Immunogenic complex, vaccine and preparation method and application thereof

Abstract

The invention relates to the technical field of vaccines, in particular to an immunogenic compound, a vaccine and a preparation method and application thereof. According to the immunogenic compound provided by the invention, the antigen is displayed on the surface of the bacteriophage virus-like particle, and the nucleic acid with the same species source as the antigen is wrapped in the virus-like particle, so that the protein and the nucleic acid antigen are simultaneously delivered, and the immunogenic compound has relatively high antigen display efficiency and nucleic acid expression quantity. The immunogenic complex can simultaneously induce high-titer antigen-specific antibodies and neutralizing antibodies, and specific IFN gamma + T cell reaction of nucleic acid corresponding antigens. The vaccine based on the immunogenic complex can simultaneously induce effective humoral immunity and cellular immunity reactions, provides an effective vaccine strategy for prevention and treatment of antigen-related microbial infection and treatment of related diseases, and provides a new idea for development of vaccines for other infectious diseases or tumors.

Description

Technical Field

[0001] The present invention relates to the technical field of vaccines, and particularly to immunogenic complexes, vaccines, and their preparation methods and applications. Background Art

[0002] MS2 phage is a single-stranded positive-sense RNA phage belonging to the Leviviridae family. Its genome contains 3,569 nucleotides and encodes four proteins: capsid protein, maturase protein, replicase protein, and lysis protein. At the 5' end of the replicase gene, there is a 19-base stem-loop structure, which is the site where the capsid protein dimer recognizes the genomic RNA and initiates self-packaging (i.e., the packaging site, pac site). Meanwhile, during the assembly of MS2 virions, the packaging site can also serve as a translation regulatory element. When the amount of capsid protein exceeds the assembly requirement, the capsid protein dimer binds to the packaging site, preventing ribosomes from binding to the replicase initiation site, thereby inhibiting replicase translation. In MS2 phage, 178 copies of the capsid protein and one maturase protein encapsulate the genomic RNA to form a T = 3 icosahedral structure. With the in-depth study of MS2 phage, it has been found that when the packaging site sequence is fused with the exogenous nucleic acid sequence of interest, the interaction with the MS2 capsid protein is retained, enabling the packaging of various target RNA molecules into MS2 virus-like particles (VLPs). Research has shown that if the uracil (U) at position 5 of the stem-loop structure is replaced with cytosine (C) (pac site C variant), the affinity of the packaging site for the MS2 capsid protein will increase by 6 - 50 times compared to the wild type, thereby improving the packaging efficiency of MS2 virus-like particles and the tolerance of the length of the internally encapsulated RNA. In many studies, the sequence expressing the MS2 capsid protein and the cDNA fragment encoding the target RNA are constructed on the same plasmid or two plasmids, and in bacterial or yeast hosts, MS2 phage virus-like particles containing specific mRNA, miRNA, siRNA, or viral genomic RNA are packaged for use as nucleic acid quality control products or RNA delivery vectors. On the other hand, both the N-terminus and the AB loop of the MS2 capsid protein are located at relatively exposed positions on the surface of the phage icosahedral particle, allowing the insertion of exogenous peptide-encoding sequences to fully display exogenous peptide segments on the outside of the particle and play corresponding biological roles. This feature also makes MS2 virus-like particles widely used as vaccine vectors, densely arranging antigenic epitopes in a repetitive manner on the particle surface to effectively activate B cell responses in vivo and enhance the immunogenicity of antigen peptides. Therefore, the ability to specifically encapsulate exogenous RNA and display polypeptides on its capsid protein makes MS2 virus-like particles have the potential to be developed into a vaccine vector that can simultaneously deliver protein and mRNA antigens.

[0003] Epstein-Barr virus (EBV) belongs to human herpesvirus type 4 and infects more than 95% of the world's population. Most primary EBV infections are asymptomatic, and a few can cause infectious mononucleosis; while EBV that persists in latent infection in host cells can induce immortalized transformation of lymphocytes or epithelial cells, thereby causing the occurrence of various malignant tumors and autoimmune diseases such as post-transplant lymphoproliferative disease, Burkitt lymphoma, Hodgkin lymphoma, gastric cancer, and nasopharyngeal carcinoma. Recently, there have also been reports that EBV reactivation exacerbates the severity of COVID-19. Currently, there are no specific drugs or vaccines against EBV officially on the market. Therefore, the development of specific drugs and vaccines against EBV is of great significance for the prevention and treatment of EBV infection.

[0004] EBV envelope glycoproteins include gp350 / 220, gH and gL, gp42 and gB, which play a key role in receptor recognition, attachment, and virus-host membrane fusion during virus infection, and are important candidate antigen targets for EBV preventive vaccines. In addition, after EBV initially infects oropharyngeal epithelial cells, it further infects B cells in secondary lymphoid tissues and finally establishes latent infection, only expressing a few genes including Epstein-Barr nuclear antigen (EBNA) and latent membrane protein (LMP) genes. Among them, EBNA1 is the only core antigen that is expressed both in the latent phase and in the lytic phase and is involved in the maintenance of the EBV episomal genome. Studies have found that EBNA1-specific CD 4+ and CD 8+ T cells can effectively control the growth of EBV-immortalized epithelial cells or B cells. Summary of the Invention

[0005] The present invention provides an immunogenic complex, a vaccine, and methods for preparing and using the same.

[0006] The present invention develops an immunogenic complex and a dual-antigen vaccine based on phage virus-like particles that simultaneously deliver protein and mRNA antigens. The combination of the two antigens can simultaneously elicit high neutralizing antibody titers and T cell responses, thereby preparing a cocktail vaccine against microbial infections and cells infected with the microorganism.

[0007] Specifically, the present invention provides the following technical solutions.

[0008] In a first aspect, the present invention provides an immunogenic complex, which comprises a virus-like particle and an antigen covalently linked to the virus-like particle through the SpyCatcher-SpyTag system, and the covalent linkage enables the antigen to be displayed on the surface of the virus-like particle; wherein, the virus-like particle comprises a phage capsid protein and nucleic acid encapsulated therein; the nucleic acid does not contain nucleic acid from the host cell expressing the virus-like particle.

[0009] To allow for simple, rapid, and efficient display of large antigens on the surface of virus-like particles, the present invention utilizes the SpyCatcher-SpyTag protein ligation system to display antigens on the surface of virus-like particles.

[0010] In the present invention, host cells expressing the virus-like particles include, but are not limited to, insect cell SF9, etc.

[0011] Preferably, the nucleic acid and the antigen are derived from the same microorganism or the same animal cell.

[0012] Preferably, the nucleic acid is RNA. More preferably, it is mRNA.

[0013] Preferably, the phage is an Escherichia coli phage. Escherichia coli phages include MS2 phage, Qβ phage, or AP205 phage, etc.

[0014] Preferably, the phage is MS2 phage.

[0015] Preferably, the capsid protein is expressed in the form of a capsid protein dimer, and the SpyTag is fused to the N-terminus of the capsid protein dimer.

[0016] The present invention has found that, compared with expressing SpyTag at the AB loop position of one of the capsid proteins in the capsid protein dimer, after fusing SpyTag to the N-terminus of the capsid protein dimer, it has significantly higher coupling efficiency when coupling with an antigen fused to SpyCatcher, and during the coupling process, the virus-like particles have higher stability and are not easily degraded.

[0017] The outer surface of the virus-like particles formed by self-assembly of the above-mentioned fused SpyTag and capsid protein dimer displays 90 copies of SpyTag, and the SpyTag is covalently linked to the fusion protein of SpyCatcher and antigen, thereby achieving efficient display of the antigen on the surface of the virus-like particles.

[0018] Preferably, the SpyTag is linked to the capsid protein dimer through a first linker peptide, and the sequence of the first linker peptide is as shown in SEQ ID NO.1.

[0019] The present invention has found that, compared with using other linker peptide sequences, using (G4S)2 as the linker peptide can significantly improve the coupling efficiency between the capsid protein dimer fused with SpyTag and the antigen fused with SpyCatcher.

[0020] The amino acid sequence of the above-mentioned capsid protein dimer is as shown in SEQ ID NO.2.

[0021] Based on the amino acid sequence of the capsid protein dimer provided above and the codon rules, those skilled in the art can obtain the coding gene sequence of the capsid protein dimer. Due to the degeneracy of codons, the coding gene sequence is not unique, and all gene sequences capable of encoding and producing the above-mentioned capsid protein dimer are within the protection scope of the present invention.

[0022] In some specific embodiments of the present invention, the coding gene sequence of the capsid protein dimer is as shown in SEQ ID NO.11. This coding gene sequence is obtained by codon optimization based on the codon preference of insect cells.

[0023] Preferably, the SpyCatcher is linked to the antigen through a second linker peptide. The second linker peptide is a flexible linker peptide rich in glycine and serine. The SpyCatcher is fused to the N-terminus of the antigen.

[0024] Preferably, the nucleic acid and the antigen are derived from Epstein-Barr virus or severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).

[0025] Specifically, the antigen is the Epstein-Barr virus envelope glycoprotein gLgH, the Epstein-Barr virus envelope glycoprotein gp350, or the RBD sequence of the SARS-CoV-2 S protein.

[0026] The nucleic acid is the mRNA of Epstein-Barr virus nuclear antigen EBNA1, the mRNA of Epstein-Barr virus envelope glycoprotein gp350, the mRNA of Epstein-Barr virus envelope glycoprotein gLgH, the mRNA of Epstein-Barr virus envelope glycoprotein gB, or the mRNA of the SARS-CoV-2 nucleocapsid protein.

[0027] As a specific embodiment, the present invention develops an immunogenic complex and a dual-antigen vaccine based on MS2 bacteriophage virus-like particles for simultaneous delivery of protein and mRNA antigens against Epstein-Barr virus. First, the Epstein-Barr virus envelope glycoprotein gLgH or gp350 is selected as the protein antigen to be delivered, and the mRNA of the Epstein-Barr virus nuclear antigen EBNA1 is selected as the mRNA antigen to be delivered. The combined use of the two antigens can simultaneously induce a high neutralizing antibody titer and a T cell response, and then an Epstein-Barr virus cocktail vaccine against virus infection and virus-infected cells is prepared.

[0028] For Epstein-Barr virus, in the above immunogenic complex, the SpyCatcher is fused with the Epstein-Barr virus envelope glycoprotein, and the Epstein-Barr virus envelope glycoprotein comprises a fusion protein formed by gL protein and gH protein or the Epstein-Barr virus envelope glycoprotein is gp350 protein.

[0029] Preferably, the amino acid sequence of the gL protein is as shown in SEQ ID NO.3, and the amino acid sequence of the gH protein is as shown in SEQ ID NO.4.

[0030] Preferably, the amino acid sequence of the Epstein-Barr virus envelope glycoprotein gp350 is as shown in SEQ ID NO.5.

[0031] Preferably, SpyCatcher is fused to the N-terminus of the Epstein-Barr virus envelope glycoprotein.

[0032] In the fusion protein of the above SpyCatcher and the Epstein-Barr virus envelope glycoprotein, SpyCatcher and the Epstein-Barr virus envelope glycoprotein are preferably linked by a linker peptide. The linker peptide shown in SEQ ID NO.12 is preferably used.

[0033] In the above Epstein-Barr virus envelope glycoprotein, the gL protein and the gH protein are preferably linked by a linker peptide. The linker peptide shown in SEQ ID NO.12 is preferably used.

[0034] In the present invention, the amino acid sequence of SpyCatcher is as shown in SEQ ID NO.13, and the amino acid sequence of SpyTag is as shown in SEQ ID NO.14.

[0035] For Epstein-Barr virus, the amino acid sequence encoded by the mRNA of the nuclear antigen EBNA1 is as shown in SEQ ID NO.7.

[0036] Preferably, a 5'-UTR is further linked to the 5' end of the mRNA of the Epstein-Barr virus nuclear antigen EBNA1, and an MS2 phage packaging site and a 3'-UTR are sequentially linked to the 3' end in the 5' to 3' direction.

[0037] The present invention finds that linking the 5'-UTR, the mRNA of the Epstein-Barr virus nuclear antigen EBNA1, the MS2 phage packaging site, and the 3'-UTR in the above order can not only enable the EB virus nuclear antigen mRNA encapsulated inside the MS2 virus-like particles to be recognized and translated by the eukaryotic cell transcription system, but also the expression level of the Epstein-Barr virus nuclear antigen EBNA1 is significantly higher than that using other linking orders.

[0038] Preferably, the MS2 phage packaging site is two tandem MS2 phage packaging sites; the sequence of the MS2 phage packaging site is preferably as shown in SEQ ID NO.15. The sequence shown in SEQ ID NO.15 is a mutant in which uracil (U) at position 5 of the MS2 phage packaging site is replaced by cytosine (C).

[0039] The UTRs described above are the UTRs of human cell NADPH cytochrome b5 reductase CYBA, i.e., the 5'-UTR is the 5'-UTR of human cell NADPH cytochrome b5 reductase CYBA, and the 3'-UTR is the 3'-UTR of human cell NADPH cytochrome b5 reductase CYBA.

[0040] Preferably, the sequence of the 5'-UTR is as shown in SEQ ID NO.16, and the sequence of the 3'-UTR is as shown in SEQ ID NO.17.

[0041] Preferably, the coding gene sequence of the Epstein-Barr virus antigen mRNA is as shown in SEQ ID NO.18. It sequentially includes a 5'-UTR, the mRNA of Epstein-Barr virus nuclear antigen EBNA1, tandem MS2 bacteriophage packaging sites, and a 3'-UTR. The sequence of the mRNA of Epstein-Barr virus nuclear antigen EBNA1 is a sequence optimized according to the codon preference of insect cells.

[0042] The immunogenic complex described above displays Epstein-Barr virus envelope glycoprotein gLgH on the outside of the MS2 bacteriophage virus-like particles and encapsulates Epstein-Barr virus latency protein EBNA1 mRNA inside. This immunogenic complex can simultaneously induce high titers of gLgH-specific antibodies and neutralizing antibodies, as well as EBNA1-specific IFNγ + T cell responses.

[0043] For Epstein-Barr virus, the optional mRNA antigens to be delivered at least include any one of the following: the mRNA of envelope glycoprotein gp350, the amino acid sequence encoded by which is as shown in SEQ ID NO.5; the mRNA of envelope glycoprotein gLgH, the amino acid sequence encoded by which is as shown in SEQ ID NO.8; the mRNA of envelope glycoprotein gB, the amino acid sequence encoded by which is as shown in SEQ ID NO.9.

[0044] As another specific embodiment of the present invention, the present invention develops an immunogenic complex and a dual-antigen vaccine based on MS2 bacteriophage virus-like particles for simultaneous delivery of protein and mRNA antigens against SARS-CoV-2 virus. First, the RBD sequence of the S protein of SARS-CoV-2 is selected as the protein antigen to be delivered, and the mRNA of the SARS-CoV-2 nucleocapsid protein is selected as the mRNA antigen to be delivered. The combined use of the two antigens can simultaneously trigger high titers of neutralizing antibodies and T cell responses, and then a SARS-CoV-2 virus cocktail vaccine against virus infection and virus-infected cells is prepared.

[0045] For the SARS-CoV-2 virus, in the above immunogenic complex, the SpyCatcher is fused with the RBD of the S protein of SARS-CoV-2.

[0046] Preferably, the amino acid sequence of the RBD sequence of the SARS-CoV-2 S protein is as shown in SEQ ID NO.6.

[0047] Preferably, the SpyCatcher is fused to the N-terminus of the RBD of the S protein of SARS-CoV-2.

[0048] In the above fusion protein of SpyCatcher and the RBD of the S protein of SARS-CoV-2, SpyCatcher and the RBD of the S protein of SARS-CoV-2 are preferably linked by a linker peptide. Preferably, the linker peptide shown in SEQ ID NO.19 is used.

[0049] For the SARS-CoV-2 virus, the delivered mRNA antigen can be the mRNA of the SARS-CoV-2 nucleocapsid protein, and the amino acid sequence encoded by the mRNA of the SARS-CoV-2 nucleocapsid protein is as shown in SEQ ID NO.10. For the specific structure and sequence of the above delivered mRNA antigen against the SARS-CoV-2 virus, reference can be made to the mRNA of the Epstein-Barr virus antigen, and the mRNA of the Epstein-Barr virus nuclear antigen EBNA1 therein can be replaced with the mRNA of the SARS-CoV-2 nucleocapsid protein.

[0050] In a second aspect, the present invention provides a polynucleotide combination that encodes the immunogenic complex, which comprises: (1) A first polynucleotide: its sequence sequentially includes a SpyTag coding sequence, a first linker peptide coding sequence, and a phage capsid protein dimer coding sequence along the 5'-3' direction; (2) A second polynucleotide: its sequence sequentially includes a 5'-UTR, the coding sequence of the nucleic acid, two tandem phage packaging sites, and a 3'-UTR along the 5'-3' direction; And, (3) A third polynucleotide: its sequence sequentially includes a SpyCatcher coding sequence, a second linker peptide coding sequence, and the coding sequence of the antigen along the 5'-3' direction.

[0051] As a specific embodiment, the present invention provides a polynucleotide combination, and the combination comprises: (1) The first polynucleotide: Its sequence sequentially contains a SpyTag coding sequence, a first linker peptide coding sequence, and an MS2 phage capsid protein dimer coding sequence along the 5'-3' direction; (2) The second polynucleotide: Its sequence sequentially contains a 5'-UTR, an mRNA coding sequence of Epstein-Barr virus nuclear antigen EBNA1, two tandem MS2 phage packaging sites, and a 3'-UTR along the 5'-3' direction; And, (3) The third polynucleotide: Its sequence sequentially contains a SpyCatcher coding sequence, a second linker peptide coding sequence, and an Epstein-Barr virus envelope glycoprotein coding sequence along the 5'-3' direction; The Epstein-Barr virus envelope glycoprotein coding sequence contains an Epstein-Barr virus gL protein coding sequence, a third linker peptide coding sequence, and an Epstein-Barr virus gH protein coding sequence.

[0052] Preferably, the amino acid sequence of the capsid protein dimer is as shown in SEQ ID NO.2, and / or the sequence of the first linker peptide is as shown in SEQ ID NO.1, and / or the amino acid sequence of the gL protein is as shown in SEQ ID NO.3, and / or the amino acid sequence of the gH protein is as shown in SEQ ID NO.4, and / or the amino acid sequence encoded by the mRNA of the nuclear antigen EBNA1 is as shown in SEQ ID NO.7, and / or the sequence of the MS2 phage packaging site is as shown in SEQ ID NO.15.

[0053] Preferably, the sequences of the second linker peptide and the third linker peptide are as shown in SEQ ID NO.12.

[0054] In a third aspect, the present invention provides a combination of recombinant vectors, and the recombinant vectors include: (1) The first recombinant vector: containing a polynucleotide, and the polynucleotide is (1) and (2) in the polynucleotide combination described in the second aspect above; (2) The second recombinant vector: containing a polynucleotide, and the polynucleotide is (3) in the polynucleotide combination described in the second aspect above.

[0055] The backbone of the above first recombinant vector can be any expression plasmid suitable for the Bac-to-Bac baculovirus insect expression system, including but not limited to the pFastBacDual vector. Preferably, the polynucleotides in (1) and (2) in the polynucleotide combination described in the second aspect above are respectively cloned downstream of two promoters of the pFastBacDual vector.

[0056] The backbone of the above-mentioned second recombinant vector can be any expression plasmid capable of expressing the target gene in bacteria, fungi or animal cells. For example, if Escherichia coli is selected as the host cell, the backbone of the second recombinant vector is an Escherichia coli expression plasmid.

[0057] Fourthly, the present invention provides a host cell combination, which comprises: (1) The first host cell: containing a recombinant vector, which is the (1) in the recombinant vector combination described in the third aspect above; (2) The second host cell: containing a recombinant vector, which is the (2) in the recombinant vector combination described in the third aspect above.

[0058] The above-mentioned first host cell can be any host cell and its intermediate host cell capable of enabling the self-assembly of the MS2 phage capsid protein into virus-like particles, including bacteria, fungi or animal cells. As an example, the first host cell is Escherichia coli containing a baculovirus shuttle vector and insect cells.

[0059] The above-mentioned second host cell can be any bacteria, fungi or animal cells capable of expressing heterologous proteins. As an example, the second host cell is an animal cell line (such as the 293F cell line).

[0060] Fifthly, the present invention provides a method for preparing the above-mentioned immunogenic complex. The first recombinant vector described in (1) of the third aspect above is introduced into Escherichia coli containing a baculovirus shuttle vector to obtain a recombinant bacmid; The recombinant bacmid is transfected into insect cells to obtain the virus-like particles; The second recombinant vector described in (2) of the third aspect above is introduced into a host cell to obtain a fusion protein of SpyCatcher and the antigen; The fusion protein of SpyCatcher and the antigen is linked to the virus-like particles.

[0061] As a specific implementation manner, the present invention provides a method for preparing the above-mentioned immunogenic complex. The method includes: expressing the coding sequence of the capsid protein dimer fused with SpyTag at the N-terminus and the coding sequence of the EB virus antigen mRNA by using a baculovirus-insect cell expression system to prepare the virus-like particles; introducing the coding sequence of the fusion protein of SpyCatcher and the EB virus envelope glycoprotein into a host cell for expression to obtain the fusion protein of SpyCatcher and the EB virus envelope glycoprotein, and linking the fusion protein of SpyCatcher and the EB virus envelope glycoprotein to the virus-like particles to obtain the immunogenic complex.

[0062] In one embodiment of the present invention, the EB virus antigen mRNA coding sequence carrying the MS2 phage packaging site and the MS2 capsid protein dimer coding sequence fused with SpyTag are respectively cloned downstream of two promoters of the pFastBacDual vector, and the Bac-to-Bac baculovirus insect expression system is used for the assembly of recombinant virus-like particles. Preferably, the MS2 capsid protein dimer coding sequence fused with SpyTag is as shown in SEQ ID NO.20.

[0063] In some embodiments of the present invention, the coding sequence of the fusion protein of SpyCatcher and EB virus envelope glycoprotein is as shown in SEQ ID NO.21.

[0064] In a sixth aspect, the present invention provides any one of the following applications of the above-mentioned immunogenic complex or the polynucleotide combination or the recombinant vector combination or the host cell combination: (1) Preparing a drug for preventing and / or treating microbial infections from which the antigen is derived; (2) Preparing a drug for preventing and / or treating diseases caused by microbial infections from which the antigen is derived; (3) Preparing a drug for preventing and / or treating diseases caused by abnormal expression of the antigen.

[0065] In a seventh aspect, the present invention provides the application of the above-mentioned immunogenic complex or the polynucleotide combination or the recombinant vector combination or the host cell combination in the preparation of a drug for preventing and / or treating microbial infections or diseases caused by microbial infections.

[0066] Wherein, the microorganism is Epstein-Barr virus or severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).

[0067] In an eighth aspect, the present invention provides a drug, which comprises the above-mentioned immunogenic complex.

[0068] Preferably, the drug further comprises a pharmaceutically acceptable carrier and / or excipient.

[0069] Preferably, the drug is a vaccine.

[0070] Preferably, the vaccine further comprises an adjuvant. The adjuvant is preferably an aluminum adjuvant, or an aluminum adjuvant and a CpG adjuvant.

[0071] In a ninth aspect, the present invention provides the application of the above-mentioned immunogenic complex or the drug in preventing and / or treating microbial infections from which the antigen is derived or diseases caused thereby.

[0072] The beneficial effects of the present invention at least include: The immunogenic complex provided by the present invention displays antigens on the surface of phage virus-like particles and encapsulates nucleic acids of the same species source as the antigens inside the virus-like particles, achieving the simultaneous delivery of protein and nucleic acid antigens, and having a high antigen display efficiency and nucleic acid expression level. This immunogenic complex can simultaneously induce high titers of antigen-specific antibodies and neutralizing antibodies, as well as specific IFNγ + T cell responses of nucleic acid corresponding antigens. Vaccines based on this immunogenic complex can simultaneously induce effective humoral and cellular immune responses, providing an effective vaccine strategy for the prevention and treatment of antigen-related microbial infections and the treatment of related diseases, and at the same time providing new ideas for the development of other infectious disease or tumor vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0073] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following will briefly introduce the drawings required for use in the examples or the description of the prior art. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0074] Figure 1 Expression purification and morphological characterization of SpyTag-MS2 ( luc ) virus-like particles in Example 1 of the present invention; wherein, A is the SDS-PAGE diagram of stratified sampling after purifying SpyTag-MS2 ( luc ) virus-like particles by 20%-60% continuous sucrose density gradient centrifugation; B is the result diagram of SpyTag-MS2 ( luc ) virus-like particles photographed under a transmission electron microscope; C is the particle size diagram of SpyTag-MS2 ( luc ) virus-like particles detected by dynamic light scattering DLS.

[0075] Figure 2 Efficiency evaluation of protein display on the surface of SpyTag-MS2 ( luc ) virus-like particles in Example 2 of the present invention; wherein, A is the SDS-PAGE diagram before and after affinity chromatography purification of SpyCatcher protein on Ni-NTA column and treatment with ULP enzyme; B is the SDS-PAGE diagram of affinity chromatography purification of SpyCatcher-gLgH protein on Ni-NTA column; C is that SpyCatcher protein is respectively combined with ABSpyTag(G4S)-MS2 ( luc ), ABSpyTag(G4S)2-MS2 ( luc ), and NSpyTag(G4S)2-MS2 ( luc)SDS-PAGE diagram after the connection of virus-like particles; Image J was used to perform grayscale analysis on the MS2 CP dimer band to calculate the coupling efficiency of virus-like particles. D shows the SDS-PAGE diagrams after the connection of the SpyCatcher-gLgH fusion protein with ABSpyTag(G4S)-MS2( luc ), ABSpyTag(G4S)2-MS2( luc ), and NSpyTag(G4S)2-MS2( luc ); Image J was used to perform grayscale analysis on the MS2 CP dimer band to calculate the coupling efficiency of virus-like particles.

[0076] Figure 3 This is the evaluation of the ability of SpyTag-MS2 virus-like particles to encapsulate RNA inside in Example 3 of the present invention. Among them, A shows six mRNA sequences of the luciferase gene with different arrangements of UTR, pac site C variant tandem, and the luciferase gene CDs; B shows the detection of the expression efficiency of the luciferase gene after the transfection of the six mRNAs into 293T cells and Raw264.7 cells; C shows the quantitative PCR detection of the efficiency of encapsulating six mRNAs with different lengths, namely EBV ebna1 (1095 nt), SARS–CoV-2 nucleocapsid (1401 nt), EBV gp350 (1419 nt), firefly luciferase (1691 nt), EBV gb (2304 nt), and EBVglgh (2520 nt), by SpyTag-MS2 virus-like particles, with the number of complete RNA gene copies encapsulated by 100 μg of virus-like particles as an indication; D shows the translation efficiency of luciferase RNA encapsulated inside the SpyTag-MS2(luc) virus-like particles distributed in layers 8, 9, 10, 11, and 12 of the 20%-60% continuous sucrose density gradient centrifugation detected by the luciferase reporter experiment.

[0077] Figure 4Purification and particle morphology characterization of RBD-NSpyTag(G4S)2-MS2(nucleocapsid) virus-like particles in Invention Example 4; wherein, A is the SDS-PAGE diagram after the SpyCatcher-RBD protein is linked to the NSpyTag(G4S)2-MS2(nucleocapsid) virus-like particles at different molar ratios; B is the agarose gel electrophoresis diagram after the SpyCatcher-RBD protein is linked to the NSpyTag(G4S)2-MS2(nucleocapsid) virus-like particles at different molar ratios, with nucleic acid and protein staining; C is the purification and separation of the RBD-NSpyTag(G4S)2-MS2(nucleocapsid) virus-like particles and the free SpyCatcher-RBD protein by a Hiload 16 / 600 superdex 200 pergrade chromatography column; D is the SDS-PAGE detection diagram of the RBD-NSpyTag(G4S)2-MS2(nucleocapsid) virus-like particles; E is the negative staining transmission electron microscopy image of the RBD-NSpyTag(G4S)2-MS2(nucleocapsid) virus-like particles.

[0078] Figure 5 Purification and particle morphology characterization of gp350-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles in Invention Example 5; wherein, A is the SDS-PAGE diagram after the SpyCatcher-gp350 protein is linked to the NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles at different molar ratios; B is the agarose gel electrophoresis diagram after the SpyCatcher-gp350 protein is linked to the NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles at different molar ratios, with nucleic acid and protein staining; C is the purification and separation of the gp350-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles and the free SpyCatcher-gp350 protein by a Hiload 16 / 600 superdex 200 pergrade chromatography column; D is the SDS-PAGE detection diagram of the gp350-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles; E is the negative staining transmission electron microscopy image of the gp350-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles.

[0079] Figure 6 Purification and particle morphology characterization of gLgH-NSpyTag(G4S)2-MS2(ebna1 )Purification of virus-like particles and characterization of particle morphology; among them, A shows the purification and separation of gLgH-NSpyTag(G4S)2-MS2 ebna1 ) virus-like particles and free SpyCatcher-gLgH protein by Hiload 16 / 600 superdex 200 pergrade chromatography column; B is the SDS-PAGE detection diagram of gLgH-NSpyTag(G4S)2-MS2 ebna1 ) virus-like particles; C is the result diagram and two-dimensional reconstruction diagram of gLgH-NSpyTag(G4S)2-MS2 ebna1 ) virus-like particles taken under a transmission electron microscope; D is the binding ability of gLgH-NSpyTag(G4S)2-MS2 ebna1 ) virus-like particles to the gLgH neutralizing antibody 1D8 detected by ELISA.

[0080] Figure 7 This is the detection of the level of anti-gLgH specific antibody response induced by gLgH-NSpyTag(G4S)2-MS2 ebna1 ) virus-like particles in Example 7 of the present invention; among them, A is the immunization program of C57BL / 6 mice; B is the detection of anti-gLgH IgG antibody at different time points after immunizing mice with gLgH-NSpyTag(G4S)2-MS2 ebna1 ) virus-like particles by ELISA.

[0081] Figure 8 This is the detection of the level of EBV neutralizing antibody induced by gLgH-NSpyTag(G4S)2-MS2 ebna1 ) virus-like particles in Example 8 of the present invention; among them, A is the neutralizing antibody level of gLgH-NSpyTag(G4S)2-MS2 ebna1 ) virus-like particles against EBV-infected B cells; B is the neutralizing antibody level of gLgH-NSpyTag(G4S)2-MS2 ebna1 ) virus-like particles against EBV-infected epithelial cells.

[0082] Figure 9 This is the detection of EBNA1 ebna1 ) specific T cells induced by gLgH-NSpyTag(G4S)2-MS2 virus-like particles in Example 9 of the present invention; among them, A is the immunization program of C57BL / 6 mice, and the number of EBNA1 + IFNγ + specific T cells is detected by ELISPOT; B is EBNA1 + IFNγ + specific T cell number; B is EBNA1+ IFNγ + Statistical results of the number of specific T cells. Specific implementation manners

[0083] The sequences involved in the present invention and their corresponding information are shown in Table 1.

[0084] Table 1 To make the objectives, technical solutions and advantages of the present invention clearer, the technical solutions in the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative efforts fall within the scope of protection of the present invention.

[0085] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods. The materials, reagents, etc. used, unless otherwise specified, can all be obtained from commercial channels. For the quantitative tests in the following examples, three repeated experiments are set, and the results are averaged.

[0086] Example 1 Construction of ABSpyTag(G4S)-MS2( luc ) virus-like particles Materials: All restriction enzymes were purchased from ThermoFisher, and all primers were synthesized by Beijing Tsingke Biotechnology. 2×Prime STAR was purchased from Takara, the gel extraction kit was purchased from Shanghai Sangon Biotech, the homologous recombination kit, Top10 Escherichia coli competent cells, DNaseI and RNaseA were purchased from Beijing TransGen Biotech, the plasmid miniprep kit was purchased from Beijing Tiangen Biochemical Technology, DH10Bac competent cells were purchased from Beijing Bomed, the bacmid small-scale extraction kit for baculovirus shuttle vector was purchased from Beyotime, kanamycin, gentamicin, tetracycline and X-Gal were purchased from Shanghai Sangon Biotech, IPTG was purchased from inalco, Grace medium, Cellfectin II Reagent transfection reagent, Sf-900TM II SFM (1×) medium and Sf-900TM (1.3×) medium were purchased from ThermoFisher, the gp64 antibody was purchased from Santa Cruz, the HRP-goat anti mouse secondary antibody was purchased from EarthOx, the chromogenic substrate TMB membrane Peroxidase Substrate was purchased from Sera care, sucrose was purchased from Sigma, and the ultracentrifugation tubes were purchased from Beckman.

[0087] 1. Construction of ABSpyTag(G4S)-MS2( luc ) virus-like particle expression plasmid Using the dual-expression vector pFastBac of the baculovirus Bac-to-Bac expression system TM Dual, insert the coding sequence of the MS2 capsid protein tandem dimer after the polyclonal site behind the polyhedrin promoter PH. The first capsid protein CP in the tandem dimer is wild-type (SEQ ID NO.22), and the SpyTag coding sequence (SEQ ID NO.23) is inserted between the 15th and 16th amino acids (TG, located in the AB loop) of the second capsid protein for expressing the capsid protein assembled into VLP; the coding sequence of the firefly luciferase gene (SEQ ID NO.24) with two consecutive pac site C variants (SEQ ID NO.15) is inserted into the polyclonal site behind the P10 promoter for transcribing the firefly luciferase mRNA encapsulated inside the VLP. The SpyTag-MS2 capsid protein dimer interacts with the pac site-containing firefly luciferase mRNA to complete the self-assembly of MS2 virus-like particles in insect cells.

[0088] The nucleic acid sequence encoding the tandem dimer of MS2 capsid protein was optimized for the codons of the insect cell sf9 host. The nucleic acid sequence at positions 1-2 of the second capsid protein was replaced with GCTAGC, and the Nhe I restriction site was introduced by synonymous amino acid mutation; the nucleic acid sequence at positions 10-11 was replaced with GTCGAC, and the Sal I restriction site was introduced by synonymous amino acid mutation; the SpyTag coding sequence was inserted between positions 15-16 of the amino acids, and a GGGGS linker sequence (SEQ ID NO.25) was added to each of the N-terminus and C-terminus of the SpyTag sequence, and the GS amino acid nucleic acid sequence at the C-terminus was replaced with GGATCC, and the BamH I restriction site was introduced by synonymous amino acid mutation. The introduction of the three restriction sites of NheI, Sal I, and BamH I is to facilitate the modification of the second capsid protein in the future and flexibly replace the inserted foreign peptide segments. The above-mentioned coding sequence of the MS2 capsid protein tandem dimer fused with SpyTag was named CP-ABSpyTag(G4S)CP and was synthesized by BGI (SEQ ID NO.26). Primers with restriction sites were designed to perform PCR amplification on the CP-ABSpyTag(G4S)CP fragment. The upstream primer introduced a plasmid homologous arm, an EcoR I restriction site, and a kozak sequence GCCACC, and the downstream primer introduced a stop codon, a Hind III restriction site, and a plasmid homologous arm. The PCR reaction system was as follows: 2×Prime STAR 25 μL, upstream primer (10 μM) 1 μL, downstream primer (10 μM) 1 μL, template 1 μL, ddH2O 23 μL, with a total volume of 50 μL. The PCR reaction conditions were as follows: pre-denaturation at 98 °C for 2 minutes; denaturation at 98 °C for 10 seconds; annealing at 60 °C for 10 seconds; extension at 72 °C for 30 seconds; a total of 35 cycles were performed, and finally an additional 5 minutes of full extension time was added. pFastBac TM The pFastBac Dual expression plasmid was digested with EcoRI and Hind III, and the fragments were recovered by agarose gel electrophoresis. According to the molar ratio of pFastBac Dual vector: CP-ABSpyTag(G4S)-CP fragment of 1:2, homologous recombination was carried out at 50 °C for 15 minutes under the action of homologous recombinase. The recombinant product was transformed into E. coli Top 10 competent cells, incubated on ice for 30 minutes, heat-shocked at 42 °C for 45 seconds, incubated on ice for 2 minutes, added with 900 μL of LB medium without antibiotics, placed on a shaker at 37 °C, and cultured at 220 rpm for 1 h. 200 μL of the bacterial solution was transferred to an LB solid medium plate containing 50 μg / mL ampicillin and cultured at 37 °C for 12 hours. The next day, single colonies were picked and sequenced for verification. The colonies with correct sequencing were amplified and cultured to 5 mL, and the plasmid pFastBac-PH ABSpyTag(G4S)dMS2CP was extracted using a plasmid extraction kit.

[0089] Using the pGL3 luciferase reporter plasmid as a template, primers with restriction sites at both ends were designed, and the luciferase-pac site C variant tandem fragment was amplified by PCR. The upstream primer was added with a plasmid homologous arm and an XhoI restriction site, and the downstream primer was added with a stop codon TAA, two tandem pac site C variants, a Kpn I restriction site, and a plasmid homologous arm. The pFastBac-PH ABSpyTag(G4S)dMS2 CP plasmid obtained in the previous step was digested with Xho I and KpnI, recovered by agarose gel electrophoresis, and homologously recombined with the amplified luciferase-pac site C variant tandem fragment. The homologous recombination product was transformed into E. coli Top 10 competent cells, and correct clones were screened by sequencing. The colonies with correct sequencing were amplified and cultured to 5 mL, and the plasmid pFastBac-PH ABSpyTag(G4S)dMS2 CP-P10luc C tandem was extracted using a plasmid extraction kit.

[0090] Among them, the amplification primers for the EcoRI-CP-ABSpyTag(G4S)CP-HindIII fragment are described as follows.

[0091] Primer F (SEQ ID NO.37): CGTCCCACCATCGGGCGAATTCGCCACCATGGCTTCCAACTTCACCCAGTTCG; Primer R (SEQ ID NO.38): CCTCTAGTACTTCTCGACAAGCTTTTAGTAGATACCGGAGTTAGCAGCG; The amplification primers for the XhoI-luciferase-pac site C variant tandem-KpnI fragment are described as follows.

[0092] Primer F (SEQ ID NO.39): CTTGATCACCCGGGATCTCGAGGCCACCATGGAAGACGCCAAAAACATAAAG; Primer R (SEQ ID NO.40): GCCTCCCCCATCTCCCGGTACCACATGGGTGATCCTCATGTACATGGGTGATCCTCATGTTTACACGGCGATCTTTCCGC.

[0093] 2. Expression of ABSpyTag (G4S)-MS2( luc ) virus-like particles in insect cells sf9 After obtaining the recombinant donor plasmid pFastBac-PH ABSpyTag (G4S)-dMS2 CP-P10 luc C tandem, it was transformed into DH10Bac competent cells. Through screening with three antibiotics and blue-white screening (kanamycin / gentamicin / tetracycline / IPTG / X-Gal) and PCR identification, the recombinant bacmid rBacmid-ABSpyTagMS2-luciferase mRNA was obtained. The recombinant bacmid was transfected into insect cells sf9 to obtain recombinant baculovirus. The P3 generation recombinant baculovirus was further used to infect sf9 cells for large-scale expression of ABSpyTag-MS2( luc ) virus-like particles.

[0094] (1) Preparation of recombinant bacmid Thaw DH10Bac competent cells on ice, add 1 μg of recombinant donor plasmid pFastBac-PH ABSpyTag (G4S)dMS2 CP-P10 luc C tandem, mix gently, and incubate on ice for 30 minutes. Heat shock at 42 °C for 90 seconds and then on ice for 2 minutes. Add 900 μL of SOC medium pre-equilibrated to room temperature, place it on a shaker at 37 °C, and culture at 220 rpm for 4 hours. Use SOC medium to prepare 10 0 10 -1 10 -2 10 -3Bacterial suspensions of four dilution gradients. Take 100 μL of the bacterial suspension at each dilution and spread it on solid LB medium plates containing 50 μg / mL kanamycin, 7 μg / mL gentamicin, 10 μg / mL tetracycline, 40 μg / mL IPTG, and 24 μg / mL X-Gal, and incubate in a 37°C constant temperature incubator for 48 hours. Pick white colonies and dissolve them thoroughly with 20 μL of LB medium containing three antibiotics (50 μg / mL kanamycin, 7 μg / mL gentamicin, 10 μg / mL tetracycline) as a template for colony PCR, with the primers being M13 universal primers. The PCR reaction conditions are as follows: pre-denaturation at 98°C for 2 minutes; denaturation at 98°C for 10 seconds; annealing at 51°C for 15 seconds; extension at 72°C for 3 minutes; a total of 35 cycles are carried out, and finally, an additional 5-minute full extension time is added. The PCR products are identified by 1% agarose gel electrophoresis, and the colonies identified as positive by PCR are further verified by sequencing. Finally, the positive colonies are inoculated into LB medium containing three antibiotics (50 μg / mL kanamycin, 7 μg / mL gentamicin, 10 μg / mL tetracycline), shaken and cultured at 37°C for 16 h, and the recombinant bacmid is extracted using a small-scale extraction kit for the baculovirus shuttle vector bacmid, named rBacmid-ABSpyTagMS2-luciferase.

[0095] (2)Preparation of recombinant baculovirus The density of sf9 cells grows to 1.5 - 2.5×10 6 cells / mL and is in the logarithmic growth phase. 15 - 30 minutes before transfection, resuspend the cells with serum-free and antibiotic-free Grace medium, plate them in a 6-well plate, 0.4×10 6cells / mL, 2 mL per well, place in an incubator at 27°C or at room temperature to allow the cells to adhere. Transfection is carried out according to the instructions of the Cellfectin II Reagent transfection reagent as follows: Add 100 μL of serum-free and antibiotic-free Grace medium to a 1.5 mL EP tube, add 8 μL of transfection reagent, and briefly vortex and mix well; in another 1.5 mL EP tube, add 100 μL of serum-free and antibiotic-free medium and 3 μL of bacmid, and gently mix well; mix the diluted bacmid with the diluted Cellfectin II, gently mix well, and incubate at room temperature for 15 - 30 minutes; add the transfection mixture dropwise to the adherent cells, and incubate at 27°C for 5 hours; after 5 hours, aspirate the transfection mixture, add 2 mL of complete medium (Grace medium containing additives + 10% FBS), and further culture at 27°C. When the cells reach 70% - 80% lesion, collect the culture supernatant to obtain the P1 generation recombinant baculovirus vBacmid-ABSpyTagMS2-luciferase. Infect normal sf9 cells with the P1 generation virus to obtain the P2 generation virus, and infect sf9 cells again with the P2 generation virus to obtain the P3 generation virus.

[0096] (3)Determination of baculovirus titer The density of sf9 cells grows to 1.5 - 2.5×10 6 cells / mL and is in the logarithmic growth phase. Dilute the cells to 1×10 6 cells / mL, add 100 μL to each well of a 96-well plate, and incubate at 27°C for 1 hour to allow the cells to adhere. Dilute the P3 generation virus stock solution with Sf-900 TM II SFM (1×) medium, 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , 10 -8 for a total of 8 gradients. Aspirate the original medium in the 96-well plate, add 50 μL of virus dilution to each well, and have 3 replicates for each dilution. Incubate at 27°C for 1 hour, aspirate the virus solution, and add 50 μL of 0.55% overlay medium. Preparation of 0.55% overlay medium: 10 mL of 2.4% carboxymethyl cellulose + 33.3 mL of Sf-900 TM(1.3×) medium, cultured at 27 °C for 48 hours. Add 150 μL of 4% paraformaldehyde to each well for fixation for 10 min at room temperature. Discard the supernatant, wash three times with 200 μL / well of 0.05% PBST. Add 50 μL of 5% goat serum to each well and block at room temperature for 30 minutes. Discard the supernatant, wash three times with 200 μL / well of 0.05% PBST. Dilute the gp64 antibody at 1:200, add 50 μL to each well, and incubate at 37 °C for two hours or overnight at 4 °C. Discard the supernatant, wash three times with 200 μL / well of 0.05% PBST. Dilute the secondary antibody HRP-goat anti-mouse at 1:500, add 50 μL to each well, and incubate at 37 °C for 1 hour. Discard the supernatant, wash three times with 200 μL / well of 0.05% PBST. Add 50 μL of TMB membrane Peroxidase substrate to each well and develop color at room temperature until obvious blue spots are visible under the microscope. Virus titer infectious units per ml (IFU / ml) = number of blue spots × corresponding dilution factor × 20.

[0097] 3. Purification of ABSpyTag(G4S)-MS2( luc ) virus-like particles (1) Infect P3 generation recombinant baculovirus vBacmid-ABSpyTagMS2-luciferase at moi = 1 into 1 L of sf9 cells at a density of 2×10 6 cells / mL, place in a 27 °C shaking incubator, and culture at 110 rpm for 72 hours.

[0098] (2) Centrifuge at 4000 rpm at 4 °C for 35 minutes to collect the cells. Resuspend the cell pellet with 80 mL of TBS solution (10 mM Tris-HCl, 100 mM NaCl, 1 mM MgCl2, 0.1 mM EDTA, pH 7.4), sonicate for 15 min with 5 s on, 9 s off, 35% Amplitude until the solution is clear and transparent. Centrifuge at 12000 rpm for 45 min at 4 °C to remove cell debris, collect the supernatant, and filter through a 0.45 μm PVDF membrane. Add PEG6000 (w / v) at a final concentration of 20% and 1 M NaCl, and precipitate overnight at 4 °C. Centrifuge at 12000 rpm at 4 °C for 45 minutes, discard the supernatant, add 20 mL of TBS to dissolve the white precipitate overnight. After the precipitate is completely dissolved, add 10 U / mL DNaseI and 10 μg / mL RNaseA, and treat at 37 °C for 1 h. Add chloroform at a volume ratio of 1:1, immediately invert and mix well, centrifuge at 12000 rpm at 4 °C for 15 minutes, take the upper aqueous phase, and concentrate with a 100 KDa ultrafiltration tube.

[0099] (3)Purify ABSpyTag(G4S)-MS2( luc ) virus-like particles by 20%-60% continuous sucrose density gradient centrifugation. 20% sucrose solution: Add 10 g of sucrose to TBS solution, dissolve completely and make up to 50 mL, filter through a 0.22 μm PVDF membrane. 60% sucrose solution: Add 30 g of sucrose to TBS solution, dissolve completely and make up to 50 mL, filter through a 0.22 μm PVDF membrane. Use a pipette to sequentially add 20% sucrose solution and 60% sucrose solution to an ultracentrifuge tube. Configure a 20%-60% continuous sucrose density gradient using a Biocomp automatic density gradient preparation instrument GRADIENT MASTER108, and the program is Long Sucr 20-60% wv 2St. Slowly add more than 1 mL of protein concentrate above each ultracentrifuge tube. Use a Himac ultracentrifuge, P40ST rotor, 150,000 RCF, 4 °C, and centrifuge for 22 hours. After ultracentrifugation, sample sequentially from top to bottom, 1 mL / layer. Detect the position of ABSpyTag(G4S)-MS2( luc ) virus-like particles by SDS-PAGE protein electrophoresis, and use a 100KDa ultrafiltration concentration tube to remove sugar and replace it with TBS buffer.

[0100] 4. Morphological characterization of ABSpyTag(G4S)-MS2( luc ) virus-like particles (1)Measure the diameter and polydispersity of ABSpyTag(G4S)-MS2( luc ) virus-like particles using a DynaPro Titan DLS instrument from Wyatt Technology. Dilute the virus-like particles with TBS solution to 0.05 mg / mL, add to a microplate for analysis, and measure at room temperature.

[0101] (2)Observe the size and morphology of ABSpyTag(G4S)-MS2( luc ) virus-like particles by transmission electron microscopy. Dilute the virus-like particles with PBS solution to 0.2 mg / mL, take 5 μL of the diluted solution and drop it on a 300-mesh carbon film copper grid, and adsorb for 1 min; gently suck the liquid from the edge of the copper grid with filter paper, drop 5 μL of 2% uranyl acetate and incubate for staining for 2 min, and wash 2 times; suck off the excess liquid with filter paper and air dry at room temperature; after air drying, place the sample on a Tecnai Spirit (120 kV) transmission electron microscope for observation.

[0102] Result: The tandem dimer CP-ABSpyTag(G4S)CP of the MS2 capsid protein fused with SpyTag was successfully expressed in sf9 cells and self-assembled into virus-like particles. As Figure 1For A, after collecting samples by sucrose density gradient centrifugation in layers, detection by SDS-PAGE showed obvious target protein bands visible from layer 8 to layer 13, about 30 KD, with the highest abundance in layers 9 and 10. Samples from layers 9 and 10 were collected, deglycosylated and concentrated, and the particle size of virus-like particles was analyzed by dynamic light scattering, and the particle morphology was observed by transmission electron microscopy. ABSpyTag(G4S)-MS2( luc ) The virus-like particles had good dispersibility and uniformity, with a diameter of about 26.8 nm, consistent with the expected size, as shown in Figure 1 B and C of

[0103] Example 2 Influence of the Linkage Mode of SpyTag and MS2 Capsid Protein Tandem Dimer on the Surface Display of SpyCatcher Fusion Protein by Virus-Like Particles Materials: All restriction enzymes were purchased from ThermoFisher, and all primers were synthesized by Beijing Tsingke Biotechnology. Imidazole and PMSF were purchased from Shanghai Sangon Biotech, the endotoxin-free plasmid large-scale extraction kit was purchased from Tiangen Biotech, the 293F cell line was purchased from Life technologies, the OPM-293 CD05 medium and feed were purchased from Optmize, the transfection reagent PEI was purchased from polyscience, the Vivaflow 200 tangential flow ultrafiltration device was purchased from Sartorius, and all ultrafiltration concentration tubes were purchased from Millipore.

[0104] 1. Construction, Expression and Purification of ABSpyTag(G4S)2-MS2( luc ) Virus-Like Particles To ensure that SpyTag was fully exposed on the surface of MS2 virus-like particles and tolerate the display of larger antigens, ABSpyTag(G4S)2-MS2( luc) Virus-like particle variant, the GGGGS linker on both sides of SpyTag was extended to GGGGSGGGGS. The modified SpyTag-MS2 capsid protein dimer was named CP-ABSpyTag(G4S)2-CP, and its nucleic acid sequence was SEQ ID NO.27. Using the pFastBac-PH ABSpyTag(G4S)dMS2 CP-P10 luc C tandem plasmid as a template, the linker at both ends of SpyTag was amplified by PCR (primer sequences are shown below). The amplified target fragment and the pFastBac-PH ABSpyTag(G4S)dMS2 CP-P10 luc C tandem plasmid were respectively double-digested with SalI and BamH I, recovered by agarose gel electrophoresis, and homologous recombination was carried out at a molar ratio of vector:target fragment of 1:2, and then transformed into competent Escherichia coli. The plasmid was extracted from the positive clone with correct sequencing and named pFastBac-PH ABSpyTag(G4S)2dMS2 CP-P10 luc Ctandem.

[0105] Use the Bac to bac baculovirus expression system to express ABSpyTag(G4S)2-MS2( luc ) virus-like particles, and purify them by continuous sucrose density gradient centrifugation at 20%-60%. The method is the same as in Example 1.

[0106] The amplification primers for extending the linker at both ends of SpyTag are shown below.

[0107] Primer F (SEQ ID NO.41): CACCCAGTTCGTGTTGGTCGACAACGGTGGCACCGGGGGCGGTGGATCAGGTGGCGGAGGTAGCGC; Primer R (SEQ ID NO.42): GGAGCCACGGTCACGTCACCGGATCCACCTCCACCACTCCCTCCGCCACCCTTAGTCG.

[0108] 2. Construction, expression and purification of NSpyTag(G4S)2-MS2( luc ) virus-like particles The N-terminus of the MS2 capsid protein dimer can also tolerate the insertion of a peptide segment of appropriate length without affecting the assembly of virus-like particles. Insert the SpyTag-GGGGSGGGGS peptide segment at the N-terminus of the capsid protein dimer to construct NSpyTag(G4S)2-MS2( luc) Virus-like particle variant. The nucleic acid sequence encoding the tandem dimer of the MS2 capsid protein was optimized for the insect cell sf9 host codons and synthesized by BGI (SEQ ID NO.11), and both capsid proteins were wild-type. The coding sequence of the SpyTag-GGGGSGGGGS peptide was inserted at the N-terminus of the capsid protein dimer using PCR amplification method, and the primer sequences are shown below. The upstream primer carried plasmid homologous arms, EcoRI restriction site, kozak sequence, start codon and the coding sequence of the SpyTag-GGGGSGGGGS peptide, and the downstream primer contained the stop codon TAA, Hind III restriction site and plasmid homologous arms. The pFastBac-PH ABSpyTag(G4S)dMS2 CP-P10 luc C tandem plasmid was digested with EcoRI and Hind III, recovered by agarose gel electrophoresis, and homologous recombined with the amplified NSpyTag(G4S)2-CP-CP (SEQ ID NO.20) target fragment at a molar ratio of vector:target fragment of 1:2, and then transformed into competent Escherichia coli. The plasmid was extracted from the positive clone with correct sequencing and named pFastBac-PH NSpyTag(G4S)2dMS2 CP-P10 luc C tandem.

[0109] The NSpyTag(G4S)2-MS2( luc ) virus-like particles were expressed using the Bac to Bac baculovirus expression system and purified by continuous sucrose density gradient centrifugation at 20%-60%. The method was the same as in Example 1.

[0110] The primers for amplifying the EcoRI-NSpyTag(G4S)2-CP-CP-HindIII fragment are shown below.

[0111] Primer F (SEQ ID NO.43): CGTCCCACCATCGGGCGAATTCGCCACCATGGCCCATATAGTGATGGTCGATG; Primer R (SEQ ID NO.44): CCTCTAGTACTTCTCGACAAGCTTTTAGTAGATACCGGAGTTAGCAGC.

[0112] 3. Expression and purification of SpyCatcher protein By homologous recombination, the coding sequence of the SpyCatcher gene (SEQ ID NO.28) was cloned between the BamHI and NotI restriction enzyme sites of the pRSF-6×His-SUMO expression vector. The pRSF-6×His-SUMO expression vector was modified from pRSFDuet-1, and the sequence between the NcoI and BamHI restriction enzyme sites was replaced with 6×his-thrombin site-SUMO (SEQ ID NO.29). The modified vector was stored by the applicant and can be obtained from the Institute of Biophysics, Chinese Academy of Sciences. This biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes. The correctly sequenced pRSF-hissumo-SpyCatcher expression plasmid was transformed into competent Escherichia coli RIL, and single colonies were picked and cultured overnight in LB medium with kanamycin (50 μg / mL) resistance at 37 °C and 220 rpm. The next day, the culture was expanded to 1 L, and when the OD value was about 0.6 in the logarithmic growth phase, an inducer IPTG with a final concentration of 0.4 mM was added, and the culture was shaken at 18 °C and 180 rpm for 22 hours. The bacterial precipitate was collected at 4000 rpm and 4 °C for 30 min for protein purification. The cells were resuspended in 100 mL of binding buffer (20 mM Tris-HCl, 150 mM NaCl, 20 mM imidazole, pH 8.5), and a protease inhibitor PMSF with a final concentration of 1 mM was added, and the cells were disrupted by high-pressure homogenization. The supernatant was collected by centrifugation at 12000 rpm and 4 °C for 40 min and filtered through a 0.45 μm PVDF membrane. The soluble recombinant protein was purified by Ni-NTA column affinity chromatography, and the flow rate was controlled by an HL-2B digital display constant flow pump. The process of affinity chromatography purification is as follows: column equilibration: binding buffer, 200 mL; sample loading: loop sample loading 3 times; removal of miscellaneous proteins: binding buffer, 200 mL; elution of target protein: elution buffer (20 mM Tris-HCl, 150 mM NaCl, 500 mM imidazole, pH 8.5), 10 mL / tube, and the eluate was collected. The target protein sample was concentrated by centrifugation at 4 °C and 4000 rpm using a 10 kDa ultrafiltration tube through SDS-PAGE detection. The buffer of the target protein was replaced with the binding buffer by dilution or dialysis by adding a Tris-NaCl solution without imidazole (20 mM Tris-HCl, 150 mM NaCl, pH 8.5). ULP1 enzyme was added at 4 °C for 30 min. The protein sample was rebound to the Ni-NTA affinity chromatography column, and the flow-through was collected. The purity of the target protein was detected by SDS-PAGE, and the target protein was dialyzed into a Tris-NaCl solution for storage.

[0113] 4. Expression and purification of SpyCatcher-gLgH fusion protein The nucleic acid sequence encoding the murine Igκ secretion signal peptide - SpyCatcher - (G4S)3 - EBV gL (amino acids 24 - 137) - (G4S)3 - EBV gH (amino acids 18 - 679) fragment was synthesized by BGI (SEQ ID NO.21) and cloned into the pCDNA TM 3.1 / Myc - hisA expression vector. The pCDNA TM 3.1 - SpyCatcher - gLgH plasmid was extracted from the host bacteria using an endotoxin - free large - scale extraction kit. The pCDNA TM 3.1 - SpyCatcher - gLgH plasmid was transfected into the 293F cell line. Prepare the transfection mixture: Add 100 μg of the plasmid to 5 mL of CD05 medium and mix well; add 450 μL of PEI to 5 mL of CD05 medium and mix well, then let it stand at room temperature for 2 minutes; add the PEI mixture to the plasmid mixture, mix well thoroughly, and let it stand at room temperature for 15 - 20 min. Then add the transfection mixture to 100 mL of cells with a density of 2×10 6In the cell culture medium with a cell density of

[0114] 5. SpyCatcher, SpyCatcher-gLgH fusion proteins were separately linked to ABSpyTag(G4S)-MS2( luc ), ABSpyTag(G4S)2-MS2( luc ), and NSpyTag(G4S)2-MS2( luc ) virus-like particles The binding of the 7th aspartic acid of SpyTag to the 31st lysine of SpyCatcher (abbreviated as SC) can form a stable amide covalent bond, and this reaction can be completed within a few minutes. SpyCatcher or SpyCatcher-gLgH fusion proteins were separately linked to three SpyTag-VLPs, namely ABSpyTag(G4S)-MS2( luc ), ABSpyTag(G4S)2-MS2( luc ), and NSpyTag(G4S)2-MS2(luc ) Virus-like particles) were ligated at different molar ratios (90 SpyTag-containing MS2 CP dimers assembled to form one VLP, i.e., there were 90 SpyTags on one VLP. This ratio refers to the molar ratio of SpyCatcher to the SpyTag on the VLP to which it is to be ligated), and incubated overnight at 4 °C in PBS (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4). The systems of SpyCatcher (abbreviated as SC) ligated to three kinds of SpyTag-VLPs are shown in Table 2. After the reaction, 10 μL of 5× loading buffer was added to each tube, and the samples were boiled at 100 °C for 5 min. 20 μL of the samples were taken for 12% SDS-PAGE to detect the ligation efficiency.

[0115] Table 2

[0116] The systems of SpyCatcher-gLgH (abbreviated as SC-gLgH) ligated to three kinds of SpyTag-VLPs are shown in Table 3. After incubation overnight at 4 °C, 12.5 μL of 5× loading buffer was added to each tube, and the samples were boiled at 100 °C for 5 min. 20 μL of the samples were taken for 15% and 7.5% SDS-PAGE to detect the ligation efficiency.

[0117] Table 3

[0118] Results: As Figure 2 shown in A of Figure 2As shown in Figure B, the SpyCatcher-gLgH protein with a purity meeting the requirements of downstream ligation experiments was obtained through Ni-NTA affinity chromatography purification. After the three SpyTag-VLPs were ligated with different ratios of SpyCatcher / SpyCatcher-gLgH, the coupling efficiency (percentage of the total binding sites of VLP) of the three SpyTag-VLPs with SpyCatcher / SpyCatcher-gLgH was detected by SDS-PAGE. Coupling efficiency = 1 - gray value of the uncoupled SpyTag-MS2 CP band after the reaction / gray value of the total SpyTag-MS2 CP band before the reaction. The gray value of the CP band was quantitatively analyzed using ImageJ. According to the gray values of the CP bands of SpyTag-VLPs with different mass gradients on the SDS-PAGE gel, a standard curve was plotted. When ligated with the smaller molecular weight SpyCatcher protein, the coupling efficiency of the ABSpyTag(G4S)2-MS2( luc ) virus-like particle was the highest, nearly 100% ( Figure 2 Figure C). When ligated with the larger molecular weight SpyCatcher-gLgH protein, the coupling efficiency of the NSpyTag(G4S)2-MS2( luc ) virus-like particle was the highest, nearly 65% ( Figure 2 Figure D). In addition, the SpyTag on the surface of the ABSpyTag(G4S)-MS2( luc ) virus-like particle might not be fully displayed, and neither SpyCatcher nor SpyCatcher-gLgH could be well displayed on the particle surface. When ligated with the SpyCatcher-gLgH protein, the ABSpyTag(G4S)-MS2( luc ) and ABSpyTag(G4S)2-MS2( luc ) virus-like particles were unstable, and two CP protein degradation bands (identified by mass spectrometry) could be seen in the SDS-PAGE detection figure.

[0119] Example 3 Optimization of Nucleic Acid Encapsulation Inside the NSpyTag(G4S)2-MS2( luc ) Virus-Like Particle Materials: Trizol, MEGAscript kit, and Lipofectamine™ Messenger MAX transfection reagent were purchased from ThermoFisher, the Cap 1 capping kit was purchased from Novoprotein, PrimeScript TMThe RT reagent Kit and oligo dT were purchased from Takara, the 2× SYBR green mix was purchased from Meiji Bio, and the Luciferase reporter assay kit was purchased from Promega.

[0120] 1. Effects of Pac site (C variant) and UTR location distribution on the in vivo translation efficiency of target mRNA According to the different location distributions of the target gene CDs, pac site C variant, 5'-UTR, and 3'-UTR, a total of six mRNA sequences were designed (with the structure shown in A of Figure 3 . The target gene was the firefly luciferase reporter gene firefly luciferase (SEQ ID NO.30), the UTRs were the 5'-UTR (SEQ ID NO.16) and 3'-UTR (SEQ ID NO.17) of human cell reduced coenzyme phytylquinone CYBA, and the poly(A) tail was 120 nt. The DNA fragments corresponding to the six mRNA sequences were synthesized by BGI, transcribed using the MEGAscript kit, capped with the vaccinia virus capping system, and the obtained mRNAs were transfected into human embryonic kidney cells 293T and mouse macrophages Raw264.7 respectively, and the luciferase reporter assay was used to detect the expression level of the luciferase reporter gene.

[0121] (1) In vitro transcription and purification of mRNA: Taking a 20 μL system as an example, it contains: 2 μL of 75 mM ATP, 2 μL of 75 mM CTP, 2 μL of 75 mM GTP, 2 μL of 75 mM N1-Me-Pseudo UTP, 2 μL of 10× Reaction Buffer, 200 ng of PCR product template, 2 μL of enzyme mixture, and nuclease-free deionized water was added to 20 μL. React at 37 °C for 3 hours, add 1 μL of TURBO DNase, and react at 37 °C for 15 minutes to digest the DNA template. The LiCl precipitation method was used to purify RNA: Add 30 μL of nuclease-free deionized water and 30 μL of 7.5 M LiCl precipitation solution to the above 20 μL post-transcription reaction mixture, place at -20 °C for 1 hour; centrifuge at 12,000 rpm and 4 °C for 15 minutes, discard the supernatant, wash the RNA precipitate twice with pre-cooled 70% ethanol (prepared with nuclease-free deionized water); dissolve the RNA in 20 μL of nuclease-free deionized water.

[0122] (2)The vaccinia virus capping system adds a Cap1 cap structure to the 5’ end of mRNA: Taking a 100 μL reaction system as an example, it contains: 50 μg RNA diluted to 67 μL, heated at 65 °C for 5 minutes, and placed on ice for 5 min for pre-denaturation; 10 μL of 10× Capping Reaction Buffer, 10 μL of 10 mM GTP, 2.5 μL of 20 mM SAM, 2.5 μL of RNase inhibitor, 4 μL of Cap2’-O-Methyltransferase, and 4 μL of Vaccinia Capping Enzyme. React at 37 °C for 30 minutes, and the RNA capping is completed, that is, mature mRNA.

[0123] (3)mRNA transfection and luciferase reporter assay to detect reporter gene expression: Transfect the six mature mRNAs obtained above into 293T and Raw264.7 cells respectively using Lipofectamine™ Messenger MAX transfection reagent. The cells are seeded in 24-well plates one day in advance at a density of about 70 - 80%. Transfect 0.5 μg mRNA per well, and collect samples after 24 hours. Use the Luciferase reporter assay system kit to detect reporter gene expression. Add 100 μL of deionized water to each well to dilute the lysate to 1×, lyse at room temperature for 30 minutes, add 2 μL of the lysate to 50 μL of the reaction substrate, and use the Promega GLOMAX MULTI detector to detect luciferase signals.

[0124] 2. Effects of mRNAs of different lengths on the packaging of NSpyTag(G4S)2-MS2( luc ) virus-like particles To study the ability of MS2 virus-like particles prepared in an insect expression system to encapsulate mRNA of different lengths, virus-like particles encapsulating mRNA fragments of EBV EBNA1 (1095 nt), EBV gp350 (1419 nt), EBV gB (2304 nt), EBV gLgH (2520 nt), firefly luciferase (1691 nt), and SARS-CoV-2 nucleocapsid (1401 nt) were constructed. The arrangement positions of the 5'-UTR, 3'-UTR, pac site, and the target gene coding sequence were the same as those of the fifth mRNA described in item 1 of Example 3 above, and were synthesized by BGI. The above-mentioned EBNA1 (SEQ ID NO.18, 5'-UTR-EBV EBNA1 (326-641 amino acids)-C variant tandem-3'-UTR fragment nucleic acid sequence), gp350 (SEQ ID NO.31), gLgH (SEQ ID NO.32), gB (SEQ ID NO.33), and SARS-CoV-2 nucleocapsid (SEQ ID NO.34) nucleic acid fragments were amplified by PCR. The upstream primer was added with a plasmid homologous arm and an Xho I restriction site, and the downstream primer was added with a Kpn I restriction site and a plasmid homologous arm. The primer sequences are shown below. The pFastBac-PH NSpyTag(G4S)2dMS2 CP-P10 luc C tandem plasmid was digested with XhoI and Kpn I, and the agarose gel was recovered. Homologous recombination was carried out at a molar ratio of vector:target fragment of 1:2, and then transformed into competent Escherichia coli. Positive clones with correct sequencing were used to extract plasmids, which were named pFastBac-PH NSpy(G4S)2dMS2 CP -P10 EBNA1 C tandem, pFastBac-PH NSpy(G4S)2dMS2 CP -P10 gp350 C tandem, pFastBac-PH NSpy(G4S)2dMS2 CP -P10 gLgH C tandem, pFastBac-PH NSpy(G4S)2dMS2 CP-P10 gB C tandem, and pFastBac-PH NSpy(G4S)2dMS2 CP-P10 nucleocapsid C tandem. Six virus-like particles were expressed using the Bac to bac baculovirus expression system, namely NSpyTag(G4S)2-MS2( ebna1 ), NSpyTag(G4S)2-MS2( gp350 ), NSpyTag(G4S)2-MS2( glgh), NSpyTag(G4S)2-MS2( gb ), NSpyTag(G4S)2-MS2( luc ), (constructed as in Example 2.2) and NSpyTag(G4S)2-MS2( nucleocapsid ). Purification was carried out by continuous sucrose density gradient centrifugation with 20% - 60%, and the method was the same as in Example 1.

[0125] The primers for amplifying the XhoI-EBNA1 / gp350 / gLgH / gB-KpnI fragment are shown below.

[0126] Primer F (SEQ ID NO.45): CTTGATCACCCGGGATCTCGAGGGGCGCGCCTAGCAGTG; Primer R (SEQ ID NO.46): GCCTCCCCCATCTCCCGGTACCTCCCGGCTTCGCTGCATTTATTG.

[0127] The primers for amplifying the XhoI-SARS-CoV-2 nucleocapsid-KpnI fragment are shown below.

[0128] Primer F (SEQ ID NO.47): AGACTTGATCACCCGGGATCTCGAGGGGCGCGCCTAGCAGTGTC CC; Primer R (SEQ ID NO.48): TTAGCCTCCCCCATCTCCCGGTACCTCCCGGCTTCGCTGCATTTAT TGCAG.

[0129] Extract the RNA encapsulated in 100 μg of the obtained virus-like particles using the Trizol method, and replace PrimeScript TMThe primers in the RT reagent Kit are oligo dT for reverse transcription, and the absolute fluorescence quantitative PCR is used to detect the number of intact mRNA copies encapsulated inside the virus-like particles. The specific steps of the absolute fluorescence quantitative PCR are as follows: 1 μL of cDNA template, 5 μL of 2× SYBR green mix, 0.4 μL of upstream primer (10 μM), 0.4 μL of downstream primer (10 μM), and 3.2 μL of ddH2O. The PCR products of the above EBV EBNA1, gp350, gLgH, gB, firefly luciferase, and SARS-CoV-2 nucleocapsid nucleic acid sequences are used as cDNA templates for fluorescence quantitative PCR, with a total of 10 8 、10 7 、10 6 、10 5 、10 4 、10 3 、10 2 、and 10 1 copy / μL for eight dilution gradients to draw the standard curve. The quantitative PCR primers are shown below.

[0130] ebna1 : F (SEQ ID NO.49): GGGCGCGCCTAGCAGTGTCC; R (SEQ ID NO.50): TTCCTCCGCTTCCTCCTCTG; gp350 : F (SEQ ID NO.51): ATGGAAGCCGCCCTGCTGG; R (SEQ ID NO.52): GGAACTCGGGGATCTCCAC; glgh : F (SEQ ID NO.53): ATGTGGGCCTACCCTTGCTG; R (SEQ ID NO.54): CAGGTCTGGTTGCTCACCAG.

[0131] gb : F (SEQ ID NO.55): ATGCAAACCCCCGAACAACC; R (SEQ ID NO.56): CTGCTCAGCTCGCACACTC; luc : F (SEQ ID NO.57): ATGGAAGACGCCAAAAACATAAAG; R (SEQ ID NO.58): CCAGGGCGTATCTCTTCATAGCC; SARS-CoV-2 nucleocapsid : F (SEQ ID NO.59): GGGCGCGCCTAGCAGTGTCC; R (SEQ ID NO.60): CGCGCCCCACTGCGTTCTC.

[0132] 3. The mRNA encapsulated inside the virus-like particles can be translated and expressed in mammalian cells Extract the RNA encapsulated inside the NSpyTag(G4S)2-MS2( luc ) virus-like particles that are distributed in layers 8, 9, 10, 11, and 12 by 20 - 60% continuous sucrose density gradient centrifugation. Transfect the pre-plated 293T cells with Lipofectamine™ Messenger MAX transfection reagent. Transfect 1.5 μg of RNA per well in a 24-well plate. Harvest the samples after 24 hours and detect the expression of the reporter gene using the Luciferasereporter assay system kit.

[0133] Results: Figure 3 For the six mRNAs in A, when transfected into 293T and Raw264.7 cells, the luciferase reporter gene level expressed by the fifth mRNA was the highest in both cell types ( Figure 3 in B), which was the best arrangement order of the UTR, pac site C variant, and target gene coding sequence. Quantify the RNA inside the six MS2 virus-like particles involved in the present invention by fluorescence quantitative PCR. The results show that MS2 virus-like particles capable of successfully assembling and encapsulating 2520 nt exogenous RNA can be formed in insect cells sf9, and about 10 10 copies of intact mRNA are contained in 100 μg of VLP (the mixture of virus-like particles in layers 9 - 12 of sucrose density gradient centrifugation) ( Figure 3 in C). Extract the fireflyluciferase RNA from sf9 cells encapsulated inside the NSpyTag(G4S)2-MS2( luc ) virus-like particles and transfect mammalian cells 293T cells. The RNA was successfully translated and expressed, and the RNA distributed in the virus-like particles in layer 10 of sucrose density gradient centrifugation had the highest translation efficiency.

[0134] Example 4 Construction of SARS-CoV-2 dual-antigen delivery vaccine particles RBD-NSpyTag(G4S)2-MS2 based on NSpyTag(G4S)2-MS2 virus-like particles nucleocapsid ) Materials: Anti-Flag M2 matrix was purchased from Sigma.

[0135] 1. Expression and purification of SpyCatcher-RBD fusion protein The nucleic acid sequence encoding the secretion signal peptide - SpyCatcher - GSGGSG linker - SARS-CoV-2 RBD fragment was synthesized by BGI (SEQ ID NO.35) and cloned into the pCDNA TM 3.1 / Strep-TagII-flag expression vector. The pCDNA TM 3.1-SpyCatcher-RBD plasmid was extracted from the host bacteria using an endotoxin-free large-scale extraction kit. The pCDNA TM 3.1-SpyCatcher-RBD plasmid was transfected into the 293F cell line using the same transfection method as in step 3 of Example 2. After 5 days, when the cell viability dropped to about 60% - 70%, the culture medium supernatant was collected for protein purification. Two-step centrifugation (centrifugation at 500×g for 10 minutes and 8000 rpm at 4°C for 30 minutes) was used to remove insoluble impurities such as cell debris. The supernatant was passed through a 0.45μm PVDF filter membrane to further remove insoluble impurities. The supernatant was concentrated using a Vivaflow 200 tangential flow ultrafiltration device with a molecular weight cut-off of 10KDa and replaced with Tris buffer solution (50mM Tris, 150mM NaCl, PH 7.8). The target protein was purified by affinity chromatography using the Anti-Flag M2 matrix. The process of affinity chromatography purification is as follows: Column equilibration: Wash the matrix with 9 column volumes of Tris buffer solution, repeat twice, and then wash the matrix with 3 column volumes of glycine buffer solution (0.1M, PH = 3.5) (not exceeding 15 minutes); then add 5 column volumes of Tris buffer solution for column equilibration; Loading: Load the cell supernatant onto the column and repeat the loading three times; Removal of miscellaneous proteins: Wash the column with 10 - 20 column volumes of Tris buffer solution to wash away unbound miscellaneous proteins; Elution of the target protein: Elute the protein with glycine buffer solution (0.1M, PH 3.5), and collect the eluted protein in a 1.5mL centrifuge tube containing 15 - 25μL of 1M Tris buffer (PH 8.0), 1mL per tube. Collect the eluate, detect it by SDS-PAGE, and concentrate the target protein sample using a 10kDa ultrafiltration tube by centrifugation at 4°C and 4000 rpm, and replace it with PBS buffer (PH 7.8). After aliquoting, store it at -80°C.

[0136] 2. Linkage of SpyCatcher-RBD fusion protein with NSpyTag(G4S)2-MS2( nucleocapsid ) virus-like particles Link the SpyCatcher-RBD fusion protein with NSpyTag(G4S)2-MS2( nucleocapsid ) virus-like particles at different molar ratios (the same as 5 in Example 2), and incubate overnight at 4 °C in PBS (pH 7.8). The connection system of SpyCatcher-RBD (abbreviated as SC-RBD) and SpyTag-VLP is shown in Table 4. After the reaction, add 5 μL of 5× loading buffer to each tube, boil the samples at 100 °C for 5 min, and perform 11% SDS-PAGE to detect the ligation efficiency. For the same reaction system, add 4 μL of 6× DNA loading buffer to each tube, and perform 1% agarose gel electrophoresis to detect whether the particles aggregate.

[0137] Table 4

[0138] 3. Production of RBD-NSpyTag(G4S)2-MS2( nucleocapsid ) virus-like particles Mix the NSpyTag(G4S)2-MS2( nucleocapsid ) virus-like particles and SpyCatcher-RBD fusion protein in a large volume at a molar ratio of 1:0.5, and invert and mix overnight at 4 °C. Remove the tiny precipitate with a 0.22 μm filter membrane, and purify and remove the excess SpyCatcher-RBD through an AKTA Pure M1 protein purification system equipped with a Hiload 16 / 600 superdex 200 prep grade gel filtration chromatography column. Equilibrate and elute the gel filtration chromatography column with PBS buffer (pH = 7.8), with a flow rate of 1 mL / min throughout the process. Collect the elution peak, and perform SDS-PAGE protein electrophoresis to detect whether the free SpyCatcher-RBD protein is completely removed. Concentrate the virus-like particles in a concentrator with a 100 kDa cut-off, aliquot, and store at -80 °C. Dilute the RBD-NSpyTag(G4S)2-MS2( nucleocapsid ) virus-like particles obtained with PBS solution to 0.3 mg / mL, take 5 μL for incubation and staining with 2% uranyl acetate (the same as 4 in Example 1), air dry, and then observe with a Tecnai Spirit (120 kV) transmission electron microscope.

[0139] Results: NSpyTag(G4S)2-MS2( nucleocapsid) Virus-like particles were separately linked with SpyCatcher-RBD fusion proteins at different ratios, and the coupling efficiency of virus-like particles and SpyCatcher-RBD was detected by SDS-PAGE. When the molar ratio of SpyTag to SpyCatcher was 1:2, the coupling efficiency of NSpyTag(G4S)2-MS2( nucleocapsid ) virus-like particles was close to saturation ( Figure 4 of A). The connection mixtures with different ratios were further subjected to agarose gel electrophoresis. Nucleic acid and protein staining showed that when the molar ratio of SpyTag to SpyCatcher was 1:1, 1:2, 1:3, and 1:4, the connection products aggregated and deposited in the nucleic acid gel wells. When the connection ratio of SpyCatcher-RBD to NSpyTag(G4S)2-MS2( nucleocapsid ) virus-like particles was reduced to 1:0.125, 1:0.25, and 1:0.5, no protein was deposited in the nucleic acid gel wells, and the RNA migrated with the AP205 protein ( Figure 4 of B). Therefore, the NSpyTag(G4S)2-MS2( nucleocapsid ) virus-like particles and SpyCatcher-gLgH fusion protein were connected in a large volume at a ratio of 1:0.5, and purified using a superdex 200 pergrade gel filtration chromatography column. The main peak of the RBD-NSpyTag(G4S)2-MS2( nucleocapsid ) virus-like particles was at the 51 ml position ( Figure 4 of C). SDS-PAGE protein electrophoresis detection showed that highly pure RBD-NSpyTag(G4S)2-MS2( nucleocapsid ) virus-like particles were obtained ( Figure 4 of D). The virus-like particles were negatively stained with 2% uranyl acetate and observed and photographed with a Tecnai Spirit (120 kV) transmission electron microscope. The results were as shown in Figure 4 of E. The RBD-NSpyTag(G4S)2-MS2( nucleocapsid ) virus-like particles had relatively good dispersion. However, due to the relatively small amount of coupled SpyCatcher-RBD, no clear and obvious spike structure was observed on the particle surface.

[0140] Example 5 Construction of EBV dual-antigen delivery vaccine particle gp350-NSpyTag(G4S)2-MS2( ebna1 ) based on NSpyTag(G4S)2-MS2 virus-like particles 1. Expression and purification of SpyCatcher-gp350 fusion protein The nucleic acid sequence encoding the murine Igκ secretion signal peptide - SpyCatcher - (G4S)3 - EBV gp350 (amino acids 2 - 425) fragment was synthesized by BGI (SEQ ID NO.36) and cloned into the pCDNA TM 3.1 / 3xflag expression vector. The pCDNA TM 3.1 - SpyCatcher - gp350 plasmid was extracted from the host bacteria using an endotoxin - free large - scale extraction kit and transfected into the 293F cell line for the expression of the SpyCatcher - gp350 fusion protein. The transfection and protein purification methods of 293F cells were the same as those in step 1 of Example 4. The column binding buffer solution was PBS buffer (PH = 7.4). The target protein sample was concentrated by centrifugation at 4°C and 4000 rpm using a 30 kDa ultrafiltration tube, replaced into PBS buffer (PH = 7.4), aliquoted, and stored at - 80°C.

[0141] 2. Ligation of the SpyCatcher - gp350 fusion protein with NSpyTag(G4S)2 - MS2( ebna1 ) virus - like particles The preparation of NSpyTag(G4S)2 - MS2( ebna1 ) virus - like particles is shown in Examples 2 and 3. The SpyCatcher - gp350 fusion protein was ligated with NSpyTag(G4S)2 - MS2( ebna1 ) virus - like particles at different molar ratios and incubated overnight at 4°C in PBS (PH 7.4). The ligation system of SpyCatcher - gp350 (abbreviated as SC - gp350) and SpyTag - VLP is shown in Table 5. After the reaction, 5 μL of 5× loading buffer was added to each tube, and the samples were boiled at 100°C for 5 min, and 9% SDS - PAGE was performed to detect the ligation efficiency. For the same reaction system, 4 μL of 6× DNA loading buffer was added to each tube, and 1% agarose gel electrophoresis was performed to detect whether the particles aggregated.

[0142] Table 5

[0143] 3. Production of gp350 - NSpyTag(G4S)2 - MS2( ebna1 ) virus - like particles The NSpyTag(G4S)2 - MS2( ebna1) The virus-like particles and the SpyCatcher-gp350 fusion protein were mixed in a large volume at a molar ratio of 1:2 and inverted gently overnight at 4 °C. Micro-precipitates were removed using a 0.22 μm filter membrane, and the excess SpyCatcher-gp350 was purified by gel filtration chromatography on a Hiload 16 / 600 superdex 200 pergrade column using an AKTA Pure M1 protein purification system. The gel filtration chromatography column was equilibrated and eluted with PBS buffer (pH 7.4) at a flow rate of 1 mL / min throughout the process. The elution peak was collected, and SDS-PAGE was used to detect whether the free SpyCatcher-gp350 protein was completely removed. The virus-like particles were concentrated in a concentrator with a 100 kDa cut-off, aliquoted, and stored at -80 °C. The gp350-NSpyTag(G4S)2-MS2 obtained by diluting with PBS solution ( ebna1 ) virus-like particles were diluted to 0.5 mg / mL, and 5 μL was taken for incubation and staining with 2% uranyl acetate (the same as 4 in Example 1); after air-drying, Tecnai Spirit (120 kV) transmission electron microscopy was performed for observation.

[0144] Results: NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles were ligated with SpyCatcher-gp350 fusion protein at different ratios, and SDS-PAGE was used to detect the coupling efficiency of virus-like particles and SpyCatcher-gp350 ( Figure 5 A). The ligation mixtures at different ratios were further subjected to agarose gel electrophoresis. Nucleic acid and protein staining showed that when the molar ratio of SpyTag to SpyCatcher was 1:0.125, 1:0.25, 1:0.5, 1:1, 1:2, 1:3, and 1:4, the ligation products did not aggregate, the RNA migrated with the AP205 protein, and no protein was deposited in the nucleic acid gel wells ( Figure 5 B). The NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles were ligated with SpyCatcher-gp350 fusion protein at a ratio of 1:2 in a large volume and purified using a superdex 200 pergrade gel filtration chromatography column. The main peak of the gp350-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles was at the 49 mL position ( Figure 5 C). SDS-PAGE protein electrophoresis detection showed that highly pure gp350-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles were obtained ( Figure 5D). The virus-like particles were negatively stained with 2% uranyl acetate and observed and photographed with a Tecnai Spirit (120 kV) transmission electron microscope. The results are shown in Figure 5 E as shown in gp350-NSpyTag(G4S)2-MS2( ebna1 ) The virus-like particles had good dispersibility and uniformity. There were clearly visible protrusions on the outer surface of the spherical core of the virus-like particles, namely, SpyCatcer-gp350 antigen.

[0145] Example 6 Construction of EBV dual-antigen delivery vaccine particles gLgH-NSpyTag(G4S)2-MS2( ebna1 ) Materials: Tween20 was purchased from Beijing Lamboid, Blocker TM Casein in PBS was purchased from Thermo Fisher, HRP-goat-anti-human was purchased from EarthOx, TMB Substrate Kit was purchased from Thermo Fisher, 100 kDa cut-off concentration tubes were purchased from Merck Millipore, 96-well enzyme-linked immunosorbent assay plates were purchased from Corning Costar, and the gLgH neutralizing antibody 1D8 was provided by the research group of Xu Miao from the Sun Yat-sen University Cancer Center (Sun Yat-sen University Cancer Hospital, Sun Yat-sen University Cancer Institute).

[0146] 1. Production of gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles For the expression and purification of the antigen fusion protein SpyCatcher-gLgH, see item 4 in Example 2. For the preparation of NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles, see Examples 2 and 3. Mix the NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles and the SpyCatcher-gLgH fusion protein in a large volume at a molar ratio of 1:2, and mix them by inverting up and down at 4 °C overnight. Remove the tiny precipitate with a 0.22 μm filter membrane, and purify and remove the excess SpyCatcher-gLgH through an AKTA Pure M1 protein purification system equipped with a Hiload 16 / 600 superdex 200 pergrade gel filtration chromatography column. Equilibrate and elute the gel filtration chromatography column with PBS buffer at a flow rate of 1 mL / min throughout the process, collect the elution peak, and detect by SDS-PAGE protein electrophoresis whether the free SpyCatcher-gLgH protein is removed completely. Concentrate the virus-like particles in a 100 kDa cut-off concentration tube, aliquot them, and store them at -80 °C.

[0147] 2. Characterization of gLgH-NSpyTag(G4S)2-MS2 ebna1 ) virus-like particles Dilute gLgH-NSpyTag(G4S)2-MS2 ebna1 ) virus-like particles with PBS solution to 0.5 mg / mL. Take 5 μL of the diluted solution and drop it on a 300-mesh carbon film copper grid for 1 min of adsorption. Gently suck the liquid from the edge of the copper grid with filter paper, drop 5 μL of 2% uranyl acetate for incubation and staining for 2 min, and wash twice. Suck the excess liquid with filter paper and air-dry at room temperature. After air-drying, place the sample on a ThermoFisher Talos F200C transmission electron microscope for observation. The transmission electron microscope is equipped with a Gatan K2 summit camera (4K×4K). Select an area with better particle dispersion and uniformity of the sample for data collection. Use a template-free automatic selection program based on the Laplacian of Gaussian (LoG) filter to select an initial set of particles from 50 frames of the sample, generate a two-dimensional classification template, and automatically select all particles according to this template. Further use RELION 5.0 to process the data for two-dimensional reconstruction of the morphological structure of the virus-like particles. ELISA was used to detect the binding ability of gLgH-NSpyTag(G4S)2-MS2 ebna1 ) virus-like particles to the gLgH neutralizing antibody 1D8 to evaluate the immunogenicity of the gLgH protein displayed on the particle surface. Dilute gLgH and gLgH-NSpyTag(G4S)2-MS2 ebna1 ) virus-like particles with coating buffer (PBS solution) respectively, with equal molar amounts of the gLgH part, 2 μg / mL of gLgH, and 3.5 μg / mL of gLgH-NSpyTag(G4S)2-MS2 ebna1 ) virus-like particles. Add 50 μL / well to an enzyme-linked immunosorbent assay plate and incubate overnight at 4°C. The next day, add 0.05% PBST (PBS solution containing 0.05% Tween 20), 300 μL / well, and wash 3 times. Blocker TM Casein in PBS was used for blocking, 100 μL / well, at room temperature for 1 hour. The gLgH neutralizing antibody 1D8 was serially diluted with Blocker TM Casein in PBS (initial well concentration was 10 μg / mL, 50 μL / well, and then continue to make 3-fold dilutions for a total of 12 gradients). Incubate at room temperature with the coated gLgH, gLgH-NSpyTag(G4S)2-MS2 ebna1) Incubate the ELISA 96-well plate with virus-like particles for 3 hours. Add 300 μL of 0.05% PBST per well and wash 3 times. Incubate the secondary antibody HRP-goat-anti-human (1:2000, diluted with Blocker TM Casein in PBS) at room temperature for 1 hour. Add 300 μL of 0.05% PBST per well and wash 7 times. Develop color with TMB Substrate Kit, terminate with 2M H2SO4, and read the OD of the corresponding wells with an enzyme-linked immunosorbent assay reader 450 -OD 630 value.

[0148] Results: Mix the gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles and the SpyCatcher-gLgH fusion protein, and purify them using a Superdex 200 prep grade gel filtration chromatography column. The main peak of the gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles is at the 49.5 ml position ( Figure 6 A). SDS-PAGE protein electrophoresis detection shows that highly pure gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles are obtained ( Figure 6 B). Stain the gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles with 2% uranyl acetate, observe and take pictures with a transmission electron microscope Talos F200C equipped with a Gatan K2 summit camera, and perform two-dimensional reconstruction. The results are as shown in Figure 6 C. Compared with the MS2 virus-like particles without conjugated antigen, there are clearly visible protrusions on the outer surface of the spherical core of the gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles, which are the conjugated SC-gLgH antigens. ELISA is used to detect the affinity between gLgH and the gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles and the gLgH neutralizing antibody 1D8, indicating that after gLgH is displayed on the surface of the MS2 virus-like particles, the immunogenicity of the antigen increases, as shown in Figure 6 D.

[0149] Example 7 gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles induce gLgH-specific antibody responses in mice Materials: Aluminum adjuvant was purchased from Thermo Fisher. The TLR9 ligand murine CpG-B adjuvant (ODN1826, 5’-tccatgacgttcctgacgtt-3’, all nucleotides were thiophosphorothioate modified) was synthesized by Takara. C57BL / 6 female mice (6 - 8 weeks old) were purchased from Jiangsu Jicui Yakang Biotechnology Co., Ltd. HRP-goat-anti-mouse IgG was purchased from Bethyl Laboratories.

[0150] 1. Immunization protocol for C57BL / 6 mice C57BL / 6 mice were divided into five groups: (1) Naïve; (2) gLgH antigen mixed with aluminum adjuvant, 9 μg / mouse; (3) gLgH antigen mixed with aluminum adjuvant and CpG adjuvant, 9 μg / mouse, with a CpG dosage of 20 μg / mouse; (4) gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles, 15 μg / mouse; (5) gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles mixed with aluminum adjuvant and CpG adjuvant, 15 μg / mouse, with a CpG dosage of 20 μg / mouse. The molar amount of gLgH in the gLgH antigen was equal to that in the gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles. The immunization components of each group were diluted with PBS to a 200 μL immunization system per mouse and administered by subcutaneous immunization at the base of the tail. A second immunization with the same dose was given 14 days after the primary immunization, and a third immunization was given on day 28. Serum samples were collected from the immunized mice on days 14, 28, 42, 70, 126, and 147 after the primary immunization to detect the anti-gLgH antibody level.

[0151] 2. ELISA for detecting the specific antibody level against gLgH in mouse serum The gLgH antigen was diluted with PBS solution to 2 μg / mL and used to coat the enzyme-linked immunosorbent assay (ELISA) plate, 50 μL / well, overnight at 4°C. Mouse serum was serially diluted (initial serum dilution was 1:100, and then further diluted 3-fold, for a total of 12 dilutions) and incubated with the gLgH-coated ELISA plate at room temperature for 3 hours. The secondary antibody HRP-goat-anti-mouse IgG was incubated at room temperature for 1 hour. TMB substrate was used for color development, and the OD 450 and OD 630 values of the corresponding wells were read using an enzyme-linked immunosorbent assay reader. Wells without incubated serum were used as blank controls. The average value of the OD 450 -OD 630 values of 12 blank control wells plus 10 times the standard deviation value was used as the reference value, and the lowest dilution of the serum greater than the reference value was recorded as the antibody titer.

[0152] Result: 14 days after primary immunization, the gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles without any adjuvant could induce the production of anti-gLgH IgG antibodies with a relatively high titer, and the antibody titer could reach 1×10 4 or so, which was higher than that of the gLgH antigen mixed with aluminum adjuvant and the gLgH antigen mixed with aluminum adjuvant and CpG adjuvant groups. After combining aluminum adjuvant and CpG adjuvant, the antibody response induced by the gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles in mice was further enhanced, and the antibody titer reached 1×10 4.8 or so. Two weeks after the second immunization, the level of anti-gLgH IgG antibodies induced by the gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles was comparable to that of the gLgH antigen mixed with aluminum adjuvant and CpG adjuvant groups, but still higher than that of the gLgH antigen mixed with aluminum adjuvant group. Two weeks after the third immunization, the level of gLgH antibodies in the gLgH antigen mixed with aluminum adjuvant and CpG adjuvant groups was slightly higher than that of the gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particle group. The antibody level in the gLgH antigen mixed with aluminum adjuvant group was still the lowest, and the highest was in the group of gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles mixed with aluminum adjuvant and CpG adjuvant. Blood samples were taken on the 70th, 126th, and 147th days of the immunization process for long-term monitoring. The results showed that the antibody level induced by the gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles had good persistence ( Figure 7 ).

[0153] Example 8 gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles induce EBV neutralizing antibodies in mice Materials: Defined Keratinocyte-SFM and EpiLife medium were purchased from Gibico, phorbol ester TPA was purchased from Cell Signaling Technology, NaB (sodium butyrate) was purchased from Merk, anti-IgG antibody was purchased from Sigma, and TGF-β was purchased from Peprotech. CNE2 cells infected with EBV-GFP were provided by the research group of Zeng Musheng at the Sun Yat-sen University Cancer Center. EBV-negative Akata cells were provided by the research group of Xu Miao at the Sun Yat-sen University Cancer Center. Akata cells infected with EBV-GFP and immortalized nasopharyngeal epithelial cells NP460-Tert were provided by the research group of Sai-Wah Tsao at the University of Hong Kong, China.

[0154] 1. Preparation of EBV from epithelial cells CNE2 cells infected with EBV-GFP were cultured in RPMI1640 + 5% FBS medium in a 37°C incubator with 5% CO2. When the cells reached 90% confluence, TPA with a final concentration of 20 ng / mL and NaB with a final concentration of 2.5 mM were added for induction. After 12 hours, the cells were washed with PBS and fresh medium was added. The culture supernatant was collected 48 - 72 hours after changing the medium, centrifuged at 2000 rpm at 4°C for 10 minutes to remove cell debris, and then filtered through a 0.45 μm filter. Virus concentration was performed by centrifugation at 27,600 RCF at 4°C for 3 hours using a Himac ultracentrifuge with a P45AT rotor. After concentration, the virus was resuspended in serum-free RPMI1640 medium and immediately used for infection or aliquoted and stored at -80°C.

[0155] 2. Preparation of EBV from B cells Akata cells infected with EBV-GFP were cultured in RPMI1640 + 10% FBS medium in a 37°C incubator with 5% CO2. When the cells reached the logarithmic growth phase, the density was adjusted to 2×10 6 cells / mL, and anti-IgG antibody with a final concentration of 5 μg / mL was added for induction. Five days later, the culture supernatant was collected, centrifuged at 2000 rpm at 4°C for 10 minutes to remove cells and cell debris, and then filtered through a 0.45 μm filter. Virus concentration was performed by centrifugation at 27,600 RCF at 4°C for 3 hours using a Himac ultracentrifuge with a P45AT rotor. After concentration, the virus was resuspended in RPMI1640 + 10% FBS medium and immediately used for infection or aliquoted and stored at -80°C.

[0156] 3. Detection of neutralizing antibody levels in mouse serum against EBV-infected B cells Take the mouse serum on the 28th day in Example 7, and compare the neutralizing antibody levels against EBV-infected B cells in the serum through the following in vitro neutralizing antibody detection method: Dilute the mouse serum with serum-free 1640 medium, starting from the original serum, perform 5-fold serial dilutions for 6 gradients. Take 25 μL of the diluted serum into a 96-well cell plate, add 25 μL of the GFP-EBV virus dilution produced by CNE2 cells, mix well, and place it in an incubator at 37°C for 2 hours. Resuspend Akata cells with serum-free RPMI1640 medium and adjust the cell concentration to 2×10 6 cells / mL. Add 50 μL of the cell suspension to the above virus and mouse serum mixture, incubate for 3 hours, then replace it with fresh complete medium (RPMI1640 + 10% FBS) without EBV virus, and continue to culture in an incubator at 37°C for 48 hours. Use the flow cytometer LSR Fortessa from BD to detect the virus infection rate (the number of GFP-positive cells) of Akata cells, and calculate the IC 50 of the serum virus neutralizing antibody using Prism.

[0157] 4. Detection of neutralizing antibody levels of mouse serum against EBV-infected epithelial cells Take the mouse serum on the 28th day in Example 7, and compare the neutralizing antibody levels against EBV-infected epithelial cells in the serum through the following in vitro neutralizing antibody detection method: First, seed NP460tert cells into a 96-well plate at a volume of 100 μL and 7500 cells / well using a mixed medium of Defined Keratinocyte-SFM and EpiLife medium (mixed at 1:1), and place it in an incubator at 37°C for culture. After 24 hours, change to a mixed medium of Defined Keratinocyte-SFM and EpiLife medium containing TGF-β at a final concentration of 2 ng / mL, and continue to culture for 24 hours. Dilute the mouse serum 25-fold with RPMI1640 + 10% FBS medium. Take 125 μL of the diluted serum into a 96-well cell plate, add 125 μL of the GFP-EBV virus dilution produced by Akata cells, mix well, and place it in an incubator at 37°C for 2 hours. Aspirate the medium containing TGF-β in NP460tert cells, wash once with PBS, add the above virus and mouse serum mixture, and place it in an incubator at 37°C for culture. After 48 hours, digest the NP460tert cells in the 96-well plate, resuspend them with a PBS solution containing 2% paraformaldehyde and 2% FBS, and use the flow cytometer LSR Fortessa from BD to detect the proportion of GFP-positive NP460tert cells and compare the virus infection rates.

[0158] Results: As Figure 8As shown in A of, the B cell virus neutralizing antibody titer induced by gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles is higher than that of the gLgH vaccine component mixed with aluminum adjuvant or aluminum adjuvant combined with CpG adjuvant. Among them, the B cell virus neutralizing antibody titer induced by the combination of gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles, aluminum adjuvant and CpG adjuvant is the highest. As shown in Figure 8 B of, the epithelial cell virus neutralizing antibody titer induced by gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles is also higher than that of the traditional gLgH vaccine mixed with aluminum adjuvant.

[0159] Example 9 gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles induce EBNA1-specific T cell responses in mice Materials: The MultiScreen Fliter ELISPOT plate (MSIPS4510) was purchased from Millipore, the PepTivator® EBV EBNA-1 polypeptide library for in vitro activation of T cells was purchased from Miltenyi Biotec, the stimulant concanavalin A was purchased from Sigma, the OTI and OTII peptides were purchased from Shanghai Bioengineering, the AEC substrate chromogenic kit was purchased from BD, and the mouse IFNγ ELISPOT detection kit was purchased from MABTECH.

[0160] 1. Immunization protocol for C57BL / 6 mice C57BL / 6 mice were divided into three groups: (1) Naïve; (2) gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles, 100 μg / mouse; (3) gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles mixed with aluminum adjuvant and CpG adjuvant, 100 μg / mouse, and the dosage of CpG was 50 μg / mouse. The immune components of each group were diluted with PBS to a 200 μL immune system per mouse, and the subcutaneous immunization method was used at the base of the tail. The same dose was given again on the 7th day after the primary immunization for the second immunization, and the inguinal lymph nodes of the immunized mice were taken on the 12th day for EBNA1 + IFNγ + T cell detection.

[0161] 2. Detection of EBNA1 + IFNγ + specific T cells Pre-treat the ELISPOT plate with 35% ethanol one day in advance, 30 μL per well, discard after no more than 1 minute. Wash twice with 200 μL per well of QH2O. Wash three times with 200 μL per well of PBS. Coat the IFNγ capture antibody AN18 (diluted with PBS filtered through 0.22 μm, final concentration 10 μg / mL, 100 μL per well), overnight at 4°C. Take the inguinal lymph nodes of mice and place them in RPMI1640 medium containing 2% FBS. Grind the lymph nodes thoroughly on a 70-mesh sieve with the back of the plunger of a 1 mL syringe, remove the precipitate, centrifuge at 1200 rpm for 5 minutes, and then resuspend the cells for counting. Dilute the cells to 5×10 6 / mL, and seed 5×10 5 cells per well in a round-bottom 96-well plate. Add the positive stimulator concanavalin A (ConA) at a final concentration of 5 μg / mL, the negative control stimulatory peptide OTI+OTII at 10 μg / mL, and the EBV peptide library at 0.6 nmol (about 1 μg) per peptide / mL, with a total volume of 200 μL. Wash the ELISPOT plate with PBS in advance, add 100 μL of RPMI1640 medium containing 10% FBS, and block at room temperature for 2 hours. Discard the blocking medium, and transfer the above cell-stimulator mixture drop by drop vertically to the ELISPOT plate, and incubate in a 37°C incubator for 48 hours. Wash the plate twice with QH2O and three times with 0.05% PBST. Add the IFNγ detection antibody R4-6A2-biotin (diluted to 1 μg / mL with PBS containing 0.5% FBS and filtered through a 0.22 μm membrane), 100 μL per well, and incubate at room temperature for 2 hours. Wash the plate three times with 0.05% PBST. Add Streptavidin-HRP (diluted 100-fold with PBS containing 0.5% FBS), 100 μL per well, and incubate at room temperature for 1 hour. Wash the plate four times with 0.05% PBST and twice with PBS. Develop the color with AEC substrate, terminate with QH2O, dry, and then take a picture with the Cellular Technology Limited instrument, and count the number of spots on the membrane.

[0162] Results: As Figure 9 shown, immunization with the gLgH-NSpyTag(G4S)2-MS2( ebna1 ) virus-like particles combined with aluminum adjuvant and CpG adjuvant can induce EBNA1 + IFNγ + -specific T cell responses in mice.

[0163] In summary, the present invention uses the MS2-based virus-like particles gLgH-NSpyTag(G4S)2-MS2 produced by the baculovirus Bac-to-Bac expression system ebna1) can not only display SpyTag peptides well on its outer surface, facilitating the rapid and efficient display of antigen proteins, effectively inducing the production of specific antibodies and neutralizing antibodies against EBV, but also encapsulate exogenous mRNA and deliver the exogenous mRNA into mice to generate specific T cell responses.

[0164] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. An immunogenic complex, characterized in that, The complex comprises virus-like particles and an antigen covalently linked to the virus-like particles via the SpyCatcher-SpyTag system, and the covalent linkage enables the antigen to be displayed on the surface of the virus-like particles; Wherein, the virus-like particles comprise phage capsid proteins and nucleic acids encapsulated therein; the nucleic acids do not contain nucleic acids from the host cells expressing the virus-like particles.

2. The immunogenic complex according to claim 1, wherein The nucleic acids and the antigen are derived from the same microorganism or the same animal cells; Preferably, the nucleic acids are RNA.

3. The immunogenic complex according to claim 1 or 2, characterized in that, The phage is an Escherichia coli phage; Preferably, the phage is MS2 phage.

4. The immunogenic complex according to any one of claims 1 to 3, characterized in that, The capsid proteins are expressed in the form of capsid protein dimers, and the SpyTag is fused to the N-terminus of the capsid protein dimers; Preferably, the SpyTag is linked to the capsid protein dimers via a first linker peptide, and the sequence of the first linker peptide is as shown in SEQ ID NO.1; More preferably, the amino acid sequence of the capsid protein dimers is as shown in SEQ ID NO.

2.

5. The immunogenic complex according to any one of claims 1 to 4, characterized in that, The SpyCatcher is linked to the antigen via a second linker peptide; Preferably, the second linker peptide is a flexible linker peptide rich in glycine and serine; More preferably, the SpyCatcher is fused to the N-terminus of the antigen.

6. The immunogenic complex according to any one of claims 1 to 5, characterized in that, The nucleic acids and the antigen are derived from Epstein-Barr virus or severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2); Preferably, the antigen is the RBD sequence of Epstein-Barr virus envelope glycoprotein gLgH, Epstein-Barr virus envelope glycoprotein gp350 or SARS-CoV-2 S protein; And / or, the nucleic acids are the mRNA of Epstein-Barr virus nuclear antigen EBNA1, the mRNA of Epstein-Barr virus envelope glycoprotein gp350, the mRNA of Epstein-Barr virus envelope glycoprotein gLgH, the mRNA of Epstein-Barr virus envelope glycoprotein gB or the mRNA of SARS-CoV-2 nucleocapsid protein.

7. The immunogenic complex according to claim 6, wherein The Epstein-Barr virus envelope glycoprotein gLgH is a fusion protein formed by gL protein and gH protein; Preferably, the amino acid sequence of the gL protein is as shown in SEQ ID NO.3, and the amino acid sequence of the gH protein is as shown in SEQ ID NO.4; And / or, the amino acid sequence of the Epstein-Barr virus envelope glycoprotein gp350 is as shown in SEQ ID NO.5 as shown; And / or, the amino acid sequence of the RBD sequence of SARS-CoV-2 S protein is as shown in SEQ ID NO.

6.

8. The immunogenic complex according to claim 6, wherein The amino acid sequence encoded by the mRNA of the nuclear antigen EBNA1 is as shown in SEQ ID NO.7; And / or, the amino acid sequence encoded by the mRNA of the envelope glycoprotein gp350 is as shown in SEQ ID NO.5; And / or, the amino acid sequence encoded by the mRNA of the envelope glycoprotein gLgH is as shown in SEQ ID NO.8; And / or, the amino acid sequence encoded by the mRNA of the envelope glycoprotein gB is as shown in SEQ ID NO.9; And / or, the amino acid sequence encoded by the mRNA of the SARS-CoV-2 nucleocapsid protein is as shown in SEQ ID NO.

10.

9. A polynucleotide combination, characterized in that, The polynucleotide combination encodes the immunogenic complex according to any one of claims 1 to 8, and comprises: (1) A first polynucleotide: whose sequence sequentially comprises a SpyTag encoding sequence, a first linker peptide encoding sequence, and a phage capsid protein dimer encoding sequence along the 5'-3' direction; (2) A second polynucleotide: whose sequence sequentially comprises a 5'-UTR, the encoding sequence of the nucleic acid, two tandem phage packaging sites, and a 3'-UTR along the 5'-3' direction; And, (3) A third polynucleotide: whose sequence sequentially comprises a SpyCatcher encoding sequence, a second linker peptide encoding sequence, and the encoding sequence of the antigen along the 5'-3' direction.

10. Recombinant vector combination, characterized in that, The recombinant vector comprises: (1) A first recombinant vector: comprising a polynucleotide, which is (1) and (2) in claim 9; And, (2) A second recombinant vector: comprising a polynucleotide, which is (3) in claim 9.

11. A host cell combination, characterized in that, The host cell combination comprises: (1) A first host cell: comprising a recombinant vector, which is (1) in claim 10; And, (2) A second host cell: comprising a recombinant vector, which is (2) in claim 10.

12. The method for preparing an immunogenic complex according to any one of claims 1 to 8, characterized in that, The preparation method comprises: Introducing the first recombinant vector described in (1) of claim 10 into Escherichia coli containing a baculovirus shuttle vector to obtain a recombinant bacmid; Transfecting the recombinant bacmid into insect cells to obtain the virus-like particles; Introducing the second recombinant vector described in (2) of claim 10 into a host cell to obtain a fusion protein of SpyCatcher and the antigen; Linking the fusion protein of SpyCatcher and the antigen with the virus-like particles.

13. Any one of the following applications of the immunogenic complex according to any one of claims 1 to 8, the polynucleotide combination according to claim 9, the recombinant vector combination according to claim 10, or the host cell combination according to claim 11: (1) Preparing a drug for preventing and / or treating microbial infections from which the antigen is derived; (2) Preparing a drug for preventing and / or treating diseases caused by microbial infections from which the antigen is derived; (3) Preparing a drug for preventing and / or treating diseases caused by abnormal expression of the antigen.

14. A drug, characterized in that, The drug comprises the immunogenic complex according to any one of claims 1 to 8; Preferably, the drug is a vaccine.

Images