Method for preparing demethylmedicarpin compound by one-pot enzyme method

The one-pot enzymatic method is used to catalyze the conversion of 2'-Hydroxydaidzein to generate Demethylmedicarpin, which solves the problems of intermediate product isolation and enzyme catalytic inhibition in traditional methods, and achieves efficient, green and environmentally friendly synthesis, with high yield and high purity effects.

CN120330221APending Publication Date: 2025-07-18SOUTH CHINA BOTANICAL GARDEN CHINESE ACADEMY OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510481555.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-17
Publication Date
2025-07-18

AI Technical Summary

Technical Problem

In the prior art, there are few researches on the synthesis of Demethylmedicarpin, which has become a bottleneck in the biosynthesis of photolicorice. In addition, traditional methods have difficulties in isolating intermediate products and product inhibition of enzyme catalytic system.

Method used

The one-pot enzyme method was used to catalyze 2'-Hydroxydaidzein to generate Demethylmedicarpin using flavonoid reductase GgIFR, vestibular lactone reductase GgVR and spandanane synthase GgPTS in the presence of cofactor NADPH, and these enzymes were expressed through recombinant plasmids and catalytic conversion was achieved in the one-pot preparation process.

Benefits of technology

The synthesis of Demethylmedicarpin with high yield, simple operation, low waste emission and high purity is achieved, avoiding the problems of intermediate product separation and product inhibition of enzyme catalytic system, and providing an efficient, green and environmentally friendly synthesis method.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330221A_ABST
    Figure CN120330221A_ABST
Patent Text Reader

Abstract

The invention provides a method for preparing a red sandalane compound Demetylmedicarpin by a one-pot enzyme method. The method comprises the following steps of: preparing demetylmedicarpin by a one-pot enzyme method; the method comprises the following steps: by taking 2 '-Hydroxydaidzein as a substrate, in the presence of an auxiliary factor NADPH (Nicotinamide Adenine Dinucleotide Phosphate), carrying out catalytic reaction on flavonoid reductase GgIFR, vestibular lactone reductase GgVR and pterocarpan synthetase GgPTS together to generate Demodemedicarpin. The synthesis method disclosed by the invention is economical, efficient, green and environment-friendly, and the purity of the synthesized Demodemedicarpin is high. The method provided by the invention is a whole enzyme method catalytic conversion method, conditions are mild and safe, meanwhile, a one-pot preparation process is adopted, the steps are simple, and the problem of separation of intermediate products and the problem of product inhibition of an enzyme catalysis system are avoided.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the fields of plant molecular biology and plant biotechnology, and particularly relates to a method for preparing the pterocarpan compound Demethylmedicarpin by a one-pot enzymatic method. Background Art

[0002] Glabridin, an isoflavanoid compound, is a characteristic compound of Glycyrrhiza glabra. Glabridin is known as the "whitening gold" and has a powerful whitening function. In addition, Glabridin also has a wide range of pharmacological properties, including anti-inflammatory, anti-cancer, antibacterial, anti-osteoporosis, regulating blood lipid and blood sugar levels, and neuroprotective activities. At present, the acquisition of Glabridin mainly relies on extraction from the roots of Glycyrrhiza glabra. However, the wild licorice resources are severely over-exploited, the distribution areas of wild medicinal species are gradually shrinking, and the artificially cultivated licorice is difficult to meet the high-yield requirements for production. In recent years, with the continuous development of science and technology, including the improvement of analytical tools, the continuous upgrading of genome mining and engineering strategies, and the progress of microbial culture, the difficulties in obtaining natural products are being gradually solved and new opportunities are being opened up. The industrial total synthesis of more and more complex natural products has been realized, which undoubtedly provides a highly efficient and indispensable sustainable production method for the future Glabridin market.

[0003] Simmler et al. (2013) proposed a hypothesis in their review that the synthesis of Glabridin is closely related to the synthesis of pterocarpan compounds. As an important class of isoflavone derivatives, pterocarpan compounds are widely distributed in leguminous plants and play a key role in the plant defense system. Among them, Medicarpin (3-Hydroxy-9-methoxypterocarpan), as a typical phytoalexin, is produced through the biosynthetic pathway in response to pathogen infection in various plants (such as alfalfa, licorice), and it exerts antifungal activity by inhibiting fungal hyphal growth, spore germination and other mechanisms. Demethylmedicarpin (3,9-Dihydroxypterocarpan), which is structurally similar to Medicarpin, is considered to be a precursor of Glabridin biosynthesis, and it may be converted into Glabridin under the catalysis of soybean isopentenyltransferase GmG4DT and pterocarpan reductase. However, there are few studies on the synthesis of Demethylmedicarpin at present, which has become a bottleneck in the research on Glabridin biosynthesis. Summary of the Invention

[0004] The first object of the present invention is to provide a one-pot enzymatic method for preparing the pterocarpan compound Demethylmedicarpin. The method provided by the present invention is a method of whole-enzymatic catalytic conversion, with mild and safe conditions. At the same time, the method of the present invention adopts a one-pot preparation process, which has simple steps and avoids the problems of intermediate product separation and product inhibition of the enzymatic catalytic system. The one-pot enzymatic process for preparing Demethylmedicarpin provided by the present invention has the characteristics of high yield and great application value and market prospects.

[0005] The specific technical solution of the present invention is as follows:

[0006] The present invention first provides flavonoid reductase GgIFR, vestitone reductase GgVR or pterocarpan synthase GgPTS. For the flavonoid reductase GgIFR, the nucleic acid sequence of its encoding gene is as shown in SEQ ID NO.1. For the vestitone reductase GgVR, the nucleic acid sequence of its encoding gene is as shown in SEQ ID NO.2. For the pterocarpan synthase, the nucleic acid sequence of its encoding gene is as shown in SEQ ID NO.3.

[0007] The present invention also provides a one-pot enzymatic method for preparing the pterocarpan compound Demethylmedicarpin, which includes the following steps: using 2'-Hydroxydaidzein (HDAI) as a substrate, in the presence of the cofactor NADPH, flavonoid reductase, vestitone reductase and pterocarpan synthase jointly carry out a catalytic reaction to generate Demethylmedicarpin.

[0008] Preferably, the concentration of the substrate HDAI is 400 μM, and the concentration of the cofactor NADPH is 8 mM.

[0009] Preferably, the addition amount of GgIFR is 10 - 20 μg / 100 μL, the addition amount of GgVR is 10 - 20 μg / 100 μL, and the addition amount of GgPTS is 10 - 20 μg / 100 μL.

[0010] Preferably, the buffer solution for the catalytic reaction is 100 mM phosphate buffer (pH 6.0).

[0011] Preferably, the temperature of the catalytic reaction is 30 °C, and the time of the catalytic reaction is 24 h.

[0012] Preferably, after the catalytic reaction is completed, ethyl acetate is added for extraction, and the combined extraction solution is concentrated to dryness to obtain Demethylmedicarpin crystals.

[0013] Preferably, the concentration temperature is controlled at 30 - 45 °C, and the concentration time is 1 - 3 h.

[0014] The present invention also provides methods for preparing the recombinant flavonoid reductase GgIFR, recombinant vestitone reductase GgVR, and recombinant pterocarpan synthase GgPTS of the above-mentioned Glycyrrhiza glabra:

[0015] 1) Respectively construct the GgIFR gene, GgVR gene, and GgPTS gene derived from Glycyrrhiza glabra onto the vector pColdII to obtain the recombinant plasmids pColdII-GgIFR, pColdII-GgVR, and pColdII-GgPTS;

[0016] 2) Respectively transform the above recombinant plasmids into Escherichia coli BL21 competent cells to obtain recombinant expression strains;

[0017] 3) Inoculate a single colony of the above recombinant expression strain into a liquid LB medium containing ampicillin resistance and culture overnight at 37°C; inoculate the cultured product obtained after activation into a liquid LB medium containing ampicillin resistance and culture with shaking at 37°C until the OD600 reaches 0.6, add IPTG with a final concentration of 0.5 mM, and induce culture at 16°C for 16 h; centrifuge to collect the bacterial cells, break the cell walls by ultrasonic treatment, and after purification, protein solutions of the recombinant flavonoid reductase GgIFR, recombinant vestitone reductase GgVR, and recombinant pterocarpan synthase GgPTS are respectively obtained.

[0018] The present invention has the following technical characteristics:

[0019] The catalytic route design of the method for preparing the pterocarpan compound Demethylmedicarpin by one-pot enzymatic method of the present invention is novel, and it has the advantages of simple operation, high yield, and small discharge of three wastes in production.

[0020] The synthesis method of the present invention is economical, efficient, green, and environmentally friendly, and the synthesized Demethylmedicarpin has high purity. The method provided by the present invention is a method of catalytic conversion by whole-enzymatic method, with mild and safe conditions. At the same time, the method of the present invention adopts a one-pot preparation process, with simple steps, and avoids the problems of separation of intermediate products and product inhibition of the enzymatic catalytic system. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is the liquid phase diagram of Demethylmedicarpin catalytically generated in Example 4 of the present invention.

[0022] Figure 2 It is the high-resolution mass spectrum diagram of Demethylmedicarpin catalytically generated in Example 4 of the present invention.

[0023] Figure 3 It is the catalytic reaction diagram of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0024] For ease of understanding the present invention, the present invention will be described more comprehensively below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, these embodiments are provided to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0025] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the technical field to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0026] For the experimental methods without specific conditions noted in the following examples, they are generally in accordance with conventional conditions, such as those described in Molecular Cloning: A Laboratory Manual (2013) by Green and Sambrook et al., or in accordance with the conditions recommended by the manufacturer. All common chemical reagents used in the examples are commercially available products.

[0027] In some embodiments of the present invention, a flavonoid reductase GgIFR, a vestitone reductase GgVR, and a pterocarpan synthase GgPTS of Glycyrrhiza glabra are disclosed. The nucleotide sequence of the GgIFR gene is shown as SEQ ID NO.1, the nucleotide sequence of the GgVR gene is shown as SEQ ID NO.2, and the nucleotide sequence of the GgPTS gene is shown as SEQ ID NO.3.

[0028] SEQ ID NO.1

[0029] ATGGCCGCGGAAAACAAAATCCTCATCCTCGGACCCACCGGAGCAATTGGAAGACACATAGTGTCGGCAGGTGTAAAAGCAGGAAATCCCACATTCGCACTGGTTAGGAAGACCACTACTGGCCCTGTTAACAAGCCAAAGCTGATTACAGCTGCTAATCCTGAAAGCAAGGAAGAACTCCTTGAGAGTTTCCAAAACGCTGGAGTTATTCTGCTCGAGGGTGATATAAATGACCATGAGAGTCTGGTGAAGGCAATCAAGCAAGTTGATGTTGTGATCTGTGCAACAGGTAGACTACTGATAGATGACCAGGTTAAGATCATAGCAGCAATCAAAGAAGCTGGAAATGTCAAGAGATTCTTCCCATCTGAGTTTGGGCTAGACGTGGACCGTCACGATTCAGTGGAGCCAGTGAGAGAAGTTTTCGAGGATAAAGCAAGAATCCGAAGAGTGATTGAAGCCGAAGGAGTTCCTTACACCTACCTCTGTTGCCATGCCTTTACCGGTTACTTCTTGCGTAACTTGGCACAACTCGATGCCACTGTTCCTCCGAGGGACAAGGTTGTCATTCTTGGAGATGGAAATGTCAAAGGAGCTTATGTGACTGAGGCTGATGTGGGGACTTATACCATCAGAGCAGCAAATGACCCCAGGACCCTGAACAAGGCCGTTCACATAAGACTCCCTGCTAATTATTTGACCGCAAACGAGGTTGTTTCCATGTGGGAGAAGAAGATTGGGAAGACTCTTGAGAAAACTTATGTTCCAGAGGAAAAAGTTCTCAAGGACATTCAGGAGTCACGGTTCCCTCATAACTACCTATTGGCATTGTACCACTCACAGCAGATAAAGGGAGATGCAGTGTATGAGATTGACCCTGCCAAAGACGTTGAGGCTTATGATTTGTATTCTGACGTGAAATACACCACCGCCGACGAATATTTGAATCAGTTTGTTTAA

[0030] SEQ ID NO.2

[0031] ATGGCAACGAGAGGTAGTAAGAAGGTGTGCGTGACTGGTGCTGGAGGCTTTGTAGCCTCTTGGTTTGTTAAGCTTCTCCTTTCCAAAGGATACATTGTCCATGGAACAGTCAGAGAACCTGGTAGTCAGAAATATGAACACTTGCTGAAATTGGAAAGAGCTTCTGAGAACCTTACACTCTTCAAGGCTGATCTCTTGAATTACCAATCTGTTTACTCCGCAATTGTTGGATGCAGTTCAGTTTTCCATGTTGCTAGCCCTGTCCCCTCAACTGTTTCATCCAATCCCGAGGTAGAAGTGATTGAGCCTGCAGTGAAGGGAACTGCTAATGTACTTGAAGCTTCTCTTGAAGCTAAAGTGGAACGGGTTGTCTTTGTATCATCTGAAGCTGCTATTTGCATGACCCCTAATTTGCCAAAGGATAAAGTGATCGATGAGTCCTATTGGTCTGACAAAGAGTATTGCAGAAAAACTAAGAACTGGTATTGTTTGTCCAAGACAGAAGCAGAGGAGCAGGCCCTGGACTTTGCAAAAAGAACTGGGCTTAGTGTGGTAAGCATTTGTCCTACCGTTGTGTGGGGACCAATTTTACAGTCAACCACTAATGCAAGTAGCTTGATTCTCCTCAAACTTTTAAAAGGTTGTGACTCATTGGAGAATAAGCTTCGTTGGATAGTAGATGTACGAGATCTAGTTGATGCAATACTTTTGGCTTATGAGAAGCATGAGGCAGAAGGGAGATACATATGCACTTCACATGCTATCAACACAAGGGATTTGGTGGAGAAATTAAAGAGTGTATATCCACATGACAAGTACCCGACTAACTATACTGAGGTGGATGATTACAGAATGTTGAGCTCAGAGAAACTGCAAAGGTTGGGTTGGAAGTACAGGCCACTGGAGGAAACACTCATTGATTCTGTTGAGAGCTATAAGAAGGCTGGACTTTTGCAATCAGAATAA

[0032] SEQ ID NO.3

[0033] ATGGCCAAATCCACAGCTTCCGCAACATTTTTCACCTCCCTGATCCTCCTTTTCCTCTTGCTCTCCGTCGTCACGGCCACATACTATCAAAGCATGTCCCCAACAATGTTGGGTTTCCAAGAAGAGAAGTTCACCCACCTTCACTTCTACTTCCACGACGTCGTGACGGGCCCAAAGCCGAGCATGGTGATAGTTGCCGAGCCCAACGGAAAGGCCAAGAACTCACTTCCGTTCGGGACTGTGGTTGCGATGGACGACCCGTTGACGGTTGGGCCGGAGAGTGACTCCAAGCTGGTGGGTAAGGCCCAAGGGATTTACACCTCTATATCGCAAGAGGAGATGGGGCTGATGATGGTGATGACCATGGCGTTCTCGGATGGAGAGTTTAATGGGAGCACGCTCAGCATACTTGCCAGGAACATGATCATGAGTGAGCCTGTGAGGGAAATGGCCATCGTTGGTGGGACCGGGGCTTTCCGTCTCGCACGTGGGTATGCTCAGGCCAAGTTTTATTCTGTGGATTTCACCAAAGGAGATGCCATCGTGGAATACGACATTTTCGTATTCCATTACTAG

[0034] It should be understood that, without affecting the structures and activities of the GgIFR, GgVR and GgPTS encoded proteins of Glycyrrhiza glabra var. glandulifera, various substitutions, deletions or additions of one or more amino acids, or terminal modifications to the amino acid sequences of the above-mentioned GgIFR, GgVR and GgPTS proteins also fall within the protection scope of the present invention.

[0035] In some other embodiments of the present invention, a method for preparing the pterocarpan compound Demethylmedicarpin by a one-pot enzymatic method is disclosed.

[0036] The expression vector is obtained by effectively ligating the flavonoid reductase GgIFR, vestitone reductase GgVR, and pterocarpan synthase GgPTS encoding genes of Glycyrrhiza glabra onto the expression vector. The expression vector includes viral vectors (including adenovirus vectors, retroviral vectors, or adeno-associated virus vectors), plasmids, phages, phagemids, cosmids, F-cosmids, phages, or artificial chromosomes (including bacterial artificial chromosomes BAC, phage P1-derived vectors PAC, yeast artificial chromosomes YAC, or mammalian artificial chromosomes MAC); preferably, the expression vector is a plasmid; more preferably, the plasmid is pColdII.

[0037] The transformed cells include bacterial cells, fungal cells (including yeast), or plant cells; among them, the bacterial cells include Escherichia, Agrobacterium, Bacillus, Streptomyces, Pseudomonas, or Staphylococcus. Preferably, the bacterial cells are Escherichia coli (such as BL21).

[0038] In some other embodiments of the present invention, a one-pot enzymatic method for preparing the pterocarpan compound Demethylmedicarpin is disclosed. The method includes: using HDAI as a substrate, in the presence of the cofactor NADPH, the recombinant flavonoid reductase catalyzes the conversion of HDAI to THIF; the THIF is catalyzed to convert to THIFL in the presence of the recombinant vestitone reductase and the cofactor NADPH; the THIFL undergoes a catalytic reaction in the presence of the recombinant pterocarpan synthase to convert to Demethylmedicarpin.

[0039] In some of the embodiments, the concentration of the substrate HDAI is 400 μM, and the concentration of the cofactor NADPH is 8 mM; the addition amount of the recombinant GgIFR is 10 - 20 μg, the addition amount of the recombinant GgVR is 10 - 20 μg, and the addition amount of the recombinant GgPTS is 10 - 20 μg; the buffer for the catalytic reaction is 100 mM phosphate buffer (pH 6.0); the temperature of the catalytic reaction is 30°C, and the time of the catalytic reaction is 24 h; after the catalytic reaction is completed, ethyl acetate is added for extraction, and the combined extract is concentrated to dryness to obtain Demethylmedicarpin crystals; the concentration temperature is controlled at 30 - 45°C, and the concentration time is 1 - 3 h.

[0040] The materials, reagents, carriers, kits, etc. used in the following embodiments of the present invention can be purchased commercially from companies without special instructions. The PCR amplification reaction Marker was purchased from Beijing Jinsha Biotechnology Co., Ltd. (Catalog No. SM811-500), the high-fidelity enzyme for PCR amplification reaction was purchased from TaKaRa Co., Ltd. (Catalog No. R045B), the Taq enzyme for PCR amplification reaction was purchased from Vazyme Co., Ltd. (Catalog No. P222-03), the Infusion ligase was purchased from CISTRO Co., Ltd. (Catalog No. E0201S), and the restriction endonucleases were all purchased from NEB Co., Ltd. The competent cells of Escherichia coli DH5α and BL21 used were prepared by the well-known methods in the art.

[0041] The present invention will be further described below in conjunction with specific embodiments and drawings.

[0042] Example 1 Construction of a full-length cDNA library of Glycyrrhiza glabra

[0043] Take the roots of two-year-old Glycyrrhiza glabra, and use the RNA extraction kit HiPure Plant RNA Mini Kit (Magen Co., Catalog No.: R4151-03C) to extract the total RNA from the roots. Use a nucleic acid analyzer to detect the RNA concentration and run electrophoresis to verify the RNA quality. Then, take the total RNA for reverse transcription reaction, and use the reverse transcription kit MonScript TM RTIII All-in-One Mix with dsDNase (Monad Co., Catalog No.: MR05101M).

[0044] The specific operation steps are as follows:

[0045] 1. RNA extraction

[0046] (1) Grind the roots of Glycyrrhiza glabra into fine powder with liquid nitrogen. Weigh 50-100 mg of the powder into a 2 mL pre-cooled centrifuge tube, and immediately add 750 μL of Buffer PRC1 / β-ME to the sample, and vortex at high speed for 15-30 s to disperse the sample.

[0047] (2) Incubate in a water bath at 55 °C for 5 min. At room temperature, centrifuge at 14,000 × g for 5 min.

[0048] (3) Install the gDNA filtration column in a 2 mL collection tube. Transfer 700 μL of the supernatant to the filtration column. Centrifuge at 13,000 xg for 2 min, and discard the gDNA filtration column.

[0049] (4) Add an equal volume of Buffer PRC2 to the filtrate. Pipette up and down 3 - 5 times, and place the HiPure RNA Mini Column in a 2 mL collection tube. Transfer ≤700 μL of the mixture to the column. Centrifuge at 12,000 x g for 30 s, discard the filtrate, and place the column back into the collection tube. (If the mixture exceeds 700 μL) Transfer the remaining mixture to the column. Centrifuge at 12,000 x g for 60 s, discard the filtrate, and place the column back into the collection tube.

[0050] (5) Add 500 μL of Buffer RW1 to the column. Centrifuge at 10,000 x g for 60 s, discard the filtrate, and place the column back into the collection tube.

[0051] (6) Add 500 μL of Buffer RW2 to the column and centrifuge at 12,000 x g for 60 s. Discard the filtrate and place the column back into the collection tube.

[0052] (7) Centrifuge at 12,000 x g for 2 min. Transfer the column to a 1.5 mL centrifuge tube. Add 50 μL of RNase Free Water to the center of the column membrane. Let it stand at room temperature for 2 min. Centrifuge at 12,000 x g for 1 min. Discard the column and store the RNA at -80 °C.

[0053] 2. Reverse transcription of RNA into cDNA

[0054] Use MonScript TM RTIII All-in-One Mix with dsDNase to reverse transcribe RNA into cDNA. The reverse transcription system is as follows: 1 μg of template RNA, 4 μL of 5×MonScript TM RTIII All-in-One Mix, 1 μL of MonScript TM dsDNase, add Nuclease-Free Water to make up to 20 μL. Mix the mixture and centrifuge briefly, incubate at 37 °C for 2 min to remove genomic DNA contamination; incubate at 55 °C for 15 min; after the reaction, incubate at 85 °C for 5 min to terminate the reaction. Measure the concentration of the obtained cDNA using a nucleic acid analyzer and store it at -20 °C.

[0055] Example 2: Cloning, construction of prokaryotic expression vector and overexpression vector of GgIFR, GgVR and GgPTS genes

[0056] Using Glycyrrhiza glabra root cDNA (diluted to about 100 ng / ul) as a template, design forward and reverse primers according to the existing Glycyrrhiza glabra genomic sequence to clone the CDS sequences of GgIFR, GgVR and GgPTS genes in Glycyrrhiza glabra. The primers are shown in Table 1.

[0057] Table 1

[0058]

[0059] Using DNA high-fidelity enzyme ( Max) for PCR amplification, the PCR reaction system is as follows: 1 ng of DNA template, 25 μL of 2×PrimeSTAR Max Premix, 1 μL of forward primer, 1 μL of reverse primer, add ddH2O to 50 μL. PCR amplification conditions: 98°C for 2 min; 98°C for 10 s, 55 - 58°C for 15 s, 72°C for 1 min, 33 cycles; 72°C for 3 min; hold at 6°C.

[0060] Perform 1% agarose gel electrophoresis analysis on the PCR products, recover the target bands of the products, and a gel DNA recovery kit (Magen, catalog number: D2111-03) can be used.

[0061] Using Fast DNA Assembly Mix homologous recombination cloning enzyme, ligate the target fragments of the GgIFR, GgVR, and GgPTS genes obtained above with the prokaryotic expression vector pColdII plasmid digested with double enzymes at 55°C for 15 min. Transform the ligation solution into competent DH5α. After culturing for 12 h, pick monoclonal colonies from the LB plate with Amp resistance, and use Rapid Taq MasterMix (Vazyme, catalog number: P222-03) for bacterial liquid PCR identification. The PCR reaction system is as follows: 1 μL of bacterial liquid, 5 μL of Rapid Taq Master Mix, 0.5 μL of vector forward primer, 0.5 μL of gene reverse primer, add ddH2O to 10 μL. Reaction conditions: 95°C for 3 min; 95°C for 15 s, 55°C for 15 s, 72°C for 15 s, 33 cycles; 72°C for 5 min; hold at 6°C. Monoclonal colonies with band sizes meeting the expectations are cultured in liquid to extract plasmids and then sent for sequencing (pColdII-F / R) as the sequencing primers. After correct sequencing, the pColdII recombinant prokaryotic expression vectors are constructed and named pColdII-GgIFR, pColdII-GgVR, and pColdII-GgPTS.

[0062] Example 3 Induced Expression of Engineered Bacteria

[0063] 1. Protein Expression

[0064] The prokaryotic expression vectors pColdII-GgIFR, pColdII-GgVR, and pColdII-GgPTS plasmids were introduced into Escherichia coli BL21 by heat shock transformation method. The cells were cultured overnight at 37°C. The next day, single colonies were picked from the Amp-resistant plate and inoculated into 1 mL of LB (50 mg / L Amp) liquid medium and cultured at 37°C with 200 rpm for 12 h. Then, they were inoculated into 200 mL of LB (50 mg / L Amp) liquid medium at a ratio of 1:100 and cultured at 37°C with 200 rpm until the 600 OD value reached 0.6 - 0.8. After adding 0.5 mM IPTG, the cells were ice-bathed in an ice-water mixture for 30 min, and then cultured in a shaker at 16°C with 180 rpm for 12 - 16 h.

[0065] 2. Protein purification

[0066] The cells were collected by centrifugation at 4°C, resuspended with 20 mL of pre-cooled Lysis buffer, and operated on ice. After adding 200 μL of PMSF (100 mM), the cells were sonicated at 200 W, with 3 s on and 3 s off for a total of 30 min. The sonicated cells were centrifuged at 4°C at 4000 x g for 20 min, and the supernatant was filtered through a 0.45 μm hydrophilic polyethersulfone filter membrane (PALL Corporation, catalog number: PN4614). The filtered supernatant was added to a protein purification column containing 1 mL of Ni-NTA resin and incubated at 200 rpm and 4°C for 1 h to bind the protein to the Ni-NTA resin.

[0067] The protein purification steps were carried out on ice. First, the protein solution was allowed to flow out, and then the Wash buffer containing 30 mM imidazole was used to elute the miscellaneous proteins. Then, the target protein with His-tag was eluted with the Eulation buffer containing 250 mM imidazole. The protein was detected with Coomassie Brilliant Blue. The collection started when the color turned blue and continued until the color no longer changed. The collected target protein solution was added to a 10 KDa ultrafiltration centrifugal tube and centrifuged at 4000 x g and 4°C for 10 - 30 min. When the protein solution was left with only 1 mL, 1 mL of Desalt buffer was added and centrifuged again. This was repeated 3 - 4 times, and 1 mM DTT was added in the last time. The concentrated and desalted target protein was collected, aliquoted into 1.5 mL centrifuge tubes at 200 μL each, and the protein concentration was measured using the Bradford method. The protein was stored at -80°C for later use.

[0068] 3. SDS-Polyacrylamide gel electrophoresis for protein detection

[0069] Dilute the protein sample to an appropriate concentration, add 5x SDS-PAGE loading buffer, boil it in a metal bath at 98°C for 10 min, centrifuge at 12,000 rpm for 1 min, and then 10 μL can be taken for SDS-PAGE gel electrophoresis; after the electrophoresis is completed, carefully remove the gel, put it into Coomassie Brilliant Blue R250 staining solution, place it on a shaker, and stain at room temperature for more than 2 h. After the staining is completed, take out the gel and place it in the decolorizing solution, decolorize it on the shaker for 12 h, and change the decolorizing solution several times during this period.

[0070] Thus, the enzymes GgIFR, GgVR, and GgPTS are obtained.

[0071] Example 4 One-pot enzymatic detection

[0072] 1. In vitro enzyme activity reaction

[0073] Using HDAI as the substrate, add the purified enzymes GgIFR, GgVR, and GgPTS at one time, and detect the enzyme activity results. The 100 μL enzyme activity reaction system is: 100 mM phosphate buffer (pH = 6.0), 8 mM NADPH, 400 μM substrate HDAI, 10 - 20 μg recombinant GgIFR, 10 - 20 μg recombinant GgVR, 10 - 20 μg recombinant GgPTS. Start timing from the addition of the substrate HDAI, react at 30°C for 24 h, and add ethyl acetate to terminate the reaction. The negative control NC is the enzyme activity reaction of GgIFR, GgVR, and GgPTS after being inactivated at 98°C for 10 min. After the reaction solution passes through a 0.22 μm nylon organic filter membrane, HPLC or UGPLC-MS / MS analysis is carried out.

[0074] 2. Analysis of enzyme activity products

[0075] HPLC analysis: Instrument: LC-2030C, SHIMADZU Corporation; Chromatographic column: C18 (4.6×250 mm, 5 μm, SHIMADZU Corporation). The column temperature is 40°C, the injection volume is 10 μL, and the flow rate is 1 mL / min. The gradient elution conditions are: methanol (A), 0.1% formic acid in water (B) (0 - 7 min, 30% - 33% B; 7 - 9 min, 33%; 9 - 13 min, 33% - 55% B; 13 - 15 min, 55% B, 15 - 27 min, 55% - 90% B, 27 - 29 min, 90% B, 29 - 31 min, 90 - 30% B, 31 - 25 min, 30% B). The detection wavelength is 280 nm.

[0076] LC-MS analysis: To determine the reaction products, further LC-MS analysis was performed. An ultra-high performance liquid chromatography-mass spectrometry (UHPLC-MS) instrument (Orbittrap Elite, Thermo) was used, and the UHPLC column was an ACQUITY UPLC HSS T3 column (100 mm × 2.1 mm, 1.8 μm, Thermo).

[0077] The UHPLC conditions were as follows: Phase A was methanol, Phase B was 0.1% formic acid in water, the column temperature was 40 °C, the injection volume was 1 μL, the flow rate was 0.3 mL / min, and the gradient elution conditions were: 0 - 7 min, 30% - 33% B; 7 - 9 min, 33%; 9 - 13 min, 33% - 55% B; 13 - 15 min, 55% B, 15 - 27 min, 55% - 90% B, 27 - 29 min, 90% B, 29 - 31 min, 90 - 30% B, 31 - 25 min, 30% B.

[0078] The mass spectrometry conditions were: positive ion mode, resolution of 60,000, mass-to-charge ratio scanning conditions of 100 - 1000, ion spray voltage of 3200 V, vaporizer temperature of 250 °C, ion transfer tube temperature of 275 °C, sheath gas flow rate of 35 arb, and auxiliary gas flow rate of 10 arb.

[0079] One-pot enzymatic activity results

[0080] The one-pot enzymatic activity reactions of GgIFR, GgVR, and GgPTS enzymes were as Figure 1 shown. When using HDAI as the substrate, no new peak was produced in the reaction of the heat-inactivated protein in the negative control experiment, while a product peak was produced when adding GgIFR, GgVR, and GgPTS. The elution time of the product was the same as that of the Demethylmedicarpin standard peak. Further LC-MS identification of the product was carried out as Figure 2 shown. In the positive ion mode, the mass-to-charge ratio of the product was m / z 257.08, which was the same as that of the Demethylmedicarpin standard. The catalytic reaction diagram was as Figure 3 shown.

[0081] The above has described the embodiments of the present invention in detail. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those of ordinary skill in the art, various changes can be made without departing from the spirit of the present invention. In addition, without conflict, the embodiments of the present invention and the features in the embodiments can be combined with each other.

Claims

1. Flavonoid reductase GgIFR, vestitone reductase GgVR or pterocarpan synthase GgPTS, wherein for the flavonoid reductase GgIFR, the nucleic acid sequence of its encoding gene is as shown in SEQ ID NO.1; for the vestitone reductase GgVR, the nucleic acid sequence of its encoding gene is as shown in SEQ ID NO.2; for the pterocarpan synthase, the nucleic acid sequence of its encoding gene is as shown in SEQ ID NO.

3.

2. Method for preparing the pterocarpan compound Demethylmedicarpin by one-pot enzymatic method, characterized in that, The method comprises the following steps: using 2'-Hydroxydaidzein as a substrate, in the presence of cofactor NADPH, the flavonoid reductase GgIFR, vestitone reductase GgVR and pterocarpan synthase GgPTS described in claim 1 jointly carry out a catalytic reaction to generate Demethylmedicarpin.

3. The method according to claim 2, wherein, The concentration of the substrate HDAI is 400 μM, and the concentration of the cofactor NADPH is 8 mM.

4. The method according to claim 2, characterized in that, The addition amount of the flavonoid reductase GgIFR is 10 - 20 μg / 100 μL, the addition amount of the vestitone reductase GgVR is 10 - 20 μg / 100 μL, and the addition amount of the pterocarpan synthase GgPTS is 10 - 20 μg / 100 μL.

5. The method according to claim 2, wherein The buffer for the catalytic reaction is 100 mM phosphate buffer at pH 6.

0.

6. The method according to claim 2, characterized in that, The temperature of the catalytic reaction is 30 °C, and the time of the catalytic reaction is 24 h.

7. The method according to claim 2, wherein After the catalytic reaction is completed, ethyl acetate is added for extraction, and the combined extract is concentrated to dryness to obtain Demethylmedicarpin crystals.

8. The method according to claim 7, wherein During the concentration, the temperature is controlled at 30 - 45 °C, and the concentration time is 1 - 3 h.

9. Preparation methods for the flavonoid reductase GgIFR, vestitone reductase GgVR and pterocarpan synthase GgPTS described in claim 1: Construct the encoding genes of the flavonoid reductase GgIFR, vestitone reductase GgVR and pterocarpan synthase GgPTS onto the vector pColdII to obtain recombinant plasmids pColdII-GgIFR, pColdII-GgVR, pColdII-GgPTS; Respectively transform the above recombinant plasmids into Escherichia coli BL21 competent cells to obtain recombinant expression strains; Inoculate a single colony of the above recombinant expression strain into a liquid LB medium containing ampicillin resistance and culture overnight at 37 °C; inoculate the cultured product obtained after activation into a liquid LB medium containing ampicillin resistance and culture with shaking at 37 °C until the OD600 is 0.6, add IPTG with a final concentration of 0.5 mM, and induce culture at 16 °C for 16 h; centrifuge to collect the thalli, break the cell walls by ultrasonic treatment, and after purification, protein solutions of recombinant flavonoid reductase GgIFR, recombinant vestitone reductase GgVR and recombinant pterocarpan synthase GgPTS are respectively obtained.