the fecal samples also included: adding 2 mL of normal saline to about 100 mg of fecal samples and then homogenizing, freezing and thawing repeatedly 3 times after sufficient homogenization, and then centrifuging at 13,000 g for 1 min to take the supernatant as the test sample. Six clinical test samples were obtained after the above-mentioned intestinal tissue samples or fecal samples were pretreated respectively. For the six clinical test samples obtained by pretreatment, the above-mentioned closed, visual LAMP and the publicly disclosed PCR method (CN118996013A) test platform were used for testing. First, the supernatant was pretreated as a template, that is, nucleic acid was extracted and reverse transcribed into cDNA. 2 μL of each cDNA corresponding to the six clinical samples was taken as a template, and positive and negative controls were set in parallel. The positive control was prepared by taking 2 μL of the stock solution of the standard product with a concentration of 46.3 ng / μL, and the negative control was taken 2 μL of water (ddH2O was taken this time), and the closed, visual LAMP and the publicly disclosed PCR method (CN118996013A) were tested in parallel. The end-point interpretation test results of the naked-eye visualization are as Figure 4 shown.

[0071] Figure 4Comparison charts of the detection results of the closed and visual LAMP of the present invention and the PCR method for 6 clinical samples to be tested. It can be clearly seen that: in the detection results of the closed and visual LAMP of the present invention, only the closed and visual LAMP reaction solutions of the 5th clinical sample and the positive control changed from light purple to cyan blue, that is, the small RNA virus in the bovine and sheep intestines was contained in the sample to be tested. The detection results can determine that the 5th clinical sample is positive for the small RNA virus in the bovine and sheep intestines; the LAMP reaction solutions of the other 5 clinical samples and the negative control remained light purple due to no distinguishable color change, and the detection results can determine that the 1st, 2nd, 3rd, 4th, and 6th clinical samples are negative for the small RNA virus in the bovine and sheep intestines. Correspondingly, in the electrophoresis chart of the PCR detection results, it can be seen that among the 6 clinical samples to be tested, only the PCR reaction solutions of the 5th clinical sample and the positive control showed specific electrophoretic amplification fragments, that is, the small RNA virus in the bovine and sheep intestines was contained in the sample to be tested. The detection results can determine that the 5th clinical sample is positive for the small RNA virus in the bovine and sheep intestines; the PCR reaction solutions of the other 5 clinical samples and the negative control did not show specific electrophoretic amplification fragments, and the PCR detection results also determined that the 1st, 2nd, 3rd, 4th, and 6th clinical samples are negative for the small RNA virus in the bovine and sheep intestines. Therefore, the detection results of the 6 clinical samples to be tested by the two detection methods are consistent.

[0072] The present invention provides a closed and visual LAMP detection platform for small RNA virus in bovine and sheep intestines without opening the lid. Based on the preferably constructed LAMP primer composition consisting only of inner primer pairs and outer primer pairs, a closed and visual LAMP detection kit for small RNA virus in bovine and sheep intestines is constructed by preloading a reaction premix containing the primer composition in the reaction tube. During detection, only 2 μL of the cDNA obtained by extracting and reverse transcribing the nucleic acid of the sample to be tested and 50 μL of paraffin oil are needed to cover the liquid surface, and then the reaction tube can be placed at 64 °C for at least 45 minutes for the closed LAMP reaction. From nucleic acid extraction to result analysis and determination, it can be completed within 2 hours. Finally, the detection results can be visually read by the naked eye through color change, and the detection limit can reach 4.63×10 -8 ng / μL, with high sensitivity, strong specificity, and low requirements for detection equipment. The closed reaction overcomes the problem of high contamination of traditional LAMP. The present invention is simpler in operation than the traditional PCR method and is more suitable for quickly detecting and analyzing the epidemic situation of small RNA virus in bovine and sheep intestines on-site. The present invention overcomes the technical problem of complex and difficult isolation and identification of newly discovered small RNA virus in bovine and sheep intestines, providing strong technical support for the detection of small RNA virus in bovine and sheep intestines.

[0073] The specific embodiments of the present invention have been described in detail, making it easy for those skilled in the art to understand. However, based on all the descriptions that have been made public, different modifications or substitutions can be made to those details, and all such changes are within the scope of protection of the present invention. The entire scope of the present invention is given by the appended claims and any equivalents thereof.

Claims

1. A primer composition for LAMP detection of small RNA virus in the intestines of cattle and sheep, comprising inner primers and outer primers. The inner primers consist of BooV-FIP and BooV-BIP to form an inner primer pair, and the outer primers consist of BooV-F3 and BooV-B3 to form an outer primer pair. The nucleotide sequences of BooV-FIP, BooV-BIP, BooV-F3 and BooV-B3 are shown in SEQ ID NO.1 - SEQ ID NO.4 respectively.

2. The primer composition according to claim 1, wherein: The molar ratio of the inner primers to the outer primers is 3:1 - 12:1, or the final concentration of the inner primers is 0.8 - 2.4 μmol / L and the final concentration of the outer primers is 0.1 - 0.3 μmol / L.

3. The primer composition according to claim 2, characterized in that: When the molar ratio of the inner primers to the outer primers is 8:1, the final concentration of the inner primers is 1.6 μmol / L and the final concentration of the outer primers is 0.2 μmol / L.

4. A LAMP detection kit for small RNA virus in the intestines of cattle and sheep, characterized in that: It includes a negative control and a reaction premix containing the primer composition described in any one of claims 1 - 3; it also includes a sealing liquid capable of sealing the LAMP detection, and a color reagent for visual determination of the LAMP detection result.

5. The bovine and sheep enteric picornavirus LAMP detection kit according to claim 4, characterized in that: In addition to the primer composition, the reaction premix further includes 10×Bst buffer, 8U / μL of Bst polymerase, 10 mM of dNTP, 100 mM of MgSO4 solution, 5 M of betaine and RNase-Free water; the sealing liquid is paraffin oil, and the color reagent is 2 mM of HNB solution; it also includes a positive control.

6. The LAMP detection kit for small RNA virus in cattle and sheep intestines according to claim 4, wherein: The primer composition is prepared into a primer mixture and then added to the reaction premix; wherein, the preparation of the primer mixture is: equal volumes of BooV-FIP, BooV-BIP, BooV-F3 and BooV-B3 are taken and mixed.

7. The LAMP detection kit for small RNA virus in cattle and sheep intestines according to claim 5, wherein: In each reaction tube, a reaction premix containing the primer composition is pre-loaded. The addition amounts of the components of the reaction premix are: 2.5 μL of 10×Bst buffer, 1 μL of 8U / μL of Bst polymerase, 3.5 μL of 10 mM of dNTP, 0.8 μL of 100 mM of MgSO4 solution, 4 μL of 5 M of betaine, 7 μL of RNase-Free water; equal volumes of BooV-FIP, BooV-BIP, BooV-F3 and BooV-B3 are taken to prepare a primer mixture and then 2 μL is added.

8. The LAMP detection kit for small RNA virus in cattle and sheep intestines according to claim 7, characterized in that: In each reaction tube, the reaction premix containing the primer composition further includes 2 mM of HNB solution, and the addition amount is 1.5 μL.

9. A method for LAMP detection of small RNA virus in the intestines of cattle and sheep, using the kit for LAMP detection of small RNA virus in the intestines of cattle and sheep described in any one of claims 4 - 8, to perform a closed and visual LAMP detection on a sample to be tested. The detection steps include template pretreatment, LAMP reaction and result determination; wherein, Template pretreatment: First, extract the RNA of the sample to be tested, and then reverse transcribe the RNA into cDNA. LAMP reaction: After adding the cDNA and 50 μL of paraffin oil to cover the liquid surface in the reaction premix in sequence, place it in a 64 °C closed LAMP reaction for at least 45 minutes; Result determination: If the LAMP reaction solution changes from light purple to cyan blue, the test result is judged as positive; if the LAMP reaction solution remains light purple all the time, the test result is judged as negative; The detection method does not include methods for the diagnosis and treatment of diseases.

10. The primer composition according to any one of claims 1-3, the kit for detecting bovine and sheep enteric picornavirus by LAMP according to any one of claims 4-8, and the application of the method for detecting bovine and sheep enteric picornavirus by LAMP according to claim 9 in the rapid detection of bovine and sheep enteric picornavirus.

Images