Vibrio parahaemolyticus deoxyribozyme label-free biosensor
The deoxyribose of parahaemolytic Vibrio parahaemolytic deoxyribozyme screened through SELEX combined with ThT fluorescent dye to construct a label-free biosensor, solving the complex and cost-effective problems of traditional detection methods, and achieving rapid, low-cost and highly sensitive VIBR detection, with industrialization potential.
Patent Information
- Application Number
- CN202510366473.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-26
- Publication Date
- 2025-07-18
AI Technical Summary
The prior art is difficult to achieve rapid, low-cost and highly sensitive detection of Vibrio parahaemolyticus, and traditional methods require fluorescent labeling and variable temperature amplification, which is costly and complex in operation.
The obtained Vibrio parahaemolytic deoxyribozyme screening obtained by SELEX combines ThT fluorescent dye, and uses the conformational changes and self-cleaving characteristics of the deoxyribozyme when bound to the target to achieve label-free fluorescence detection, and generates fluorescence signals through rolling ring amplification and formation of G-quadribozyme/ThT complexes.
The rapid, low-cost and ultra-sensitive detection of Vibrio parahaemolyticus was achieved, with the detection limit as low as 1.59CFU·mL-1, and has good linear relationships within the range of 1.86×100~1.86×108CFU mL-1, and has industrialization potential.
Smart Images
Figure CN120330224A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biosensors, and particularly relates to a Vibrio parahaemolyticus deoxyribozyme and its label-free biosensor. Background Art
[0002] Vibrio parahaemolyticus is a Gram-negative halophilic bacterium. Monitoring data of foodborne diseases in China shows that the outbreak scale and population exposure scale of foodborne diseases caused by Vibrio parahaemolyticus have exceeded those of Salmonella, becoming the primary pathogenic factor. In addition to threatening human health, Vibrio parahaemolyticus can also cause diseases in aquatic animals, causing significant economic losses to the aquaculture industry. Therefore, rapid detection and identification of Vibrio parahaemolyticus have important public health significance.
[0003] Deoxyribozyme is a functional nucleic acid with target-binding ability and self-cleavage ability. When the ribozyme binds specifically to the target, its conformation changes, triggering cleavage of its RNA site. As a target signal normalization element, ribozymes are widely used in the detection of various substances. Currently, ribozymes targeting various targets such as metal ions and microorganisms have been developed. Ribozyme screening usually uses high-throughput random libraries, and for specific targets, oligonucleotide sequences meeting the requirements are obtained by systematic evolution of ligands by exponential enrichment (SELEX). Thioflavin T (ThT) is a small molecule fluorescent dye that can be embedded in special nucleic acid conformations to produce a high fluorescence quantum yield, such as G-quadruplex, hairpin structure, or B-DNA duplex.
[0004] The present invention proposes a Vibrio parahaemolyticus-responsive deoxyribozyme obtained by SELEX screening, and based on this deoxyribozyme, a label-free biosensor for Vibrio parahaemolyticus deoxyribozyme has been successfully constructed, ultimately realizing rapid, low-cost, and ultrasensitive label-free fluorescence detection of Vibrio parahaemolyticus. Summary of the Invention
[0005] Based on this, the present invention proposes a Vibrio parahaemolyticus deoxyribozyme and successfully constructs a label-free biosensor for Vibrio parahaemolyticus deoxyribozyme.
[0006] On the one hand, the present application proposes a Vibrio parahaemolyticus deoxyribozyme.
[0007] The Vibrio parahaemolyticus deoxyribozyme sequence is: 5’-CTATG AACTG AC-rA-GA CCTCA CTACCAAGAT GCCAT CCTAC CAACA GTGAA ACGTT GAGGG GTTGC CTGAC TAA AGGGA TACTT GTATTAGTAT GGAGC TCTGA ACTCG-3’, as shown in SEQ ID NO:1, where rA indicates that this nucleic acid site is RNA.
[0008] On the other hand, the present invention provides a label-free biosensor for Vibrio parahaemolyticus deoxyribozyme, characterized in that: (1) the sequence of the label-free biosensor for Vibrio parahaemolyticus deoxyribozyme; (2) the signal reporter molecule of the label-free biosensor for Vibrio parahaemolyticus deoxyribozyme.
[0009] The sequence of the label-free biosensor for Vibrio parahaemolyticus deoxyribozyme is: 5’-CTATG AACTG AC-rA-GA CCTCA CTACC AAGAT GCCAT CCTAC CAACA GTGAA ACGTT GAGGG GTTGC CTGAC TAAAGGGA TACTT GTATT AGTAT GGAGC TCTGA ACTCG-3’, as shown in SEQ ID NO:1, where rA indicates that this nucleic acid site is RNA;
[0010] The signal reporter molecule of the label-free biosensor for Vibrio parahaemolyticus deoxyribozyme is ThT fluorescent dye;
[0011] The concentration of ThT fluorescent dye in the solution of the label-free biosensor for Vibrio parahaemolyticus deoxyribozyme is 5 μmol·L -1 ;
[0012] The buffer solution of the label-free biosensor for Vibrio parahaemolyticus deoxyribozyme is: 50 mmol·L -1 KCl, pH 7.4;
[0013] The detection of Vibrio parahaemolyticus is based on the conformational change and self-cleavage of deoxyribozyme due to the interaction between deoxyribozyme and Vibrio parahaemolyticus. The generated cleavage short chain initiates RCA amplification to obtain a large number of long-chain DNA products with repeated tandem G-quadruplex sequences, which form a G-quadruplex / ThT complex with ThT to generate fluorescence. The ThT fluorescence value under specific excitation conditions shows a gradient change with the concentration of Vibrio parahaemolyticus, thereby realizing the detection of Vibrio parahaemolyticus;
[0014] Specific steps for establishing the standard curve: Add different concentrations of Vibrio parahaemolyticus to a solution containing 2 μmol·L -1In the SB buffer solution of the deoxyribozyme, the concentrations of Vibrio parahaemolyticus were 1.86×10 0 、1.86×10 1 、1.86×10 2 、1.86×10 3 、1.86×10 4 、~1.86×10 5 、1.86×10 6 、1.86×10 7 、1.86×10 8 CFU mL -1 . After mixing well by shaking at room temperature and incubating for 30 min, 20 μL of the incubation product was taken, and after mixing with 2 μL of circular template, 4 μL of 10×phi29 DNA polymerase buffer, and 7.6 μL of ddH2O, it was first pre-denatured at 95°C for 5 min, immediately placed on ice bath for 5 min, then 2 μL of phi29 DNA polymerase (10 U / μL), 0.4 μL of 100×BSA, and 4 μL of 10 mM dNTPs were added. The total volume was 40 μL, and the reaction was carried out at 30°C for 1.5 h and terminated by reacting at 65°C for 10 min. Then, 36 μL of the RCA product was mixed with 25 μL of 200 mM KCl and 34 μL of ddH2O, and then 5 μL of 100 μM ThT was added. The total system was 100 μL, and it was mixed well to form a G4 / ThT complex. After 5 min, the fluorescence intensity of ThT in the solution system was measured using a fluorescence spectrophotometer (excitation wavelength 439 nm, emission wavelength 490 nm), and a standard curve was plotted based on the fluorescence value and the concentration of Vibrio parahaemolyticus. The results showed that the deoxyribozyme label-free sensor for Vibrio parahaemolyticus had a good linear relationship (R 0 ~1.86×10 8 CFU mL -1 in the concentration range of Vibrio parahaemolyticus (R 2 = 0.998), the linear regression equation was Y = 25.29X + 42.71, and the detection limit was as low as 1.59 CFU·mL -1 .
[0015] On the other hand, the present invention also relates to the application of the biosensor in the development of a detection method for Vibrio parahaemolyticus or environmental detection.
[0016] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0017] 1. A new deoxyribozyme sequence for Vibrio parahaemolyticus was obtained by SELEX screening in the present invention, which can specifically bind to Vibrio parahaemolyticus and trigger self-cleavage.
[0018] 2. The deoxyribozyme of the present invention has high target recognition ability and high self-cleavage activity.
[0019] 3. The biosensor proposed by the present invention does not require fluorescence labeling or temperature-variable amplification and can achieve signal amplification at room temperature.
[0020] 4. The Vibrio parahaemolyticus deoxyribozyme label-free biosensor proposed by the present invention has a good linear relationship (R 0 ~1.86×10 8 CFU mL -1 in the Vibrio parahaemolyticus concentration range (R 2 = 0.998), and the linear regression equation is Y = 25.29X + 42.71. The detection limit is as low as 1.59 CFU·mL -1 .
[0021] 5. The Vibrio parahaemolyticus deoxyribozyme label-free biosensor proposed by the present invention can achieve rapid, low-cost, stable and ultrasensitive label-free detection of Vibrio parahaemolyticus, and has certain generality and industrialization potential. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 is the secondary structure of the Vibrio parahaemolyticus deoxyribozyme.
[0023] Figure 2 is the change in cleavage efficiency of the ribozyme incubated with Vibrio parahaemolyticus for different times.
[0024] Figure 3 is the result graph of the affinity constant of the Vibrio parahaemolyticus deoxyribozyme determined by cleavage efficiency.
[0025] Figure 4 is the schematic diagram of the sensor.
[0026] Figure 5 is the optimization of ThT concentration.
[0027] Figure 6 is the optimization of buffer concentration.
[0028] Figure 7 is the fluorescence signal of ThT at different Vibrio parahaemolyticus concentrations.
[0029] Figure 8 is the standard curve graph of the deoxyribozyme label-free sensor for detecting Vibrio parahaemolyticus. DETAILED DESCRIPTION OF THE INVENTION
[0030] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.
[0031] Example 1. SELEX Screening of Vibrio parahaemolyticus Deoxyribozyme
[0032] The present invention provides a method for screening Vibrio parahaemolyticus deoxyribozyme, comprising the following steps:
[0033] (1) Preparation of Ribozyme Screening Targets
[0034] Vibrio parahaemolyticus was selected as the positive screening target, and Vibrio alginolyticus, Staphylococcus aureus, and Bacillus cereus were used as the negative screening targets. After overnight culture of the above bacteria, the supernatant was collected by centrifugation as the crude extracellular mixture (CEM). The bacterial precipitate was resuspended in an equal volume of PBS solution containing lysozyme, incubated, and repeatedly frozen and thawed, and the supernatant was collected by centrifugation as the crude intracellular mixture (CIM). After mixing CEM and CIM, the positive and negative screening targets for screening were obtained through filtration.
[0035] (2) Generation of Screening Library
[0036] The random library was phosphorylated and covalently linked to the substrate strand to obtain the screening library (FS-DL). A RNA base was modified in the middle of the substrate strand, and a fluorescent group and a quenching group were respectively modified at both ends of the RNA.
[0037] (3) Purification of FS-DL
[0038] FS-DL was recovered by ethanol precipitation method, and then the obtained precipitate was dissolved in ultrapure water, and FS-DL was recovered by excising the gel through 12% dPAGE.
[0039] (4) Incubation of FS-DL with Negative Screening Targets
[0040] After the incubation of FS-DL with the negative screening targets was completed, FS-DL that did not undergo RNA site cleavage was recovered and purified by ethanol precipitation method and 12% PAGE.
[0041] (5) Incubation of FS-DL with Positive Screening Targets
[0042] After incubating the recovered FS-DL above with the positive screening target, the FS-DL with RNA site cleavage was recovered and purified by ethanol precipitation and 12% PAGE.
[0043] (6) PCR amplification
[0044] Using the recovered FS-DL above as a template, perform two rounds of PCR amplification;
[0045] (7) Secondary library preparation
[0046] Recover and purify the amplification product in step (6) to obtain a secondary library.
[0047] (8) Multiple rounds of screening
[0048] Replace the random single-stranded DNA library in step (1) with the secondary library obtained in step (7), and repeat the screening multiple rounds according to steps (1) to (7).
[0049] (9) High-throughput sequencing
[0050] After the screening is completed, perform high-throughput sequencing analysis on the latest obtained secondary library to obtain Vibrio parahaemolyticus deoxyribozymes to be tested as alternatives.
[0051] Example 2. Structure prediction and affinity determination of Vibrio parahaemolyticus deoxyribozyme
[0052] First, perform structure prediction on the screened Vibrio parahaemolyticus deoxyribozyme, and its sequence is: 5’-CTATGAACTG AC-rA-GA CCTCA CTACC AAGAT GCCAT CCTAC CAACA GTGAA ACGTT GAGGG GTTGCCTGAC TAA AGGGA TACTT GTATT AGTAT GGAGC TCTGA ACTCG-3’, as shown in SEQ ID NO:1, where rA indicates that this nucleic acid site is RNA. Use the RNAfold WebServer to predict the secondary structure of the deoxyribozyme, and the result is as Figure 1 shown, and it can be seen that the screened Vibrio parahaemolyticus deoxyribozyme contains multiple hairpin, bulge loop, and internal loop structures.
[0053] Subsequently, the cleavage activity of Vibrio parahaemolyticus deoxyribozyme (as shown in SEQ ID NO: 1) was verified. The principle is as follows: When Vibrio parahaemolyticus is present in the system, Vibrio parahaemolyticus will specifically bind to the deoxyribozyme, causing a conformational change in the deoxyribozyme and catalyzing the cleavage of the RNA site on the substrate strand. The cleavage of the target and the deoxyribozyme incubated for different times was detected by 12% dPAGE, and the gray value of the cleavage band was analyzed to determine the cleavage activity of the deoxyribozyme and the target by calculating the cleavage rate at different incubation times.
[0054] The specific experimental steps are as follows:
[0055] Mix 10 μL of the ribozyme to be verified (1 μM) with 10 μL of 2×SB buffer, incubate at 95 °C for 5 min and then slowly cool to room temperature. Immediately add 10 μL of Vibrio parahaemolyticus CEM-CIM, 10 μL of 2×SB buffer and 10 μL of ddH2O, mix well, and after incubating at room temperature for different times with shaking, immediately perform 12% dPAGE to analyze the cleavage ability of the sequence.
[0056] As Figure 2 shown, as the incubation time prolongs, the proportion of the cleavage band gradually increases, indicating that the screened Vibrio parahaemolyticus deoxyribozyme (as shown in SEQ ID NO: 1) has good cleavage efficiency. Nonlinear fitting of the cleavage rates at different incubation times shows that the cleavage rate of Vibrio parahaemolyticus deoxyribozyme (as shown in SEQ ID NO: 1) is 0.3662 min -1 ( Figure 3 )
[0057] Example 3. Optimization of the label-free sensor based on Vibrio parahaemolyticus deoxyribozyme
[0058] The cleaved short strand produced after the incubation of Vibrio parahaemolyticus deoxyribozyme (as shown in SEQ ID NO: 1) with the target can serve as a primer for rolling circle amplification (RCA). Through the designed RCA circular template, a large number of long-chain DNA products with repetitive tandem G-quadruplex sequences can be obtained. Therefore, ThT is introduced as a fluorescent small molecule to construct a label-free sensor for Vibrio parahaemolyticus deoxyribozyme. The specific detection principle is as follows: G-quadruplex can form a G-quadruplex / ThT complex with ThT, generating strong fluorescence at an excitation wavelength of 439 nm, and the higher the concentration of Vibrio parahaemolyticus, the higher the fluorescence intensity of the system ( Figure 4 ). The concentration of the sensor ThT and the concentration of KCl buffer were optimized. As Figure 5 shown, when the ThT concentration increased from 2 μmol·L -1 to 5 μmol·L -1 , the fluorescence intensity increased. This value remained stable when the concentration was higher than 5 μmol·L -1It decreased over time, so 5 μmol·L -1 was selected as the ThT working concentration. The effect of KCl concentration on fluorescence intensity was detected in the range of 10 - 200 mmol·L -1 . As Figure 6 shown, the highest fluorescence intensity was observed at a KCl concentration of 50 mM, indicating that the G4 folding and stability were sufficient. Therefore, 50 mM KCl was selected as the working concentration.
[0059] Example 4. Evaluation of the sensitivity of a Vibrio parahaemolyticus deoxyribozyme label-free sensor
[0060] Vibrio parahaemolyticus deoxyribozyme (as shown in SEQ ID NO:1) was used to detect known concentrations of Vibrio parahaemolyticus, and a standard curve was made based on the change in ThT fluorescence value in the solution. Different concentrations of Vibrio parahaemolyticus were added to the SB buffer solution containing 2 μmol·L -1 deoxyribozyme. The concentrations of Vibrio parahaemolyticus were 1.86×10 0 , 1.86×10 1 , 1.86×10 2 , 1.86×10 3 , 1.86×10 4 , ~1.86×10 5 , 1.86×10 6 , 1.86×10 7 , 1.86×10 8 CFU / mL -1 . After mixing well by shaking at room temperature and incubating for 30 min, 20 μL of the incubation product was taken, and after adding 2 μL of circular template, 4 μL of 10×phi29 DNA polymerase buffer, and 7.6 μL of ddH2O and mixing, it was first pre-denatured at 95 °C for 5 min, immediately placed on ice for 5 min, then 2 μL of phi29 DNA polymerase (10 U / μL), 0.4 μL of 100×BSA, and 4 μL of 10 mM dNTPs were added. The total volume was 40 μL, and the reaction was carried out at 30 °C for 1.5 h and terminated at 65 °C for 10 min. Then, 36 μL of the RCA product was mixed with 25 μL of 200 mM KCl and 34 μL of ddH2O, and then 5 μL of 100 μM ThT was added. The total system was 100 μL, and it was mixed well to form the G4 / ThT complex. After 5 min, the fluorescence intensity of ThT in the solution system was measured using a fluorescence spectrophotometer (excitation wavelength 439 nm, emission wavelength 490 nm), and a standard curve was plotted based on the fluorescence value and the concentration of Vibrio parahaemolyticus.
[0061] As Figure 7 shown, the Vibrio parahaemolyticus deoxyribozyme label-free sensor had a detection limit of 1.86×10 0~1.86×10 8 CFU / mL -1 Within the concentration range of Vibrio parahaemolyticus, its fluorescence signal increases with the increase of the concentration of Vibrio parahaemolyticus, showing a good detection trend. Moreover, the label-free Vibrio parahaemolyticus deoxyribozyme sensor has a good linear relationship (R 0 ~1.86×10 8 CFU / mL -1 within the concentration range of Vibrio parahaemolyticus (R 2 = 0.998), and the linear regression equation is Y = 25.29X + 42.71, with the detection limit as low as 1.59 CFU·mL -1 ( Figure 8 ).
Claims
1. A Vibrio parahaemolyticus deoxyribozyme, characterized in that, The deoxyribozyme sequence is: 5’-CTATGAACTGAC-rA-GACCTCACTACCAAGATGCCATCCTACCAACAGTGAAACG TTGAGGGGTTGCCTGACTAAAGGGATACTTGTATTAGTATGGAGCTCTGAACTCG-3’, as shown in SEQ ID NO:
1.
2. Use of the deoxyribozyme sequence according to claim 1 in the development of a method for detecting Vibrio parahaemolyticus.
3. Use of the deoxyribozyme sequence according to claim 1 in a kit for detecting Vibrio parahaemolyticus.
4. A Vibrio parahaemolyticus deoxyribozyme label-free biosensor, characterized in that, The label-free biosensor comprises: (1) the sequence of the label-free biosensor of Vibrio parahaemolyticus deoxyribozyme; (2) the detection of Vibrio parahaemolyticus. The Vibrio parahaemolyticus deoxyribozyme sequence is: 5’-CTATGAACTGAC-rA-GACCTCACTACCAAGATGCCATCCTACCAACAGTGAAACG TTGAGGGGTTGCCTGACTAAAGGGATACTTGTATTAGTATGGAGCTCTGAACTCG-3’, as shown in SEQ ID NO:
1.
5. The Vibrio parahaemolyticus deoxyribozyme label-free biosensor according to claim 4, wherein The signal reporter molecule of the label-free biosensor of Vibrio parahaemolyticus deoxyribozyme is ThT fluorescent dye.
6. The Vibrio parahaemolyticus deoxyribozyme label-free biosensor according to claim 4, wherein The concentration of ThT fluorescent dye in the solution of the biosensor is 5 μmol·L -1 .
7. The Vibrio parahaemolyticus deoxyribozyme label-free biosensor according to claim 4, characterized in that The buffer solution of the biosensor is 50 mmol·L -1 KCl solution.
8. The method for quantitatively detecting Vibrio parahaemolyticus by using the Vibrio parahaemolyticus deoxyribozyme label-free biosensor according to claim 4, characterized in that, Establishment of a standard curve: Vibrio parahaemolyticus at different concentrations was added to the screening buffer solution containing 2 μmol·L -1 deoxyribozyme. The concentrations of Vibrio parahaemolyticus were 1.86×10 0 , 1.86×10 1 , 1.86×10 2 , 1.86×10 3 , 1.86×10 4 , 1.86×10 5 , 1.86×10 6 , 1.86×10 7 , 1.86×10 8 CFU mL -1 . After mixing well by shaking at room temperature and incubating for 30 min, 20 μL of the incubation product was taken, and after mixing with 2 μL of circular template, 4 μL of 10×phi29 DNA polymerase buffer, and 7.6 μL of ddH2O, it was first pre-denatured at 95 °C for 5 min, immediately placed on ice bath for 5 min, then 2 μL of phi29 DNA polymerase (10 U / μL), 0.4 μL of 100×BSA, and 4 μL of 10 mM dNTPs were added. The total volume was 40 μL, and the reaction was carried out at 30 °C for 1.5 h and terminated by reacting at 65 °C for 10 min. Subsequently, 36 μL of the RCA product was mixed with 25 μL of 200 mM KCl and 34 μL of ddH2O, and then 5 μL of 100 μM ThT was added. The total system was 100 μL, and it was mixed well to form a G4 / ThT complex. After 5 min, the fluorescence intensity of ThT in the solution system was measured using a fluorescence spectrophotometer. The excitation wavelength was set at 439 nm and the emission wavelength was set at 490 nm. A standard curve was plotted based on the fluorescence value and the concentration of Vibrio parahaemolyticus.
9. Use of the label-free biosensor according to any one of claims 4 to 8 in the development of a method for detecting Vibrio parahaemolyticus.
10. Use of the label-free biosensor according to any one of claims 4 to 8 in a kit for food safety detection of Vibrio parahaemolyticus.
Citation Information
Cited By
Multicolor colorimetric detection method and application of vibrio parahaemolyticus
CN120945081A