Aptamer of enrofloxacin and ciprofloxacin, enzyme sensor and application thereof
Through the modification of enrofloxacin and ciprofloxacin nucleic acid aptamers and the construction of enzyme sensors, the problem of detecting the residual amount of enrofloxacin and ciprofloxacin in the prior art was solved, and a high sensitivity specific recognition and detection effect was achieved.
Patent Information
- Application Number
- CN202510779060.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-12
- Publication Date
- 2025-07-18
- Estimated Expiration
- 2045-06-12
AI Technical Summary
The prior art lacks nucleic acid aptamers with high affinity for enrofloxacin and ciprofloxacin, making it difficult to effectively detect the residual amount of these two antibiotics in food.
By modifying existing nucleic acid aptamers, the obtained nucleic acid aptamers D1-2 of enrofloxacin and ciprofloxacin are optimized, and enzyme sensors are constructed in combination with auxiliary chains H1, H2, H3 and copper sulfate. DNA nanospheres are used to enhance the peroxidase activity of Cu2+, and specific identification and high sensitivity detection of enrofloxacin and ciprofloxacin are achieved.
The affinity of the modified nucleic acid aptamers for enrofloxacin and ciprofloxacin has been significantly improved, and the enzyme sensor has achieved high sensitivity detection and has a wide range of food safety monitoring application prospects.
Smart Images

Figure CN120330198A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a nucleic acid aptamer for enrofloxacin and ciprofloxacin, an enzyme sensor and its application, belonging to the technical field of nucleic acid aptamers. Background Art
[0002] Enrofloxacin (ENR) is an antibiotic with a broad antibacterial spectrum and strong antibacterial activity, and is widely used in the prevention and treatment of diseases caused by bacteria in aquaculture. Since part of ENR is metabolized by P450 in animals into ciprofloxacin (CIP), the sum of ENR and CIP is used as the final residue amount of ENR in food.
[0003] Using nucleic acid aptamers and enzyme sensors to detect the residues of ENR and CIP is one of the common methods. The core of this method is a nucleic acid aptamer that has high affinity for both enrofloxacin and ciprofloxacin. There are relatively few nucleic acid aptamers for enrofloxacin and ciprofloxacin reported in the prior art. Developing nucleic acid aptamers for enrofloxacin and ciprofloxacin with high affinity is one of the research hotspots. Summary of the Invention
[0004] In view of the above prior art, the present invention provides a nucleic acid aptamer for enrofloxacin and ciprofloxacin, an enzyme sensor and its application, belonging to the technical field of nucleic acid aptamers.
[0005] The present invention is achieved by the following technical solutions: A nucleic acid aptamer for enrofloxacin and ciprofloxacin, the nucleotide sequence of which is shown in SEQ ID NO.3.
[0006] The application of the nucleic acid aptamer for enrofloxacin and ciprofloxacin in detecting enrofloxacin and ciprofloxacin.
[0007] The application of the nucleic acid aptamer for enrofloxacin and ciprofloxacin in preparing reagents, reagent kits or enzyme sensors for detecting enrofloxacin and ciprofloxacin.
[0008] An enzyme sensor, comprising the following components: a nucleic acid aptamer for enrofloxacin and ciprofloxacin, auxiliary strand H1, auxiliary strand H2, auxiliary strand H3, copper sulfate and TMB chromogenic solution; wherein, the nucleotide sequence of the nucleic acid aptamer for enrofloxacin and ciprofloxacin is shown in SEQ ID NO.3, the nucleotide sequence of the auxiliary strand H1 is shown in SEQ ID NO.5, the nucleotide sequence of the auxiliary strand H2 is shown in SEQ ID NO.6, and the nucleotide sequence of the auxiliary strand H3 is shown in SEQ ID NO.7.
[0009] Further, the enzyme sensor consists of the following components: 10 μL of a nucleic acid aptamer solution of enrofloxacin and ciprofloxacin with a concentration of 2 μM; 20 μL of an auxiliary strand H1 solution with a concentration of 1 μM; 20 μL of an auxiliary strand H2 solution with a concentration of 1 μM; 20 μL of an auxiliary strand H3 solution with a concentration of 1 μM; 20 μL of a copper sulfate solution with a concentration of 1 mM; 80 μL of a TMB chromogenic solution.
[0010] Application of the enzyme sensor in detecting enrofloxacin and ciprofloxacin.
[0011] A method for simultaneously detecting enrofloxacin and ciprofloxacin, comprising the following steps: (1) Respectively take the standard solutions of ENR and CIP, add the nucleic acid aptamers of enrofloxacin and ciprofloxacin, and incubate at room temperature; then add auxiliary strand H1, auxiliary strand H2, and auxiliary strand H3, and react at room temperature; then add copper sulfate and shake to react; take the reaction mixture, add the TMB chromogenic solution, react for 5 min, take a photo with a smartphone to record the color of the microplate, identify the RGB values of the corresponding reaction wells, calculate the signal change rate, and plot the standard curve of ENR and the standard curve of CIP; wherein, the nucleotide sequences of the nucleic acid aptamers of enrofloxacin and ciprofloxacin are as shown in SEQ ID NO.3, the nucleotide sequence of auxiliary strand H1 is as shown in SEQ ID NO.5, the nucleotide sequence of auxiliary strand H2 is as shown in SEQ ID NO.6, and the nucleotide sequence of auxiliary strand H3 is as shown in SEQ ID NO.7; (2) Take the sample to be detected, add the nucleic acid aptamers of enrofloxacin and ciprofloxacin, and incubate at room temperature; then add auxiliary strand H1, auxiliary strand H2, and auxiliary strand H3, and react at room temperature; then add copper sulfate and shake to react; take the reaction mixture, add the TMB chromogenic solution, react for 5 min, take a photo with a smartphone to record the color of the microplate, identify the RGB values of the corresponding reaction wells, and calculate the signal change rate; (3) Substitute the signal change rate of the sample to be detected into the standard curve to calculate the concentrations of ENR and CIP in the sample to be detected.
[0012] Further, the specific operation of step (1) is as follows: Take 10 μL of the ENR standard solution, add 10 μL of the nucleic acid aptamer solution of enrofloxacin and ciprofloxacin with a concentration of 2 μM, and react at room temperature for 10 min; then add 20 μL each of the auxiliary strand H1 solution with a concentration of 1 μM, the auxiliary strand H2 solution with a concentration of 1 μM, and the auxiliary strand H3 solution with a concentration of 1 μM, and react at room temperature for 30 min; then add 20 μL of the copper sulfate solution with a concentration of 1 μM, and shake and react for 20 min; finally, take 20 μL of the reaction mixture, add 80 μL of the TMB chromogenic solution, react for 5 min, take a photo with a smartphone to record the color of the well plate, identify the RGB values of the corresponding reaction wells, and calculate the signal change rate |A0 - Ai| / A0; detect the ENR standard solution with different concentration gradients, and plot the standard curve of the signal change rate versus the ENR concentration; the concentration gradients of the ENR standard solution are: 0, 1.4 nM, 4.1 nM, 12.3 nM, 37.1 nM, 111.1 nM, 333.3 nM, 1000 nM; Take 10 μL of the CIP standard solution, add 10 μL of the nucleic acid aptamer solution of enrofloxacin and ciprofloxacin with a concentration of 2 μM, and react at room temperature for 10 min; then add 20 μL each of the auxiliary strand H1 solution with a concentration of 1 μM, the auxiliary strand H2 solution with a concentration of 1 μM, and the auxiliary strand H3 solution with a concentration of 1 μM, and react at room temperature for 30 min; then add 20 μL of the copper sulfate solution with a concentration of 1 μM, and shake and react for 20 min; finally, take 20 μL of the reaction mixture, add 80 μL of the TMB chromogenic solution, react for 5 min, take a photo with a smartphone to record the color of the well plate, identify the RGB values of the corresponding reaction wells, and calculate the signal change rate |A0 - Ai| / A0; detect the ENR standard solution with different concentration gradients, and plot the standard curve of the signal change rate versus the ENR concentration; the concentration gradients of the ENR standard solution are: 0, 1.4 nM, 4.1 nM, 12.3 nM, 37.1 nM, 111.1 nM, 333.3 nM, 1000 nM.
[0013] Further, the specific operation of step (2) is as follows: Take 10 μL of the sample to be tested, add 10 μL of the nucleic acid aptamer solution of enrofloxacin and ciprofloxacin with a concentration of 2 μM, and react at room temperature for 10 min; then add 20 μL of the auxiliary strand H1 solution with a concentration of 1 μM, 20 μL of the auxiliary strand H2 solution with a concentration of 1 μM, and 20 μL of the auxiliary strand H3 solution with a concentration of 1 μM respectively, and react at room temperature for 30 min; then add 20 μL of the copper sulfate solution with a concentration of 1 μM, and react with shaking for 20 min; finally, take 20 μL of the reaction mixture, add 80 μL of the TMB chromogenic solution, react for 5 min, take a photo with a smartphone to record the color of the well plate, identify the RGB values of the corresponding reaction wells, and calculate the signal change rate |A0 - Ai| / A0.
[0014] The nucleic acid aptamers of enrofloxacin and ciprofloxacin of the present invention are a split-type integral aptamer, which uses aptamer D1 with a certain affinity for ENR and CIP as the initial strand, and is optimized and modified by a new modification method (analyzing the binding of the aptamer to the target, finding the core binding domain, splitting the aptamer near the key bases, and connecting the 5'-end and 3'-end of the original aptamer to expose the binding sites at both ends of the new strand). The modified aptamer D1-2 has a higher affinity for the target, with a Kd value of 15 nM for enrofloxacin and a Kd value of 123 nM for CIP. Compared with aptamer D1, the affinity for enrofloxacin is increased by 133.3 times, and the affinity for ciprofloxacin is increased by 5.8 times, with remarkable effects.
[0015] The enzyme sensor of the present invention is constructed based on the principle that aptamer D1-2, auxiliary strand H1, auxiliary strand H2, and auxiliary strand H3 form a DNA nanosphere. The DNA nanosphere has a high capacity for Cu 2+ (the DNA nanosphere can provide more binding sites for Cu 2+ to further enhance the peroxidase activity of the Cu-based nanozyme), thereby enabling the specific recognition of ENR and CIP with high sensitivity. The enzyme sensor of the present invention has a wide application prospect in actual food safety monitoring, and the present invention opens up a new way for the detection of enrofloxacin and ciprofloxacin.
[0016] All terms and phrases used in the present invention have the general meanings well-known to those skilled in the art. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 : Schematic diagram of the secondary structure of aptamer D1, where a, b, and c respectively represent three splitting positions.
[0018] Figure 2:Schematic diagram of the molecular docking simulation results of aptamer D1 with ENR and CIP.
[0019] Figure 3 :Schematic diagram of the affinity detection results of aptamer D1 with ENR. Among them, the upper part represents the heat change when aptamer D1 binds to ENR, and the lower part represents the enthalpy change when aptamer D1 binds to ENR.
[0020] Figure 4 :Schematic diagram of the affinity detection results of aptamer D1 with CIP. Among them, the upper part represents the heat change when aptamer D1 binds to CIP, and the lower part represents the enthalpy change when aptamer D1 binds to CIP.
[0021] Figure 5 :Schematic diagram of the secondary structure of aptamer D1-1.
[0022] Figure 6 :Schematic diagram of the affinity detection results of aptamer D1-1 with ENR. Among them, the upper part represents the heat change when aptamer D1-1 binds to ENR, and the lower part represents the enthalpy change when aptamer D1-1 binds to ENR.
[0023] Figure 7 :Schematic diagram of the affinity detection results of aptamer D1-1 with CIP. Among them, the upper part represents the heat change when aptamer D1-1 binds to CIP, and the lower part represents the enthalpy change when aptamer D1-1 binds to CIP.
[0024] Figure 8 :Schematic diagram of the secondary structure of aptamer D1-2.
[0025] Figure 9 :Schematic diagram of the affinity detection results of aptamer D1-2 with ENR. Among them, the upper part represents the heat change when aptamer D1-2 binds to ENR, and the lower part represents the enthalpy change when aptamer D1-2 binds to ENR.
[0026] Figure 10 :Schematic diagram of the affinity detection results of aptamer D1-2 with CIP. Among them, the upper part represents the heat change when aptamer D1-2 binds to CIP, and the lower part represents the enthalpy change when aptamer D1-2 binds to CIP.
[0027] Figure 11 :Schematic diagram of the secondary structure of aptamer D1-3.
[0028] Figure 12:Schematic diagram of the affinity detection results of aptamer D1-3 and ENR. Among them, the upper part represents the heat change when aptamer D1-3 binds to ENR, and the lower part represents the enthalpy change when aptamer D1-3 binds to ENR.
[0029] Figure 13 :Schematic diagram of the affinity detection results of aptamer D1-3 and CIP. Among them, the upper part represents the heat change when aptamer D1-3 binds to CIP, and the lower part represents the enthalpy change when aptamer D1-3 binds to CIP.
[0030] Figure 14 :Signal response curve of ENR.
[0031] Figure 15 :Signal response curve of CIP.
[0032] Figure 16 :Standard curve of ENR.
[0033] Figure 17 :Standard curve of CIP.
[0034] Figure 18 :Schematic diagram of the signal change rate of 6 antibacterial drugs, where MIX represents the mixture of 6 antibacterial drugs. Detailed implementation manners
[0035] The present invention will be further described below in conjunction with embodiments. However, the scope of the present invention is not limited to the following embodiments. Those skilled in the art can understand that various changes and modifications can be made to the present invention without departing from the spirit and scope of the present invention.
[0036] The instruments, reagents, and materials involved in the following embodiments, unless otherwise specified, are all conventional instruments, reagents, and materials existing in the prior art and can be obtained through regular commercial channels. The experimental methods, detection methods, etc. involved in the following embodiments, unless otherwise specified, are all conventional experimental methods and detection methods existing in the prior art.
[0037] The present invention uses an isothermal titration microcalorimeter to determine the affinity of aptamers for targets. The isothermal titration microcalorimeter is the only technique that can simultaneously determine all binding parameters in a single experiment. The isothermal titration microcalorimeter can measure the affinity of binding partners in their natural state without modifying the binding partners through fluorescence labeling or immobilization techniques. By measuring the heat transfer during the binding process, the binding constant can be accurately determined. The specific measurement method is as follows: The aptamer is dissolved and diluted into a clear solution of a certain concentration and placed in a temperature-controlled sample cell, which is coupled to a reference cell through a thermocouple circuit. The enrofloxacin and ciprofloxacin sample solutions are placed in a syringe as ligands. The program set by the instrument is 25 drops of the sample solution, 2 μl per drop, a titration interval of 120 s, a temperature of 25 °C, and a stirring speed of 350 r / min. Fitting the obtained curve can yield the affinity constant, i.e., the Kd value.
[0038] Example 1 Optimization of the original aptamers of enrofloxacin and ciprofloxacin The nucleotide sequence of the original aptamers of enrofloxacin and ciprofloxacin - aptamer D1 is shown in SEQ ID NO.1 as follows (direction 5'-3'): ACTCGATTTGACAATGAAGATGGATGCTGTAGTTGATTG.
[0039] Use the online tool "the mfold web server" to predict the secondary structure of aptamer D1. The schematic diagram of the secondary structure of aptamer D1 is as Figure 1 shown.
[0040] Use the molecular docking simulation software Autodock to simulate the binding of the aptamer to the targets (ENR, CIP). The schematic diagrams of the molecular docking simulation results of aptamer D1 with ENR and CIP are as Figure 2 shown. Based on the clustering results and the principle of the lowest energy, the key sites of the interaction between aptamer D1 and the two targets are predicted to be G22, G23, G29, T30, A31, G32, T33.
[0041] Use an isothermal titration microcalorimeter to detect the affinity of aptamer D1 for ENR and CIP. The schematic diagram of the affinity detection result of aptamer D1 for ENR is as Figure 3 shown. The schematic diagram of the affinity detection result of aptamer D1 for CIP is as Figure 4 shown. The results show that the Kd value of aptamer D1 for ENR is 2000 nM, and the Kd value of aptamer D1 for CIP is 716 nM.
[0042] To obtain a more optimized aptamer, the aptamer D1 was subjected to splitting and integration transformation. According to the key base information obtained from molecular docking, three parts, a, b, and c, were selected for splitting (as shown by a, b, and c in Figure 1 ). After splitting, aptamer D1-1, aptamer D1-2, and aptamer D1-3 were obtained respectively. The schematic diagram of the secondary structure of aptamer D1-1 is shown in Figure 5 , the schematic diagram of the secondary structure of aptamer D1-2 is shown in Figure 8 , and the schematic diagram of the secondary structure of aptamer D1-3 is shown in Figure 11 .
[0043] The nucleotide sequence of aptamer D1-1 is shown in SEQ ID NO.2, as follows (direction 5'-3'): ATGCTGTAGTTGATTGACTCGATTTGACAATGAAGATGG.
[0044] The nucleotide sequence of aptamer D1-2 is shown in SEQ ID NO.3, as follows (direction 5'-3'): CTGTAGTTGATTGACTCGATTTGACAATGAAGATGGATG.
[0045] The nucleotide sequence of aptamer D1-3 is shown in SEQ ID NO.4, as follows (direction 5'-3'): GTAGTTGATTGACTCGATTTGACAATGAAGATGGATGCT.
[0046] The isothermal titration microcalorimeter was used to detect the affinity of aptamer D1-1, aptamer D1-2, and aptamer D1-3 with ENR and CIP. The schematic diagram of the detection result of the affinity between aptamer D1-1 and ENR is shown in Figure 6 , the schematic diagram of the detection result of the affinity between aptamer D1-1 and CIP is shown in Figure 7 , the schematic diagram of the detection result of the affinity between aptamer D1-2 and ENR is shown in Figure 9 , the schematic diagram of the detection result of the affinity between aptamer D1-2 and CIP is shown in Figure 10 , the schematic diagram of the detection result of the affinity between aptamer D1-3 and ENR is shown in Figure 12 , and the schematic diagram of the detection result of the affinity between aptamer D1-3 and CIP is shown in Figure 13As shown. The results show that the Kd values of aptamer D1-1, aptamer D1-2, and aptamer D1-3 for ENR are 428 nM, 15 nM, and 526 nM respectively, which are 4.7 times, 133.3 times, and 3.8 times higher than that of aptamer D1; the Kd values of aptamer D1-1, aptamer D1-2, and aptamer D1-3 for CIP are 259 nM, 123 nM, and 202 nM respectively, which are 2.8 times, 5.8 times, and 3.5 times higher than that of aptamer D1. The affinity of the modified aptamers for enrofloxacin and ciprofloxacin has been significantly improved, and the improvement effect of aptamer D1-2 is the most significant.
[0047] Example 2 Construction of Enzyme Sensor Through the optimization of Example 1, aptamer D1-2 with high affinity for enrofloxacin and ciprofloxacin was obtained. An enzyme sensor was constructed based on aptamer D1-2, including the following components: aptamer D1-2, auxiliary strand H1, auxiliary strand H2, auxiliary strand H3, copper sulfate, and TMB chromogenic solution; among them, the complementary sequence of aptamer D1-2 was designed for auxiliary strand H1. In addition, auxiliary strand H2 and auxiliary strand H3 are complementary to each other pairwise with auxiliary strand H1.
[0048] The nucleotide sequence of auxiliary strand H1 is shown in SEQ ID NO.5, as follows (direction 5'-3'): AGTACGCGTACTCATCCATCTTCATTGTCAAATCGAGTCAATCAACTACAG.
[0049] The nucleotide sequence of auxiliary strand H2 is shown in SEQ ID NO.6, as follows (direction 5'-3'): AGCTCGAGCTACACTCGCTCGCACGAGCTAAAGACAATGAAGATGGATG.
[0050] The nucleotide sequence of auxiliary strand H3 is shown in SEQ ID NO.7, as follows (direction 5'-3'): AGCTCGAGCTCTGTAGTTGATTGACTTCGTGCGAGCGAGTGT.
[0051] Specifically, the enzyme sensor consists of the following components (the dosage of each component below is the minimum dosage required for single sample detection): 10 μL of aptamer D1-2 solution with a concentration of 2 μM; 20 μL of auxiliary strand H1 solution with a concentration of 1 μM; 20 μL of auxiliary strand H2 solution with a concentration of 1 μM; 20 μL of auxiliary strand H3 solution with a concentration of 1 μM; 20 μL of copper sulfate solution with a concentration of 1 mM; 80 μL of TMB chromogenic solution (composed of 5 μL of TMB solution, 5 μL of H2O2 solution, and the balance of acetate buffer solution). The solvent used for each solution is ultrapure water.
[0052] The copper sulfate solution is prepared with anhydrous copper sulfate, and the anhydrous copper sulfate is purchased from Shanghai Hushi Analytical Instrument Co., Ltd.
[0053] The TMB solution is a 1% TMB solution purchased from Beijing Solarbio Science & Technology Co., Ltd., product number: T8120.
[0054] The H2O2 solution is 30% H2O2 purchased from Sinopharm Chemical Reagent Co., Ltd., product number: 10011208.
[0055] The concentration of the acetate buffer solution is 1 M and the pH is 5.0.
[0056] Example 3 Detection of ENR and CIP Using the Enzyme Sensor Detect ENR and CIP using the enzyme sensor constructed in Example 2, and the steps are as follows: (1) Detection of standard solutions Take 10 μL of ENR standard solution, add 10 μL of aptamer D1-2 solution, and react at room temperature for 10 min; then add 20 μL each of auxiliary strand H1 solution, auxiliary strand H2 solution, and auxiliary strand H3 solution, and react at room temperature for 30 min; then add 20 μL of copper sulfate solution and shake to react for 20 min; finally, take 20 μL of the reaction mixture, add 80 μL of TMB chromogenic solution, react for 5 min, take a photo with a smartphone to record the color of the well plate, identify the RGB value of the corresponding reaction well, and calculate the signal change rate |A0 - Ai| / A0. Detect standard solutions of different concentration gradients of ENR, and plot a standard curve of the signal change rate versus the ENR concentration; the concentration gradients of the ENR standard solution are: 0, 1.4 nM, 4.1 nM, 12.3 nM, 37.1 nM, 111.1 nM, 333.3 nM, 1000 nM.
[0057] According to the same method, detect standard solutions of different concentration gradients of CIP to obtain the spectrogram of the CIP standard product, as Figure 12As shown. The concentration gradients of the CIP standard solution are: 0, 1.4 nM, 4.1 nM, 12.3 nM, 37.1 nM, 111.1 nM, 333.3 nM, 1000 nM.
[0058] The ENR standard solution is prepared by the following method: Take the ENR standard product, dissolve it with an appropriate amount of 1M NaOH solution, add buffer solution, and prepare it to the required concentration.
[0059] The CIP standard solution is prepared by the following method: Take the CIP standard product, dissolve it with an appropriate amount of 1M NaOH solution, add buffer solution, and prepare it to the required concentration.
[0060] The buffer solution consists of the following components: 8 mM disodium hydrogen phosphate (Na2HPO4), 1360 mM sodium chloride (NaCl), 2 mM potassium dihydrogen phosphate (KH2PO4), and the balance is water, pH 7.2.
[0061] (2)Establishment of the standard curve The color intensity (RGB) of the ENR standard solution with different concentration gradients after reacting for 5 min is extracted by the smart phone to obtain the signal response curve of ENR, as Figure 14 shown.
[0062] The color intensity of the CIP standard solution with different concentration gradients after reacting for 5 min is extracted by the smart phone to obtain the signal response curve of CIP, as Figure 15 shown.
[0063] From Figure 14 、 Figure 15 it can be seen that when the target concentration is 0, the aptamer D1-2 binds to the auxiliary strand H1, and DNA nanospheres cannot be formed, resulting in a relatively small ability to amplify the peroxidase-like activity signal of Cu and a weak color intensity; as the target concentration increases, after the aptamer binds to the target, the more DNA nanospheres are formed by the self-assembly of the auxiliary strands H1, H2, and H3 being pulled closer, the ability to amplify the peroxidase-like signal of Cu is significantly enhanced, and the extracted RGB value increases with the increase of the target concentration.
[0064] Taking the lg value of the concentrations of ENR and CIP as the abscissa and the extracted color intensity as the ordinate, the standard curves of ENR and CIP are plotted. The standard curve of ENR is as Figure 16 shown, and the standard curve of CIP is as Figure 17 shown. After calculation, the linear range of the enzyme sensor is 1.4 - 1000 nM, and the detection limits are 342.1 pM (ENR) and 330.8 pM (CIP) respectively.
[0065] (3)Specificity evaluation of the enzyme sensor Specific experiments were carried out on norfloxacin (NOR), tetracycline (TC), oxytetracycline (OTC), chloramphenicol (CAP), enrofloxacin (ENR) and ciprofloxacin (CIP) with relatively high detection rates in aquatic products.
[0066] Norfloxacin, tetracycline, oxytetracycline, chloramphenicol, enrofloxacin and ciprofloxacin were separately taken and prepared into solutions with a concentration of 111.1 nM.
[0067] A mixed solution containing the above six antibacterial drugs was prepared, in which the concentrations of norfloxacin, tetracycline, oxytetracycline, chloramphenicol, enrofloxacin and ciprofloxacin were all 111.1 nM.
[0068] During the preparation, a 10 mM stock solution was first prepared with a solvent of 1 M NaOH solution; then it was diluted to 111.1 nM with the buffer solution in step (1) above.
[0069] Detect according to the detection method in step (1): Take 10 μL of the test solution, add 10 μL of the aptamer D1-2 solution, and react at room temperature for 10 min; then add 20 μL each of the auxiliary strand H1 solution, auxiliary strand H2 solution and auxiliary strand H3 solution, and react at room temperature for 30 min; then add 20 μL of the copper sulfate solution and shake and react for 20 min; finally, take 20 μL of the reaction mixture, add 80 μL of the TMB chromogenic solution, react for 5 min, take a photo with a smartphone to record the color of the well plate, identify the RGB value of the corresponding reaction well, and calculate the signal change rate |A0 - Ai| / A0. The signal change rate schematic diagrams of the six antibacterial drugs are as Figure 18 shown. As can be seen from the figure, obvious signals only appear when ENR or CIP is present, indicating that the enzyme sensor of the present invention has good specificity.
[0070] Example 4 Recovery evaluation of the enzyme sensor and simultaneous detection of ENR and CIP in aquatic products (1) The ENR standard solution and CIP standard solution were mixed at different concentration ratios (respectively: 0:1000 nM, 200 nM:800 nM, 500 nM:500 nM, 800 nM:200 nM, 1000 nM:0) to obtain 5 kinds of mixed solutions. The enzyme sensor constructed in Example 2 was used for analysis (the method is the same as that in Example 3), and the recovery rate and relative standard deviation (RSD) were calculated. The recovery evaluation information is shown in Table 1. As can be seen from Table 1, the enzyme sensor has a good recovery rate between [83.46%, 105.91%], and the RSD is less than 5%, indicating that the enzyme sensor of the present invention has high accuracy and repeatability.
[0071]
[0072] (2)Examine the Eriocheir sinensis and Litopenaeus vannamei purchased on the market Sample preparation: Take 4 g of muscle tissue from each sample (Eriocheir sinensis and Litopenaeus vannamei), mix them with 20 mL of acetonitrile solution containing 25 mM phosphoric acid respectively, homogenize for 5 minutes, and centrifuge at 4500 rpm for 20 minutes; collect the supernatant, centrifuge again at 4500 rpm for 20 minutes; take the supernatant and filter it through a 0.22 μm filter membrane to obtain Sample 1 and Sample 3.
[0073] Add the ENR stock solution and the CIP stock solution to Sample 1 to make the final concentration of ENR 200 nM and the final concentration of CIP 800 nM to obtain Sample 2.
[0074] Add the ENR stock solution and the CIP stock solution to Sample 3 to make the final concentration of ENR 500 nM and the final concentration of CIP 500 nM to obtain Sample 4.
[0075] Add the ENR stock solution and the CIP stock solution to Sample 3 to make the final concentration of ENR 800 nM and the final concentration of CIP 200 nM to obtain Sample 5.
[0076] The solvents of the ENR stock solution and the CIP stock solution are both 1 M NaOH solution.
[0077] Analyze Samples 1 - 5 using the enzyme sensor constructed in Example 2 (the method is the same as in Example 3), calculate the total concentration of ENR and CIP. At the same time, examine Samples 1 - 5 using HPLC. The test results of the enzyme sensor and HPLC are shown in Table 2. As can be seen from Table 2, both Sample 1 and Sample 3 are negative, while the spiked Samples 2, 4, and 5 are all positive, and the results of quantitative analysis are highly accurate with little deviation. The analysis results are consistent with the HPLC test results.
[0078]
[0079] Provide the above embodiments to those skilled in the art to fully disclose and describe how to implement and use the claimed embodiments, rather than to limit the scope disclosed herein. Modifications that are obvious to those skilled in the art will be within the scope of the appended claims.
Claims
1. An aptamer for enrofloxacin and ciprofloxacin, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.
3.
2. Use of the nucleic acid aptamer of enrofloxacin and ciprofloxacin according to claim 1 in the detection of enrofloxacin and ciprofloxacin.
3. Use of the nucleic acid aptamer of enrofloxacin and ciprofloxacin according to claim 1 in the preparation of a reagent, kit or enzyme sensor for detecting enrofloxacin and ciprofloxacin.
4. An enzyme sensor, characterized in that, It comprises the following components: nucleic acid aptamer of enrofloxacin and ciprofloxacin, auxiliary strand H1, auxiliary strand H2, auxiliary strand H3, copper sulfate and TMB chromogenic solution; wherein, the nucleotide sequence of the nucleic acid aptamer of enrofloxacin and ciprofloxacin is shown in SEQ ID NO.3, the nucleotide sequence of the auxiliary strand H1 is shown in SEQ ID NO.5, the nucleotide sequence of the auxiliary strand H2 is shown in SEQ ID NO.6, and the nucleotide sequence of the auxiliary strand H3 is shown in SEQ ID NO.
7.
5. The enzyme sensor according to claim 4, characterized in that, It consists of the following components: 10 μL of a nucleic acid aptamer solution of enrofloxacin and ciprofloxacin with a concentration of 2 μM; 20 μL of an auxiliary strand H1 solution with a concentration of 1 μM; 20 μL of an auxiliary strand H2 solution with a concentration of 1 μM; 20 μL of an auxiliary strand H3 solution with a concentration of 1 μM; 20 μL of a copper sulfate solution with a concentration of 1 mM; 80 μL of TMB chromogenic solution.
6. Use of the enzyme sensor according to claim 4 or 5 in the detection of enrofloxacin and ciprofloxacin.
7. A method for simultaneously detecting enrofloxacin and ciprofloxacin, characterized in that, It comprises the following steps: (1) Respectively take the standard solutions of ENR and CIP, add the nucleic acid aptamer of enrofloxacin and ciprofloxacin, and incubate at room temperature; then add auxiliary strand H1, auxiliary strand H2 and auxiliary strand H3, and react at room temperature; then add copper sulfate and shake to react; take the reaction mixture, add TMB chromogenic solution, react for 5 min, take a photo with a smartphone to record the color of the well plate, identify the RGB value of the corresponding reaction well, calculate the signal change rate, and draw the standard curve of ENR and the standard curve of CIP; wherein, the nucleotide sequence of the nucleic acid aptamer of enrofloxacin and ciprofloxacin is shown in SEQ ID NO.3, the nucleotide sequence of the auxiliary strand H1 is shown in SEQ ID NO.5, the nucleotide sequence of the auxiliary strand H2 is shown in SEQ ID NO.6, and the nucleotide sequence of the auxiliary strand H3 is shown in SEQ ID NO.7; (2) Take the sample to be detected, add the nucleic acid aptamer of enrofloxacin and ciprofloxacin, and incubate at room temperature; then add auxiliary strand H1, auxiliary strand H2 and auxiliary strand H3, and react at room temperature; then add copper sulfate and shake to react; take the reaction mixture, add TMB chromogenic solution, react for 5 min, take a photo with a smartphone to record the color of the well plate, identify the RGB value of the corresponding reaction well, and calculate the signal change rate; (3) Substitute the signal change rate of the sample to be detected into the standard curve to calculate the concentration of ENR and the concentration of CIP in the sample to be detected.
8. The method for simultaneously detecting enrofloxacin and ciprofloxacin according to claim 7, characterized in that, The specific operation of step (1) is: Take 10 μL of the ENR standard solution, add 10 μL of the nucleic acid aptamer solution of enrofloxacin and ciprofloxacin with a concentration of 2 μM, and react at room temperature for 10 min; then add 20 μL each of the auxiliary strand H1 solution with a concentration of 1 μM, the auxiliary strand H2 solution with a concentration of 1 μM, and the auxiliary strand H3 solution with a concentration of 1 μM, and react at room temperature for 30 min; then add 20 μL of the copper sulfate solution with a concentration of 1 μM, and shake and react for 20 min; finally, take 20 μL of the reaction mixture, add 80 μL of the TMB chromogenic solution, react for 5 min, take a photo with a smartphone to record the color of the microplate, identify the RGB value of the corresponding reaction well, and calculate the signal change rate |A0 - Ai| / A0; detect the ENR standard solution with different concentration gradients, and draw a standard curve of the signal change rate versus the ENR concentration; the concentration gradients of the ENR standard solution are: 0, 1.4 nM, 4.1 nM, 12.3 nM, 37.1 nM, 111.1 nM, 333.3 nM, 1000 nM; Take 10 μL of the CIP standard solution, add 10 μL of the nucleic acid aptamer solution of enrofloxacin and ciprofloxacin with a concentration of 2 μM, and react at room temperature for 10 min; then add 20 μL each of the auxiliary strand H1 solution with a concentration of 1 μM, the auxiliary strand H2 solution with a concentration of 1 μM, and the auxiliary strand H3 solution with a concentration of 1 μM, and react at room temperature for 30 min; then add 20 μL of the copper sulfate solution with a concentration of 1 μM, and shake and react for 20 min; finally, take 20 μL of the reaction mixture, add 80 μL of the TMB chromogenic solution, react for 5 min, take a photo with a smartphone to record the color of the microplate, identify the RGB value of the corresponding reaction well, and calculate the signal change rate |A0 - Ai| / A0; detect the ENR standard solution with different concentration gradients, and draw a standard curve of the signal change rate versus the ENR concentration; the concentration gradients of the ENR standard solution are: 0, 1.4 nM, 4.1 nM, 12.3 nM, 37.1 nM, 111.1 nM, 333.3 nM, 1000 nM.
9. The method for simultaneously detecting enrofloxacin and ciprofloxacin according to claim 7, wherein The specific operation of the step (2) is: take 10 μL of the sample to be tested, add 10 μL of the nucleic acid aptamer solution of enrofloxacin and ciprofloxacin with a concentration of 2 μM, and react at room temperature for 10 min; then add 20 μL each of the auxiliary strand H1 solution with a concentration of 1 μM, the auxiliary strand H2 solution with a concentration of 1 μM, and the auxiliary strand H3 solution with a concentration of 1 μM, and react at room temperature for 30 min; then add 20 μL of the copper sulfate solution with a concentration of 1 μM, and shake and react for 20 min; finally, take 20 μL of the reaction mixture, add 80 μL of the TMB chromogenic solution, react for 5 min, take a photo with a smartphone to record the color of the microplate, identify the RGB value of the corresponding reaction well, and calculate the signal change rate |A0 - Ai| / A0.
Citation Information
Patent Citations
Aptamer of enrofloxacin and preparation method and application thereof
CN104450725A
Aptamer and kit for detecting enrofloxacin and ciprofloxacin and application thereof
CN111004804A
Nucleic acid aptamer of enrofloxacin and ciprofloxacin and enzyme-linked aptamer sensor
CN116286836A
Nucleic acid aptamer specifically binding to enrofloxacin or ciprofloxacin
KR1020150003013A
Cited By
Aptamer TET-HeR of tetracycline and application thereof
CN120866331A
Nucleic acid aptamer tet-heR of tetracycline and application thereof
CN120866331B
Nucleic acid aptamer OUC-NOR7-2T of norfloxacin and application of nucleic acid aptamer OUC-NOR7-2T
CN122081335A