Identification of germplasm of idesia polycarpa by irap markers

Abstract

The application discloses a Idahoa genus germplasm identification IRAP marker, and an IRAP primer used in the IRAP marker is designed based on a RT sequence of an Idahoa genus retrotransposon, wherein the specific IRAP primer used in the IRAP marker is selected from one or more sequences shown in the following: primer IRAP07, sequence 5'-GCCGACCAT TGTTGTTATGT-3'; primer IRAP19, sequence 5'-AGGCGTCTGTTTGAGACCAT-3'; primer IRAP52, sequence 5'-GCTGTATGCCAAATTGAGCA-3'; primer IRAP56, sequence 5'-CCAAGTAAGGCTGGAAAACC-3'; primer IRAP59, sequence 5'-CCGCGGATAGATGACTTGTT-3'; primer IRAP65, sequence 5'-TAGTGATGCCATTCGGGTTA-3'; and primer IRAP73, sequence 5'-ACTTCCGCGGATAGATGACT-3'. The marker is convenient and fast to operate, stable in result, high in efficiency, not easy to be affected by environment, and can be applied to researches such as Idahoa genus germplasm identification, genetic diversity evaluation and species genetic relationship analysis, thereby providing an effective means for excellent germplasm mining, assisted breeding and germplasm property right protection.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to bio-agriculture and related industries, or gene testing services and other related technologies in the biopharmaceutical industry, and particularly to an IRAP marker for germplasm identification of *Vernicia fordii* and its application. Background Technology

[0002] Shantongzi( Idesia polycarpa Maxim. Belonging to the family Elaeagnaceae, it is a deciduous tree, often called the chair tree or water melon. The mountain tung tree prefers deep, moist, acidic or neutral soil and typically grows in mixed forests in low mountainous areas at altitudes of 400-2500 meters. It is cold- and drought-resistant.

[0003] The Chinese privet (Vernicia fordii) possesses extremely high economic and ecological value. Its fruit has an oil content as high as 43.6%, with linoleic acid exceeding 58%, earning it the nickname "oil depot on a tree," suitable for refining high-quality edible oil and biofuels. The wood of the Chinese privet is soft and corrosion-resistant, making it an excellent material for construction and furniture making. Its well-developed root system and strong lateral roots play a vital role in soil and water conservation. From an ornamental perspective, its new leaves display a vibrant red color in spring, with panicles adorned with yellow stamens; in autumn, the crimson berries adorn the branches like pearls, making it not only aesthetically pleasing but also a valuable source of nectar, ideal for landscaping in mountainous areas. In traditional medicine, the leaves and fruit of the Chinese privet are used to clear heat and dampness, reduce swelling, and relieve pain; modern research has further discovered that its rich polyphenolic compounds possess antioxidant activity, and squalene can regulate blood lipids, benefiting human health.

[0004] Accurate germplasm identification is crucial in the research and utilization of *Vernicia fordii*. Currently, identification methods for *Vernicia fordii* mainly cover morphological markers, cytological markers, biochemical markers, and molecular markers. Among these, molecular markers, with their significant advantages such as speed, lack of seasonal and environmental limitations, and wide applicability, compensate for the shortcomings of the other three identification methods and have been widely used in research fields such as genetic diversity analysis, germplasm identification, and phylogenetic studies of *Vernicia fordii*.

[0005] For example, the publication number in Chinese patent documents is CN116814825A The invention patent discloses a method for accurately identifying the sex of *Vernicia fordii* seeds. DNA Sequence, primers, and identification methods allow for sex identification of *Vernicia fordii* at any growth stage and in any strain. Based on transcriptome sequencing data from *Vernicia fordii*, Li Na et al. successfully developed a polymorphic... SSR Molecular markers were used, and their feasibility was verified through primers. The study found that *Vernicia fordii* (a type of vine)... SSRThe dominant repeat types at the loci were single nucleotides, dinucleotides, and trinucleotides, with repeat frequencies concentrated at 3, 5, and 6. Polymorphism analysis identified 8 primer pairs that can specifically distinguish *Vernicia fordii* from different regions, providing strong technical support for genetic diversity research and resource conservation.

[0006] However, existing molecular marker technologies still have shortcomings. Among them, SSR Primer design relies on known sequences and is species-specific, resulting in low marker density, which makes it difficult to meet the needs of large-scale breeding; while ISSR As it is a dominant marker, it is difficult to distinguish between homozygotes and heterozygotes, and the amplification products are complex, which increases the difficulty of data analysis. SRAP The amplification effect on the centromere and telomere regions was poor, and it also had a poor effect on... PCR The conditions are quite sensitive, which affects the consistency of the results. Summary of the Invention

[0007] To address the technical problems existing in the background art, the present invention provides a germplasm identification method for *Vernicia fordii*. IRAP Tags and their applications.

[0008] Based on the first main aspect of the present invention, a germplasm identification method for *Vernicia fordii* is provided. IRAP The mark, IRAP The mark used IRAP Primers are based on the retrotransposon of *Vernicia fordii*. RT Sequence design, wherein the sequence is used for the IRAP Label specificity IRAP Primers are selected from one or more of the following sequences:

[0009] Primers IRAP 07, sequence is 5'- GCCGACCATTGTTGTTATGT -3';

[0010] Primers IRAP 19, sequence is 5'- AGGCGTCTGTTTGAGACCAT -3';

[0011] Primers IRAP 52, sequence is 5'- GCTGTATGCCAAATTGAGCA -3';

[0012] Primers IRAP 56, sequence is 5'- CCAAGTAAGGCTGGAAAACC -3';

[0013] Primers IRAP 59, sequence is 5'- CCGCGGATAGATGACTTGTT -3';

[0014] Primers IRAP 65, sequence is 5'- TAGTGATGCCATTCGGGTTTA -3';

[0015] Primers IRAP 73, sequence is 5'- ACTTCCGCGGATAGATGACT -3'.

[0016] Based on a second key aspect of the present invention, a method for germplasm identification of *Vernicia fordii* is provided, comprising the following steps:

[0017] Extraction of the genome of *Vernicia fordii* DNA ;

[0018] Based on the retrotransposon of *Vernicia fordii* Ty1-copy and Ty3-gypsy of RT Sequence Design IRAP Primers;

[0019] Eight germplasm samples with significant morphological differences were selected for testing. PCR After the reaction amplification, the sample was analyzed by 1.5% agarose gel electrophoresis. IRAP Primers were screened to select those with specificity that met the criteria. IRAP Primers are used in subsequent steps;

[0020] Select the specificity that has been filtered IRAP Primer pairs were analyzed for all tested germplasm, and the results were determined based on the presence, number, and size of the amplified bands.

[0021] Furthermore, the aforementioned method for germplasm identification of *Vernicia fordii* also includes the following steps:

[0022] The data is labeled according to the presence or absence of amplified bands. That is, bands at the same electrophoresis position are labeled as "1" and no bands are labeled as "0". Then a 0 / 1 data matrix is ​​built.

[0023] Calculating polymorphic information content using software PIC The core primers were identified, and the germplasm fingerprint code was constructed using the obtained 0 / 1 data matrix.

[0024] Finally, an electronic ID card for the tested germplasm was constructed using a barcode and QR code generator.

[0025] Furthermore, in the aforementioned method for germplasm identification of *Vernicia fordii*, the described... PCR The reaction system is 10 μL System: 0.6 μL template DNA 1.0 μL Primer, 6.0 μL PCR Mix and 2.4 μL ddH 2 O The PCR The reaction procedure is: 94℃ Pre-variant 4 minutes 94 ℃ Transgender 30 s 57 ℃ Annealing 30 s 72 ℃ Extension 1 minutes A total of 40 cycles; extended at 72℃ for another 10 minutes. minutes 4 ℃ save.

[0026] Furthermore, in the aforementioned method for identifying the germplasm of *Vernicia fordii*, the core primers are selected from one or more sequences listed below:

[0027] Primers IRAP 07, sequence is 5'- GCCGACCATTGTTGTTATGT -3';

[0028] Primers IRAP 19, sequence is 5'- AGGCGTCTGTTTGAGACCAT -3';

[0029] Primers IRAP 52, sequence is 5'- GCTGTATGCCAAATTGAGCA -3';

[0030] Primers IRAP 56, sequence is 5'- CCAAGTAAGGCTGGAAAACC -3';

[0031] Primers IRAP 59, sequence is 5'- CCGCGGATAGATGACTTGTT -3';

[0032] Primers IRAP 65, sequence is 5'- TAGTGATGCCATTCGGGTTTA -3';

[0033] Primers IRAP 73, sequence is 5'- ACTTCCGCGGATAGATGACT -3'.

[0034] Based on the third key aspect of the present invention, a method comprising the foregoing is provided. IRAP A kit for labeled primer combinations, the kit further comprising for... PCR Other reagents for the reaction, said other reagents include at least PCR reaction buffer and ddH 2 O The kit is used for germplasm identification of *Vernicia fordii*.

[0035] Furthermore, in the aforementioned reagent kit, the... PCR The reaction buffer solution must contain at least 50 components. mM KCl 10 mM Tris-HCl ( pH 8.4), 1.5 mM MgCl 2 0.2 mM dNTPs .

[0036] Based on the fourth principal aspect of the present invention, a method applying the foregoing is provided. IRAP The method for constructing electronic identity cards for *Vernicia fordii* germplasm includes the following steps:

[0037] Based on the retrotransposon of *Vernicia fordii* Ty1-copy and Ty3-gypsy of RT Sequence Design IRAP Primers are used to target germplasm. PCR Amplification to obtain polymorphic amplification products;

[0038] The amplification products were detected by 1.5% agarose gel electrophoresis, and a binary data matrix was established based on the presence or absence of bands.

[0039] The data matrix is ​​converted into a unique encrypted fingerprint code using a hash algorithm, and a composite data packet is generated by combining the geographical location and altitude information of the germplasm collection.

[0040] Dynamic QR code technology is used to encode the composite data packet into an electronic ID card and simultaneously upload it to a blockchain distributed database to achieve tamper-proof storage and traceability of germplasm information.

[0041] Furthermore, in the aforementioned construction method, the hash algorithm is: SHA- The 256 encryption algorithm is used, and the composite data packet is further bound to environmental parameters during germplasm collection, including temperature, humidity, and soil conditions. pH value.

[0042] Based on the fifth main aspect of the present invention, an encrypted construction system for an electronic ID card of *Vernicia fordii* germplasm for implementing the aforementioned construction method is provided, comprising:

[0043] Primer design and amplification module for use with reverse transcriptase transposons from *Vernicia fordii*. Type1- copy and Ty3-gypsy of RT Sequence Design IRAP Primers, and using the designed primers to target germplasm. PCR Amplification is performed to obtain polymorphic amplification products;

[0044] The electrophoresis detection and data processing module is used to detect the polymorphic amplification products by 1.5% agarose gel electrophoresis and establish a binary data matrix based on the presence or absence of electrophoretic bands.

[0045] The code generation and data packet construction module is used to convert the binary data matrix into a unique encrypted fingerprint code using a hash algorithm, and to generate a composite data packet by combining the geographical location, altitude information and environmental parameters of the germplasm collection.

[0046] The QR code generation and data storage module is used to encode the composite data packet into an electronic ID card using dynamic QR code technology and simultaneously upload it to the blockchain distributed database to achieve tamper-proof storage and traceability of germplasm information.

[0047] Advantages and beneficial effects of the present invention:

[0048] This invention is developed based on the retrotransposon sequence of *Vernicia fordii*. IRAP This invention provides a marker that is easy to operate, fast, produces stable results, is highly efficient, and is not easily affected by the environment. It can be applied to research on *Vernicia fordii* germplasm identification, genetic diversity evaluation, and species phylogenetic analysis in various regions, providing an effective means for discovering superior germplasm, assisted breeding, and protecting germplasm intellectual property rights. The key technical problem this invention aims to solve is obtaining a highly efficient marker. IRAP Primers and establishment PCR Amplification system.

[0049] Specifically, compared with the prior art, the present invention has at least the following outstanding substantive features and significant progress:

[0050] (1) Simple and fast operation: This invention utilizes the reverse transcriptase transposon sequence developed from the tung oil tree seed. IRAP Primers, for sample preparation PCR The detection results can be obtained by amplification and agarose gel electrophoresis.

[0051] (2) The results are accurate and reliable: This invention is based on... DNA At the molecular level, detection was performed based on retrotransposon sequences. The results of repeated tests on 101 *Vernicia fordii* germplasm were consistent and accurate.

[0052] (3) High sensitivity of detection results: only 30 samples are required for testing. of template DNA This allows for accurate identification of its germplasm;

[0053] (4) Good polymorphism: Through testing of 101 *Vernicia fordii* germplasm accessions, IRAP Primers generally exhibit high polymorphism, enabling efficient identification of different germplasm.

[0054] (5) The mountain tung seed was identified IRAP-PCR The optimal system, utilizing economically and efficiently. IRAP Marking was used to identify the germplasm of *Vernicia fordii*.

[0055] (6) This invention is developed based on the retrotransposon sequence of *Vernicia fordii*. IRAP The marker can be effectively used in research such as germplasm identification, genetic diversity evaluation, and species phylogenetic analysis of *Vernicia fordii* in various regions, and can also realize the construction of electronic ID cards for *Vernicia fordii* germplasm, providing an effective means for the discovery of superior germplasm, assisted breeding, and protection of germplasm intellectual property rights. Attached Figure Description

[0056] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, obtaining other drawings based on these drawings without creative effort still falls within the scope of the present invention.

[0057] Figure 1 An embodiment of the present invention is shown. IRAP Primers IRAP 59. IRAP 65. IRAP 71. IRAP 73 PCR Preliminary screening results by 1.5% agarose gel electrophoresis after amplification. M for DNA Markers 1-8 represent 8 different germplasms of *Vernicia fordii*.

[0058] Figure 2 An embodiment of the present invention is shown. IRAP Primers IRAP 03 pairs of 24 *Vernicia fordii* germplasm samples PCR Results of 1.5% agarose gel electrophoresis after amplification. M for DNA Markers 1-24 represent samples 1-24 of the tung oil tree fruit.

[0059] Figure 3 An embodiment of the present invention is shown. IRAP Primers IRAP 08 pairs of 24 *Vernicia fordii* germplasm samples PCR Results of 1.5% agarose gel electrophoresis after amplification. M for DNA Markers 1-24 represent samples 1-24 of the tung oil tree fruit.

[0060] Figure 4 An embodiment of the present invention is shown. IRAP Primers IRAP 77 pairs of 24 *Vernicia fordii* germplasm samples PCR Results of 1.5% agarose gel electrophoresis after amplification. M for DNA Markers1-24 represent samples 1-24 of the *Vernicia fordii*. Detailed Implementation

[0061] The preferred embodiments of the present invention will be described in detail below to provide a clearer understanding of the purpose, features, and advantages of the invention. It should be understood that the following embodiments are not intended to limit the scope of the invention, but are merely illustrative of the essential spirit of the technical solution of the invention.

[0062] In the following description, certain specific details are set forth for the purpose of illustrating various disclosed embodiments in order to provide a thorough understanding of the various disclosed embodiments. However, those skilled in the art will recognize that embodiments may be practiced without one or more of these specific details. In other instances, well-known techniques associated with this application may not have been shown or described in detail to avoid unnecessarily obscuring the description of the embodiments.

[0063] Throughout this specification, references to "an embodiment" or "an embodiment" indicate that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment. Therefore, the appearance of "in an embodiment" or "an embodiment" in various places throughout the specification does not necessarily refer to the same embodiment. Furthermore, a particular feature, structure, or characteristic may be combined in any manner in one or more embodiments.

[0064] Example 1

[0065] 1. Sample Collection

[0066] A total of 101 germplasm samples were collected for this experiment from Datian Village, Huangban Township, Songtao County; Shuiyuan Village, Panshi Town, Songtao County; and Fodingshan Village, Pingshan Township, Shiqian County. Fresh, young leaves were randomly selected from each sample, packaged in aluminum foil, and clearly labeled. Two samples of the same material were collected and placed in an icebox with ice packs. One sample was brought back to the laboratory for testing, while the other was stored at -80°C. ℃ Store in the refrigerator for later use. Detailed information on the 101 pieces of identification materials is shown in Table 1.

[0067] Table 1 Germplasm Information of *Vernicia fordii*

[0068]

[0069]

[0070]

[0071] 2. Genome DNA extract

[0072] Using a novel plant genome from Tiangen Biotech (Beijing) Co., Ltd. DNAExtraction kit (centrifuge column type) extracts all samples. DNA The operating procedures should be followed according to the kit instructions. DNA After extraction, the samples were analyzed by 1% agarose gel electrophoresis. DNA Integrity, using a full-wavelength microplate reader Multiscan GO Its concentration and purity were tested, and after passing the quality test, it was stored at -20°C. ℃ Ultra-low temperature freezer for backup.

[0073] Genome analysis of *Vernicia fordii* leaves was performed using 1% agarose gel electrophoresis. DNA It has high integrity. DNA The sample bands were clear, the main band was distinct, and no abnormalities were observed. DNA Degradation phenomenon.

[0074] Use a full-wavelength microplate reader Multiscan GO Testing, 101 samples DNA of OD 260 / OD The 280 values ​​were all between 1.7 and 2.0, with a concentration of 38. ng / μL -122 ng / μL Between, the purity and concentration both reached IRAP Molecular markers PCR Amplification requirements.

[0075] 3. IRAP Primer design and synthesis

[0076] Toyama Tongzi LTR retrotransposon RT The sequences obtained from sequence cloning and sequencing are analyzed, and shorter, repetitive sequences are removed. Utilizing... snapgene design IRAP 100 marker primers were designed. IRAP Primers were synthesized by Bioengineering (Shanghai) Co., Ltd.

[0077] 4. IRAP-PCR Establishment of the reaction system

[0078] PCR The reaction system is 10 μL System: 50 of / L template DNA 0.6 μL 1.0 μL Primer, 6.0 μL of PCR Mix and 2.4 μL of ddH 2 O , PCR The number of cycles is 40.

[0079] 5. IRAP-PCR Establishment of the reaction procedure

[0080] PCR The reaction procedure is: 94 ℃ Pre-variant 4 minutes 94 ℃ Transgender 30 s Annealing at 57℃ for 30 minutes s 72 ℃ Extension 1 minutes A total of 40 cycles; the final 72 ℃ Re-reaction 10 minutes 4 ℃ save.

[0081] 6. IRAP Primer screening

[0082] One hundred primers were used to target eight germplasm samples with significant morphological differences. DNA conduct PCR Amplification, detected by 1.5% agarose gel electrophoresis. PCR The reaction products were selected based on their high polymorphism and clear bands. IRAP Primers, some primer screening results are as follows Figure 1 .

[0083] Seventeen bands with good polymorphism and clear bands were selected. IRAP Primers.

[0084] 7. IRAP Label detection

[0085] 17 articles IRAP Primers were used to target 101 germplasms. PCR Amplification, each IRAP The primers were tested three times, and the results were detected by 1.5% agarose gel electrophoresis. PCR Reaction products. Partial. PCR Amplification results as follows Figure 2-Figure 4 .

[0086] 8. Data Statistics

[0087] In three replicate experiments, the bands that could be repeatedly amplified and were clear were counted. Bands with the same electrophoretic position were marked as "1", and those without a band were marked as "0". A "0 / 1" data matrix of 101 germplasms was constructed.

[0088] 9. Electronic ID Card Production

[0089] use PowerMarkerv 3.25 Software calculation of polymorphic information content ( PIC ), PICThe values ​​are shown in Table 2. Based on the principle of using the fewest primers to identify the most tested germplasm, the core primers were determined to be... IRAP 59. IRAP 07、 IRAP 56. IRAP 52. IRAP 19. IRAP 73. IRAP 65. After determining the core primers, use the obtained 0 / 1 data matrix to construct the germplasm fingerprint code.

[0090] When performing hash encryption, the binary matrix is ​​first converted into a string (such as "1011010"). SHA The -256 hash algorithm takes a binary data matrix as input (each row corresponds to a type of prime, such as...). STZ The code for 01 is A00000000000B0000000000000C...). Finally, a 256-bit hash value (hexadecimal format) is output.

[0091] For example:

[0092] Input data: STZ The binary code for 01 → " A 00000000000 B 0000000000000 C ..."

[0093] Hash output: 5d6b7f8a3c1e9f2d4a7b0c6d8e1f2a3 ... (fixed length 64 characters).

[0094] Then the files are packaged into a composite data package, which binds the hash value with germplasm geographic information (latitude, longitude, altitude), in the following format: JSON .

[0095] Dynamic QR code generation can be used QR-Batch API Will JSON The data packet is encoded into a QR code and dynamically updated. Then, it is used... Hyperledger Fabric The framework writes data packets into a distributed ledger, ensuring that they are immutable.

[0096] The composite data packet also needs to be bound to environmental parameters. IoT sensors can be used to record the temperature during germplasm collection. ℃ ),humidity(% RH ),soil pH Value (e.g.) pH =6.5). Update JSON The data packet, for example, includes an `environment` field added to the program. Finally, the data packet containing the environment parameters is executed again. SHA -256 encryption ensures data integrity.

[0097] When implementing an encrypted construction system, the first step is to design the system modules and operational processes.

[0098] Among them, the implementation of the primer design and amplification module involves inputting the RT sequence of the reverse transcriptase transposon from *Vernicia fordii* (a type of vine). FASTA (Format), then output IRAP Primer sequences and amplification products. In one embodiment, the following can be used: SnapGene Software-designed primers, and after primer synthesis, they were used... PCR instrument( Bio-Rad T100) completes amplification.

[0099] The electrophoresis detection and data processing module takes PCR products as input and outputs a binary data matrix. CSV (File). Among them, electrophoresis images can be obtained through... ImageJ The software analyzes and automatically generates a 0 / 1 matrix. For example, if the strip intensity is greater than the threshold (e.g., 500 grayscale value), it is marked as 1; otherwise, it is marked as 0.

[0100] The code generation and data packet construction module takes a binary matrix and geographic environment data as input and outputs an encrypted data packet. JSON (Format). Can be called. Python of hashlib Library execution SHA- 256 encryption.

[0101] The QR code generation and data storage module primarily takes encrypted data packets as input and outputs dynamic QR codes and blockchain records. In one embodiment, it can use... qrcode The library generates a QR code and passes it. Hyperledger Fabric SDK Uploaded to the blockchain:

[0102] SHA The -256 algorithm ensures the uniqueness of each germplasm (collision probability ≈ 1.4 × 10⁻⁶). -29 Blockchain storage supports full lifecycle traceability (such as...). STZ 01. A complete record from collection to breeding. Dynamic QR codes allow for real-time updates of environmental data, adapting to complex field conditions. Finally, an electronic ID card for the tested germplasm is constructed using a barcode and QR code generator (http: / / qr-batch.com).

[0103] Table 2 PIC values ​​of 17 IRAP primers

[0104]

[0105] The constructed fingerprint codes are shown in Table 3.

[0106] Table 3. Fingerprint codes of 101 *Vernicia fordii* germplasm accessions

[0107]

[0108]

[0109]

[0110]

[0111]

[0112] Any aspects of this invention not described in detail are well-known to those skilled in the art.

[0113] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. Germplasm identification of a species of *Vernicia fordii* IRAP The mark, characterized in that, Should IRAP The mark used IRAP Primers are based on the retrotransposon of *Vernicia fordii*. RT Sequence design, wherein the sequence is used for the IRAP Label specificity IRAP Primers were selected from the following sequences: Primers IRAP 07, sequence is 5'- GCCGACCATTGTTGTTATGT -3'; Primers IRAP 19, sequence is 5'- AGGCGTCTGTTTGAGACCAT -3'; Primers IRAP 52, sequence is 5'- GCTGTATGCCAAATTGAGCA -3'; Primers IRAP 56, sequence is 5'- CCAAGTAAGGCTGGAAAACC -3'; Primers IRAP 59, sequence is 5'- CCGCGGATAGATGACTTGTT -3'; Primers IRAP 65, sequence is 5'- TAGTGATGCCATTCGGGTTA -3'; Primers IRAP 73, sequence is 5'- ACTTCCGCGGATAGATGACT -3'.

2. A device comprising the features described in claim 1 IRAP A kit for labeled primer combinations, characterized in that, The kit also includes [equipment for use with] PCR Other reagents for the reaction, said other reagents include at least PCR reaction buffer and ddH 2 O The kit is used for germplasm identification of *Vernicia fordii*.

3. The reagent kit according to claim 2, characterized in that, The PCR The reaction buffer solution must contain at least 50 components. mM KCl 10 mM Tris-HCl , pH 8.4, 1.5 mM MgCl 2 0.2 mM dNTPs .

4. An application of the method described in claim 1 IRAP A method for constructing electronic identity cards for *Vernicia fordii* germplasm, characterized in that: Includes the following steps: Based on the retrotransposon of *Vernicia fordii* Ty1-copia and Ty3-gypsy of RT Sequence Design IRAP Primers are used to target germplasm. PCR Amplification to obtain polymorphic amplification products; The amplification products were detected by 1.5% agarose gel electrophoresis, and a binary data matrix was established based on the presence or absence of bands. The data matrix is ​​converted into a unique encrypted fingerprint code using a hash algorithm, and a composite data packet is generated by combining the geographical location and altitude information of the germplasm collection. Dynamic QR code technology is used to encode the composite data packet into an electronic ID card and simultaneously upload it to a blockchain distributed database to achieve tamper-proof storage and traceability of germplasm information.

5. The method for constructing an electronic ID card for *Vernicia fordii* germplasm according to claim 4, characterized in that, The hash algorithm is as follows: SHA -256 encryption algorithm, and the composite data packet is further bound to environmental parameters during germplasm collection, including temperature, humidity, and soil. pH value.

6. An encryption construction system for implementing the electronic ID card of *Vernicia fordii* germplasm according to claim 4 or 5, comprising: Primer design and amplification module for use with reverse transcriptase transposons from *Vernicia fordii*. Ty1-copia and Ty3 -gypsy of RT Sequence Design IRAP Primers, and using the designed primers to target germplasm. PCR Amplification is performed to obtain polymorphic amplification products; The electrophoresis detection and data processing module is used to detect the polymorphic amplification products by 1.5% agarose gel electrophoresis and establish a binary data matrix based on the presence or absence of electrophoretic bands. The code generation and data packet construction module is used to convert the binary data matrix into a unique encrypted fingerprint code using a hash algorithm, and to generate a composite data packet by combining the geographical location, altitude information and environmental parameters of the germplasm collection. The QR code generation and data storage module is used to encode the composite data packet into an electronic ID card using dynamic QR code technology and simultaneously upload it to the blockchain distributed database to achieve tamper-proof storage and traceability of germplasm information.

Images