Application of TFAM in preparation of medicine for treating hepatic fibrosis
Through TFAM and KLF16 regulators, drugs were prepared to restore the mitochondrial function of macrophages, solving the metabolism and inflammation regulation problems in liver fibrosis, and improving the therapeutic effect of liver fibrosis.
Patent Information
- Application Number
- CN202510321935.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-18
- Publication Date
- 2025-07-22
AI Technical Summary
The prior art has failed to effectively solve the mechanism of liver fibrosis, especially the metabolism and inflammation regulation of macrophages in liver fibrosis, making it difficult to cure cirrhosis.
Drugs for treating liver fibrosis are prepared by applying TFAM or upregulators, or activators of them, or KLF16 or upregulators, or activators of them, to regulate M1 polarization and mitochondrial damage of macrophages, and to restore mitochondrial function.
It significantly improves mitochondrial dysfunction and inflammatory response in liver fibrosis, and provides a treatment for liver fibrosis.
Smart Images

Figure CN120346324A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine, and particularly relates to the application of TFAM in the preparation of drugs for treating liver fibrosis. Background Art
[0002] Liver fibrosis is a common response to chronic liver injury caused by various etiologies (such as cholestasis, viral hepatitis, fatty liver, etc.). This process leads to cirrhosis, which is the end stage of progressive fibrosis, characterized by a feathery distribution of fibrous structures, accompanied by the risk of dysfunction and organ failure. Cirrhosis is generally considered an incurable disease and is the 14th leading cause of death globally. Currently, no effective anti-fibrotic therapy has been approved except for liver transplantation. Therefore, there is an urgent need to further understand the precise mechanism of liver fibrosis.
[0003] The mechanism of liver fibrosis is a highly controversial issue. It is now becoming increasingly clear that uncontrolled immune disorders are the key driving forces promoting the progression of liver fibrosis. During the development of liver fibrosis, damaged hepatocytes secrete danger-associated molecular patterns (DAMPs), activating resident macrophages (Kupffer cells) and recruited monocyte-derived macrophages. These activated macrophages release various cytokines, directly damaging hepatocytes, enhancing the activation of hepatic stellate cells (HSCs), and promoting the accumulation of extracellular matrix (ECM). As one of the most commonly studied cell types in innate immunity, liver macrophages have become core participants in the progression and reversal of liver fibrosis. There are mainly two polarized states of activated macrophages: the classical activated inflammatory phenotype (M1) and the alternative anti-inflammatory phenotype (M2) macrophages. When the liver is damaged, stimuli such as a high-fat diet can cause macrophages to fully polarize into the M1 phenotype, which is characterized by the high expression of pro-inflammatory cytokines, stimulating HSCs to release extracellular matrix and leading to a gradual aggravation of fibrosis. Increasing evidence indicates that the metabolic switch between glycolysis and mitochondrial oxidative phosphorylation plays an important role in macrophage polarization. M1 macrophages mainly rely on glycolysis, while M2 macrophages utilize the tricarboxylic acid cycle and oxidative phosphorylation. Therefore, factors affecting macrophage metabolism may disrupt the M1 / M2 balance and exacerbate inflammation. However, how macrophages regulate liver metabolism, inflammation, and fibrosis programs remains poorly understood.
[0004] The vertebrate genome encodes three nuclear factors, namely erythroid-derived nuclear factor-related proteins 2 (Nrf1-3). Although they have similar DNA-binding patterns, Nrf1, Nrf2, and Nrf3 exhibit different biological functions and regulate partially overlapping sets of target genes. Nrf2 is the best-known cap 'n' collar basic region leucine zipper factor and is widely regarded as the main regulator of the antioxidant response in inflammatory diseases in humans and mice. Similar to Nrf2, Nrf1 can bind to the ARE region and plays a central role in maintaining organ integrity. However, the regulatory mechanisms of Nrf1 activation, its target genes, and its requirements for cellular homeostasis seem to be different from those of Nrf2. Nrf1 is mainly located in the endoplasmic reticulum and can be activated by the DNA damage-inducible protein 1 homolog 2 (DDI2) proteasome under pathological conditions. After activation, Nrf1 translocates to the nucleus and initiates the transcriptional program. Growing evidence indicates that inactivation of Nrf1 in hepatocytes leads to mitochondrial dysfunction and subsequent alcoholic steatohepatitis. In addition, hepatocytes lacking Nrf1 exhibit a strong oxidative stress response. With the reduced expression of multiple ARE-containing genes, it results in liver inflammation, fibrosis, and tumorigenic growth.
[0005] Krüppel-like transcription factors (KLFs) belong to the zinc finger transcription factor family and are involved in growth, development, and metabolic homeostasis. Numerous studies have shown that KLF9, KLF10, and KLF15 regulate hepatic glucose homeostasis by increasing the activity of peroxisome proliferator-activated receptor-γ coactivator-1α. Recently, KLF6 has been identified as a new regulator of autophagy and has become a new target for protection after liver transplantation. As one of the best-known KLFs, KLF16 coordinates multiple hepatic pathological processes, including hepatic lipid metabolism and insulin response.
[0006] TFAM is one of the most abundant mitochondrial DNA-binding proteins and regulates the transcription and packaging of mitochondrial DNA. Tissue-specific deficiency of TFAM impairs oxidative phosphorylation (OXPHOS) and causes mitochondrial genetic diseases in humans and mice. Previous studies have demonstrated that TFAM plays a key regulatory role in the KLF16 signaling pathway and the Nrf1 signaling pathway. Through chromatin immunoprecipitation experiments, it has been confirmed that KLF16 specifically and directly binds to the BTE region of the TFAM promoter in glioma cells. In an alcohol-induced liver injury model, Nrf1 silencing led to a decrease in TFAM expression and mitochondrial DNA depletion.
[0007] However, previous studies have mainly focused on the profibrotic function of Nrf1 in mesenchymal cells such as hepatocytes and have overlooked its role in inflammatory cells such as macrophages. Therefore, in-depth understanding of the unique immunomodulatory mechanisms of TFAM and KLF16 in macrophages may provide valuable insights into preventing and effectively reversing ongoing liver fibrosis. Summary of the Invention
[0008] In view of this, the present invention aims to propose the application of TFAM in the preparation of drugs for treating liver fibrosis, so as to deeply understand the mechanism of action of TFAM in liver fibrosis.
[0009] To achieve the above object, the technical solution of the present invention is realized as follows: The first aspect of the present invention provides the application of TFAM or its upregulator, or its activator in the preparation of drugs for treating liver fibrosis.
[0010] The second aspect of the present invention provides the application of TFAM or its upregulator, or its activator in the preparation of drugs for inhibiting M1 polarization and mitochondrial damage in fibrotic liver.
[0011] Further, the upregulator described in the first aspect or the second aspect of the present invention is selected from small molecule compounds or biological macromolecules.
[0012] Further, the liver fibrosis described in the first aspect of the present invention is liver fibrosis caused by cholestasis, viral hepatitis, or fatty liver.
[0013] The third aspect of the present invention provides the application of KLF16 or its upregulator, or its activator in the preparation of drugs for treating liver fibrosis.
[0014] The fourth aspect of the present invention provides the application of KLF16 or its upregulator, or its activator in the preparation of drugs for inhibiting M1 polarization and mitochondrial damage in fibrotic liver.
[0015] Further, the upregulator described in the third aspect or the fourth aspect of the present invention is selected from small molecule compounds or biological macromolecules.
[0016] Further, the liver fibrosis described in the third aspect of the present invention is liver fibrosis caused by cholestasis, viral hepatitis, or fatty liver.
[0017] The fifth aspect of the present invention provides a pharmaceutical composition for treating liver fibrosis diseases, comprising TFAM or its upregulator, or its activator described in the first aspect or the second aspect of the present invention, or KLF16 or its upregulator, or its activator described in the third aspect or the fourth aspect of the present invention, and a pharmaceutically acceptable carrier.
[0018] Further, the dosage form of the pharmaceutical composition is tablets, capsules, suspensions, syrups, granules, creams, pills, gels, patches, sprays, aerosols, oral liquids or injections.
[0019] Compared with the prior art, the application of TFAM described in the present invention in the preparation of drugs for treating liver fibrosis has the following advantages: The research results of the present invention show that the knockout of KLF16 inhibits TFAM expression, accompanied by impaired mitochondrial function, but increases the level of iNOS in Foxo1 M-KO macrophages under LPS stimulation. However, overexpression of KLF16 can positively regulate the mitochondrial TFAM level of Nrf1 under LPS stimulation and reduce mtDNA leakage in M-KO macrophages. The disruption of TFAM leads to a decrease in the amount of mitochondrial DNA and a reduction in complex I activity, but promotes macrophage M1 polarization. Overexpression of TFAM in macrophages significantly improves mitochondrial dysfunction and inflammatory responses. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] The drawings constituting a part of the present invention are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings: Figure 1 A shows the comparison of Nrf1 mRNA expression levels in normal and fibrotic liver tissues detected by qRT-PCR technology in Example 1 of the present invention; Figure 1 B-C show the negative correlation between serum ALT values and liver Nrf1 expression in MASH and liver cirrhosis patients in Example 1 of the present invention; Figure 1 D is a double immunofluorescence staining image in Example 1 of the present invention, showing the localization of Nrf1 mainly on macrophages in human fibrotic liver tissue; Figure 1 E-G show the comparison of Nrf1 protein levels in liver samples of three different mouse liver fibrosis models (HFD, CCl4, BDL) and their control groups in Example 1 of the present invention; Figure 1 H is a double immunofluorescence staining image in Example 1 of the present invention, comparing the difference in the number of Nrf1+CD68+ macrophages in fibrotic and control livers; Figure 2 A shows the expression of Nrf1 in liver macrophages of two mouse models detected by labeling technology in Example 2 of the present invention; Figure 2 B shows the changes in serum ALT and AST levels in three mice after liver fibrosis induction treatment in Example 2 of the present invention; Figure 2 C shows the staining results of HE, Masson, Sirius Red and α-SMA in Example 2 of the present invention, which are used to visually display the pathological changes and fibrosis degree of liver tissues of three mice; Figure 2D-G shows the comparison of the expression levels of TGF-β, Col1a1, TIMP1, and type I collagen in three types of mouse liver tissues in Example 2 of the present invention; Figure 3 A shows the comparison of the expression levels of TNF-α and IL-1β in fibrotic liver tissues in Example 3 of the present invention; Figure 3 B shows the comparison of the levels of TNF-α and IL-1β in serum between Nrf1 M-KO mice and control mice in Example 3 of the present invention; Figure 3 C shows the infiltration of macrophages and neutrophils in fibrotic liver tissues by labeling F4 / 80, CD11b, and Ly6G in Example 3 of the present invention; Figure 3 D shows the expression changes of iNOS mRNA and Arg1 mRNA in fibrotic livers in Example 3 of the present invention; Figure 3 E shows the change in ATP production among different groups in Example 3 of the present invention; Figure 3 F shows the difference in mtROS release in Example 3 of the present invention; Figure 3 G shows the analysis of the degree of mitochondrial damage in Example 3 of the present invention; Figure 4 A shows the expression levels of Foxo1 mRNA and protein in Example 4 of the present invention; Figure 4 B shows the expression of Foxo1 in Example 4 of the present invention; Figure 4 C shows the serum ALT and AST levels in Example 4 of the present invention; Figure 4 D shows the histological lesions and the severity of fibrosis in liver tissues in Example 4 of the present invention; Figure 4 E-F shows the expression levels of TNF-α mRNA and iNOS mRNA in Example 4 of the present invention; Figure 4 G shows the interruption of ATP generation in Example 4 of the present invention; Figure 4 H shows the release of mtDNA in Example 4 of the present invention; Figure 4 I shows the fragmentation of mitochondria in Example 4 of the present invention; Figure 5 A shows the relative nuclear levels of Nrf1 and Foxo1 in macrophages before and after LPS treatment in Example 5 of the present invention; Figure 5B is the double immunofluorescence image in Example 5 of the present invention; Figure 5 C is the result of the immunoprecipitation experiment in Example 5 of the present invention; Figure 5 D is the result of the ChIP-seq experiment in Example 5 of the present invention; Figure 5 E is the result of the ChIP-PCR experiment in Example 5 of the present invention; Figure 5 F is the result of the RNA in situ hybridization experiment in Example 5 of the present invention; Figure 5 G-J show the effects of Foxo1 or Nrf1 deletion on KLF16, TFAM, ATP production, mtDNA copy number, and iNOS expression in Example 5 of the present invention; Figure 6 A shows the changes in TFAM and CytC after KLF16 knockdown in Example 6 of the present invention; Figure 6 B shows the effects of KLF16 knockdown on TFAM, iNOS, and ROS levels in Example 6 of the present invention; Figure 6 C shows the situation of mtDNA leakage after KLF16 knockdown in Example 6 of the present invention; Figure 6 D shows the comparison of ATP production after KLF16 knockdown in Example 6 of the present invention; Figure 6 E shows the effect of KLF16 knockdown on the expression level of IL-1β in Example 6 of the present invention; Figure 6 F shows the effects of KLF16 activation on the expression of TFAM and CytC in Example 6 of the present invention; Figure 6 G shows the effects of KLF16 activation on TFAM, iNOS, and ROS levels in Example 6 of the present invention; Figure 6 H shows the change in mtDNA copy number after KLF16 activation in Example 6 of the present invention; Figure 6 I shows the comparison of ATP production after KLF16 activation in Example 6 of the present invention; Figure 6 J shows the effect of KLF16 activation on IL-1β secretion in Example 6 of the present invention; Figure 7 A shows the change in the activity of mitochondrial respiratory complex I after TFAM knockdown in Example 7 of the present invention; Figure 7 B shows the comparison of the change in ATP production after TFAM knockdown in Example 7 of the present invention; Figure 7 C shows the change in mtDNA copy number upon TFAM knockdown in Example 7 of the present invention; Figure 7 D shows the production of ROS upon TFAM knockdown in Example 7 of the present invention; Figure 7 E shows the change in the mRNA expression level of pro-inflammatory cytokines upon TFAM knockdown in Example 7 of the present invention; Figure 7 F shows the change in the protein expression level of iNOS upon TFAM knockdown in Example 7 of the present invention; Figure 7 G shows the change in the activity of mitochondrial respiratory complex I upon TFAM overexpression in Example 7 of the present invention; Figure 7 H shows the comparison of the change in ATP production upon TFAM overexpression in Example 7 of the present invention; Figure 7 I shows the change in mtDNA copy number upon TFAM overexpression in Example 7 of the present invention; Figure 7 J shows the production of ROS upon TFAM overexpression in Example 7 of the present invention; Figure 7 K shows the change in the protein expression level of iNOS upon TFAM overexpression in Example 7 of the present invention; Figure 7 L shows the change in the mRNA expression level of pro-inflammatory cytokines upon TFAM overexpression in Example 7 of the present invention. Detailed implementation manners
[0021] It should be noted that, without conflict, the embodiments in the present invention and the features in the embodiments can be combined with each other.
[0022] The present invention will be described in detail below with reference to the drawings and in combination with the embodiments.
[0023] The up-regulators of Nrf1 described in the present invention include promoters, agonists, etc. Any substance that can increase the activity of Nrf1 protein, maintain the stability of Nrf1 protein, promote the expression of Nrf1 protein, promote the secretion of Nrf1 protein, extend the effective action time of Nrf1 protein, or promote the transcription and translation of Nrf1 can be used in the present invention.
[0024] As a preferred embodiment of the present invention, the upregulators of Nrf1 include (but are not limited to): expression vectors or expression constructs that can express (preferably overexpress) Nrf1 after being transfected into cells. Generally, the expression vector contains a gene cassette, and the gene cassette contains a gene encoding Nrf1 and an expression regulatory sequence operably linked thereto. The term "operably linked" or "operably connected" refers to a situation where certain parts of a linear DNA sequence can regulate or control the activity of other parts of the same linear DNA sequence. For example, if a promoter controls the transcription of a coding sequence, then it is operably linked to the coding sequence.
[0025] Materials and Methods Human liver samples Liver samples were obtained from 30 patients with hemangioma who underwent hepatectomy at Tianjin First Central Hospital. Among them, 10 patients were diagnosed with liver cirrhosis; 10 patients were diagnosed with metabolic dysfunction-associated steatohepatitis (MASH). The included control individuals had no history of diabetes, alcohol abuse, or viral hepatitis. Pathologists diagnosed liver fibrosis using hematoxylin and Masson staining. Two senior pathologists graded the liver fibrosis samples according to an established fibrosis scoring system. The study design and sample collection protocol have been approved by the Ethics Committee of Tianjin First Central Hospital. All patients signed informed consent forms at the time of recruitment.
[0026] Animal experiments All mice were housed in a specific pathogen-free (SPF) animal facility with controlled temperature and humidity, and were subjected to a 12-hour light-dark cycle, with free access to food and water.
[0027] To study liver fibrosis induced by a high-fat diet (HFD), 4-week-old male mice were fed either a normal chow diet (NCD) containing 18.3% protein, 10.2% fat, and 71.5% carbohydrates (Research Diets, New Brunswick, Canada), or an HFD containing 61.6% protein, 61.6% fat, and 20.3% carbohydrates (Research Diets) for 26 weeks.
[0028] To study liver fibrosis induced by carbon tetrachloride (CCl4), 6-8-week-old male mice were randomly assigned to receive intraperitoneal injection of olive oil or CCl4 (dissolved in olive oil at a volume ratio of 10% and a concentration of 2 mg / kg). The injections were performed twice a week for 8 weeks.
[0029] To study bile duct ligation (BDL)-induced liver fibrosis, male mice aged 6 - 8 weeks were subjected to surgical intervention. Specifically, the mice were anesthetized with isoflurane, and after skin disinfection, a midline abdominal incision was made, followed by exposure and ligation of the common bile duct with 5-0 non-absorbable sutures. Samples were collected 4 weeks after the operation.
[0030] This study was conducted in accordance with the regulations described in the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health.
[0031] Construction of myeloid-specific knockout mice Male mice of the following genotypes were used in this study: wild type (WT), FloxP-Nrf1 (Nrf1 FL / FL ), FloxP-Foxo1 (Foxo1 FL / FL ), myeloid cell-specific Nrf1 knockout mice (Nrf1 M-KO ), and myeloid cell-specific Foxo1 knockout mice (Foxo1 M-KO ). All mice were obtained on a C57BL / 6 background.
[0032] Floxed Nrf1 (Nrf1 FL / FL ) mice (C57BL / 6JCya-Nrf1 em1flox / Cya) and floxed Foxo1 (Foxo1 FL / FL ) mice (C57BL / 6NCya-Foxo1 em1flox / Cya) used in this study were purchased from Cyagen Biosciences (Suzhou) Inc., and mice expressing Cre recombinase under the control of the lysozyme 2 (Lysozyme 2, Lyz2) promoter (LysM-Cre; purchased from Cyagen Biosciences (Suzhou) Inc.) were used to generate myeloid cell-specific Nrf1 knockout mice (Nrf1 M-KO ) and myeloid cell-specific Foxo1 knockout mice (Foxo1 M-KO ). Generation of Nrf1 M-KO mice was completed in two steps: First, homozygous floxed Nrf1 mice were crossed with homozygous Lyz2-Cre mice to produce F1 generation mice, which were heterozygous for both the Nrf1 allele at the loxP-site and the Lyz2-Cre allele. Subsequently, these F1 generation mice were backcrossed with homozygous Nrf1 FL / FL mice, and finally Nrf1 M-KO mice (25% of the offspring) were obtained. These mice were homozygous for the Nrf1 allele at the loxP site and heterozygous for the Lyz2-Cre allele. The breeding method of Foxo1 M-KO mice was the same as that of Nrf1 M-KOThe breeding methods of mice are similar.
[0033] Isolation, culture and treatment of primary macrophages To differentiate bone marrow-derived macrophages (BMDMs), they were treated with recombinant M-CSF (M9170, Sigma-Aldrich). The specific steps were as follows: From male mice that had been euthanized, the femurs and tibias were carefully removed from the laminar flow hood. Subsequently, bone marrow cells were flushed from these bones into a container containing DMEM using a 20 mL syringe with a 30 G needle. After washing to remove red blood cells with Roche buffer (11814389001), they were rinsed with PBS and cultured in DMEM medium enriched with 20 ng / mL M-CSF and 10% fetal bovine serum (FBS). After four days of culture, the cells were washed with PBS and the medium was replaced. By day 7, the cells had fully differentiated into BMDMs. Subsequently, BMDMs (1×10 6 ) were transfected with CRISPR KLF6 activation, CRISPR TFAM activation, KLF6-siRNA, TFAM-siRNA, and a control vector (SantaCruz Biotechnology), and transfection was performed using Lipofectamine according to the manufacturer's instructions (Invitrogen). The transfected cells were treated with lipopolysaccharide (LPS, 100 ng / ml) for 6 hours.
[0034] Experimental results Example 1: In macrophages of fibrotic liver tissue, the expression of Nrf1 is decreased By analyzing 30 human liver samples (including normal and fibrotic liver tissues), according to qRT-PCR detection, compared with normal liver, the messenger RNA (mRNA) expression of Nrf1 in fibrotic liver was significantly decreased ( Figure 1 A). The serum alanine aminotransferase (ALT) level in patients with non-alcoholic steatohepatitis (MASH) or cirrhosis was negatively correlated with the expression of Nrf1 in liver biopsies ( Figure 1 B-C). To determine the specific expression of Nrf1 in different cell types, we used double immunofluorescence staining technology, and the results showed that Nrf1 was mainly expressed on macrophages in human fibrotic liver ( Figure 1 D). Subsequently, we evaluated the Nrf1 protein level in three mouse liver fibrosis models including HFD-induced, CCl4-induced, and BDL-induced. Consistent with the results of human samples, the results of all mouse models showed that the Nrf1 protein level in fibrotic liver samples was lower than that in the control group ( Figure 1E-G). Double immunofluorescence staining further confirmed that the number of Nrf1+CD68+ macrophages in fibrotic livers was significantly less than that in the control group livers ( Figure 1 H). In summary, our data indicate that Nrf1 is significantly inhibited in fibrotic liver tissues, especially in liver macrophages.
[0035] Example 2: Myeloid-specific Nrf1 knockout exacerbates liver fibrosis To better clarify the role of Nrf1 in macrophages in liver fibrosis, we used the Cre-LoxP system to create a myeloid-specific Nrf1-KO (Nrf1 M-KO ) mouse model. The experimental results showed that the expression of Nrf1 was successfully knocked out in liver macrophages of Nrf1 M-KO mice, while it remained normally expressed in control Nrf1 FL / FL mice ( Figure 2 A). Then, liver fibrosis was induced by giving Nrf1 FL / FL and Nrf1 M-KO mice HFD induction, CCl4 injection, or BDL surgery. The results showed that in Nrf1 M-KO mice, the levels of ALT (alanine aminotransferase) and AST (aspartate aminotransferase) in the serum increased ( Figure 2 B), suggesting aggravated hepatocyte injury. In addition, Nrf1 M-KO mice showed more severe histopathological damage and liver fibrosis than Nrf1 FL / FL mice, as shown by the results of HE, Masson, Sirius Red, and α-SMA staining ( Figure 2 C). Further analysis showed that the expression levels of TGF-β, Col1a1, TIMP1, and type I collagen in the liver tissues of Nrf1 M-KO mice were significantly higher than those in littermate control mice, demonstrating that Nrf1 M-KO mice had a higher degree of liver fibrosis ( Figure 2 D-G). Our results indicate that myeloid Nrf1 deficiency exacerbates liver fibrosis in mice.
[0036] Example 3: Myeloid Nrf1 knockout promotes inflammatory response and mitochondrial damage in fibrotic liver Subsequently, we investigated the effect of Nrf1-deficient macrophages on local inflammation in fibrotic liver tissues. The experimental results showed that the expression levels of TNF-α and IL-1β in the livers obtained from Nrf1 M-KO mice were significantly increased compared with the control group ( Figure 3 A). In addition, the levels of TNF-α and IL-1β in the serum of Nrf1 M-KO mice were higher than those in littermate control mice.Figure 3 B). To evaluate the accumulation of inflammatory cells in fibrotic liver tissues, we detected using macrophage markers F4 / 80 and CD11b, as well as neutrophil marker Ly6G. The results showed that compared with Nrf1 FL / FL mice, myeloid-specific Nrf1 deficiency significantly exacerbated macrophage and neutrophil infiltration in fibrotic livers ( Figure 3 C). In the fibrotic livers of Nrf1 M-KO mice, the mRNA expression level of iNOS was upregulated, while the mRNA expression level of Arg1 was downregulated ( Figure 3 D), indicating that Nrf1 deficiency may promote M1 polarization. In addition, compared with the control group, myeloid Nrf1 deficiency showed severe mitochondrial dysfunction, manifested as reduced ATP production ( Figure 3 E), increased mtROS release ( Figure 3 F), and exacerbated mitochondrial damage ( Figure 3 G).
[0037] Example 4. Disruption of myeloid Foxo1 inhibits M1 polarization and mitochondrial dysfunction in fibrotic livers Since the Foxo1 signaling pathway can be activated in acute or chronic hepatitis, we subsequently explored whether the Foxo1 signaling pathway affects the inflammatory response and mitochondrial function in liver fibrosis. First, we detected the expression of Foxo1 in liver fibrosis samples. The experimental results showed that compared with the normal control group, the mRNA and protein levels of Foxo1 in fibrotic livers were significantly increased ( Figure 4 A). Different from Foxo1 FL / FL mice, Foxo1 expression was not shown in Foxo1 M-KO mice ( Figure 4 B). In addition, the levels of serum ALT and AST ( M-KO C), histological lesions of liver tissues, and the severity of fibrosis ( Figure 4 D) in Foxo1 Figure 4 mice were all inhibited. At the same time, compared with the Foxo1 FL / FL control group, the mRNA expressions of TNF-α and iNOS in the livers of Foxo1 M-KO mice were significantly decreased ( Figure 4 E-F), indicating an improvement in the inflammatory response of fibrotic livers. Finally, mitochondrial dysfunction in the fibrotic livers of Foxo1 M-KO mice was also improved, manifested as interrupted ATP production ( Figure 4 G), mtDNA release ( Figure 4 H), and mitochondrial fragmentation ( Figure 4 I).
[0038] Example 5: Nrf1 directly binds to Foxo1 and regulates the transcription of KLF6 in macrophages To further explore the mechanism by which macrophage Nrf1 and Foxo1 regulate liver fibrosis, we extracted nuclear proteins to study the intracellular distribution of these two proteins under LPS stimulation. The experimental results showed that LPS could induce a decrease in nuclear Nrf1 levels and an increase in Foxo1 ( Figure 5 A). Double immunofluorescence analysis showed that Nrf1 and Foxo1 were co-localized in the nucleus ( Figure 5 B). In addition, immunoprecipitation experiments demonstrated the binding of Nrf1 and Foxo1 in macrophages ( Figure 5 C). Subsequently, to explore the potential role of the Nrf1-Foxo1 interaction, we performed chromatin immunoprecipitation combined with massively parallel sequencing (ChIP-Seq) experiments. The results showed that Foxo1 ChIP-seq peaks were detected within the KLF16 gene, one of which was located in the promoter region, and the others were located in introns and exons ( Figure 5 D). To confirm the Foxo1 ChIP-seq peak in the KLF16 promoter region, ChIP-PCR experiments were performed in LPS-stimulated BMDMs using a Foxo1 antibody. After ChIP with the Foxo1 antibody, PCR analysis was performed using specifically designed primers to identify the Foxo1 DNA binding site in the KLF16 promoter ( Figure 5 E).
[0039] According to the ChIP results, RNA in situ hybridization experiments demonstrated that Foxo1 deficiency enhanced the expression of KLF16 transcripts in LPS-stimulated macrophages. Conversely, disruption of Nrf1 led to a decrease in KLF16 transcript levels ( Figure 5 F). Consistently, Foxo1 deficiency decreased the protein expression of KLF16 and TFAM in macrophages, accompanied by a decrease in ATP production and an increase in mDNA copy number. In addition, the expression of iNOS in Foxo1-deficient macrophages was also lower than that in the control group ( Figure 5 G-J). Different from Nrf1 FL / FL macrophages, Nrf1 M-KO promoted the protein levels of KLF16 and TFAM, but reversed mitochondrial damage and inhibited macrophage M1 polarization ( Figure 5 G-J). Taken together, these results indicate that the Nrf1-Foxo1 complex plays an important role in the regulation of its target gene KLF16, which may be involved in energy imbalance and the progression of liver fibrosis.
[0040] Example 6: Mitochondrial function and M1 polarization regulated by the Nrf1-Foxo1 axis require KLF16 To further determine the effect of KLF16 on mitochondrial function regulated by the Nrf1-Foxo1 axis and macrophage M1 polarization, we generated KLF16-knockdown BMMs. The specific experimental steps were as follows: 1×10 6 bone marrow-derived macrophages (BMDMs) were used for transfection experiments. First, according to the instructions of the manufacturer (Santa Cruz Biotechnology), siRNA targeting the KLF16 gene (KLF16-siRNA) (the nucleic acid sequence of the siRNA is shown in SEQ ID NO.1, specifically GGGAAAGAAATTATTTATTGTCC) and a control vector (as a negative control) were prepared. The transfection experiment was carried out using Lipofectamine 3000 reagent (from Invitrogen). Specifically, the transfection complex was prepared according to the product operation instructions: an appropriate amount of KLF16-siRNA or the control vector was respectively mixed with diluted Lipofectamine and incubated at room temperature for 10 - 20 minutes to form a stable transfection complex. Then, the complex was added to the BMDMs culture plate, and the cells and the transfection reagent were co-incubated in serum-free medium for 4 - 6 hours. After the incubation, the culture medium was replaced with fresh complete medium (such as DMEM containing 10% FBS), and the cells were continued to be cultured in an incubator at 37°C and 5% CO2. The transfection efficiency and the knockdown efficiency of the KLF16 gene were verified by western blot 24 hours after transfection. A control group (BMDMs transfected with the control vector) was set up synchronously in the experiment to ensure specificity and reliability.
[0041] The results showed that the deletion of KLF16 led to a decrease in TFAM and an increase in CytC ( Figure 6 A), and the abundance of TFAM in mitochondria (marker Tom20) was also reduced by KLF16 siRNA intervention ( Figure 6 B). In addition, the deletion of KLF16 led to mitochondrial dysfunction, manifested as an increase in mtDNA leakage ( Figure 6 C), a decrease in ATP production ( Figure 6 D), and an increase in ROS production ( Figure 6 B), and these phenomena were all reflected in Foxo1-knockout BMMs. In addition, KLF16 knockdown significantly exacerbated the expression of pro-inflammatory factors IL-1β ( Figure 6 E) and iNOS ( Figure 6 B).
[0042] Next, we investigated the effect of KLF16 on mitochondrial biogenesis and inflammatory responses in Nrf1 knockout macrophages. Bone marrow-derived macrophages deficient in Nrf1 were transfected with a KLF16 activation plasmid and stimulated with LPS. The results showed that KLF16 activation led to an increase in the protein level of TFAM, while the expression of CytC was inhibited in Nrf1-deficient bone marrow-derived macrophages ( Figure 6 F). In particular, the KLF16 activation plasmid enhanced the content of TFAM in mitochondria ( Figure 6 G). Subsequently, we determined the role of KLF16 in mitochondrial function and macrophage damage in Nrf1-deficient bone marrow-derived macrophages, showing that the KLF16 activation plasmid reversed the mtDNA copy number ( Figure 6 H) and ROS production ( Figure 6 G), while ATP production was restored compared with Nrf1 knockout cells in the control group ( Figure 6 I). In addition, KLF16 activation also eliminated the pro-inflammatory IL-1β release ( Figure 6 J) and macrophage M1 polarization ( Figure 6 G) induced by Nrf1 knockout. These results verified that the mitochondrial function of KLF16 is crucial for M1 polarization and inflammation regulated by the Nrf1-Foxo1 axis.
[0043] Example 7: TFAM is crucial for maintaining mitochondrial biogenesis and participating in anti-inflammatory innate immunity To further test the functional role of TFAM in regulating mitochondrial biogenesis and innate immunity, we isolated BMMs from Foxo1 M-KO and Nrf1 M-KO mice. The specific experimental steps were as follows: 1×10 6Bone marrow-derived macrophages (BMDMs) were used for transfection experiments. First, according to the instructions of the manufacturer (Santa Cruz Biotechnology), siRNA targeting the TFAM gene (F-siRNA) (the nucleic acid sequence of the siRNA is shown in SEQ ID NO.2, specifically GTCTGTATTCCGAAGTGTTTTTC) and a control vector (as a negative control) were prepared. The transfection experiment was carried out using Lipofectamine 3000 reagent (from Invitrogen), and the transfection complex was prepared according to the product operation instructions: an appropriate amount of TFAM-siRNA or the control vector was mixed with diluted Lipofectamine 3000 respectively and incubated at room temperature for 10 - 20 minutes to form a stable transfection complex. Then, the complex was added to the BMDMs culture plate, and the cells and the transfection reagent were co-incubated in serum-free medium for 4 - 6 hours. After incubation, the culture medium was replaced with fresh complete medium (such as DMEM containing 10% FBS), and the cells were continued to be cultured in an incubator at 37°C and 5% CO2. The transfection efficiency and the knockdown efficiency of the TFAM gene in the transfected cells were verified by western blot 24 hours later. A control group (BMDMs transfected with the control vector) was set up synchronously in the experiment to ensure specificity and reliability.
[0044] The results showed that siRNA-mediated TFAM knockdown exacerbated mitochondrial damage in LPS-treated Foxo1 M-KO macrophages, as manifested by a decrease in the activity of mitochondrial respiratory complex I ( Figure 7 A), a reduction in ATP production ( Figure 7 B), an increase in mtDNA copy number ( Figure 7 C), and an increase in ROS release ( Figure 7 D). In addition, we observed that TFAM knockdown enhanced the expression of pro-inflammatory cytokines ( Figure 7 E) and the protein level of iNOS ( Figure 7 F) in macrophages. However, TFAM overexpression restored mitochondrial function ( Figure 7 G-J), and inhibited pro-inflammatory M1 polarization ( Figure 7 K-L).
[0045] Conclusion The above experiments demonstrated that the Nrf1 / Foxo1 axis-mediated regulation of mitochondrial metabolism is crucial for the regulation of macrophage function in liver fibrosis. The main findings included: (1) reduced Nrf1 expression in macrophages, which was negatively correlated with the histological damage observed in liver fibrosis; (2) myeloid Nrf1 deficiency exacerbated M1 polarization, enhanced the inflammatory response, and promoted liver fibrosis; (3) Nrf1 directly bound to Foxo1 and inhibited downstream KLF16 transcription in the nucleus; (4) KLF16 was crucial for Nrf1 / Foxo1-regulated mitochondrial energy metabolism, macrophage polarization, and inflammatory response in fibrotic livers. Our results confirmed the key role of Nrf1 in regulating macrophage mitochondrial function and inflammation during liver fibrosis.
[0046] Nrf1 in macrophages enhances mitochondrial protein turnover through the ubiquitin proteasome system, thereby alleviating mitochondrial stress and inflammation. Our data showed that Nrf1 expression in macrophages was significantly reduced in liver fibrosis tissues from both humans and mice. Additionally, myeloid Nrf1 deficiency was associated with impaired energy consumption, M1 polarization, and fibrosis. Our findings highlight the regulatory role of Nrf1 in macrophage inflammatory responses during the progression of liver fibrosis.
[0047] We observed that metabolic stress upregulated Foxo1 expression in three different mouse models of liver fibrosis. Additionally, Foxo1 deficiency in macrophages led to reduced ROS production, restored mitochondrial biogenesis, and alleviated inflammation.
[0048] Furthermore, Nrf1 could translocate into the nucleus and interact with Foxo1 to regulate the transcription of genes related to mitochondrial biogenesis. Our in vitro studies showed that nuclear expression of both Nrf1 and Foxo1 increased under LPS stimulation. Importantly, Nrf1 interacted with Foxo1 in the nucleus through direct binding. Additionally, ChIP sequencing and ChIP assays showed that Nrf1 and Foxo1 co-localized in the promoter region of KLF16, indicating that KLF16 was a genuine target gene of Foxo1 and was regulated by the Nrf1-Foxo1 complex. Moreover, disruption of the Foxo1 signaling pathway reduced KLF16 expression, while Nrf1 deficiency enhanced KLF16 transcription. This suggested that Nrf1 functioned as a transcriptional corepressor of Foxo1 in situations involving mitochondrial dysfunction, macrophage M1 polarization, and inflammation.
[0049] The above experiments showed that Foxo1 inhibited the expression of KLF16 by directly interacting with its promoter. Upregulated transcription of KLF16 promoted mitochondrial biogenesis in macrophages.
[0050] KLF16 knockout inhibited TFAM expression, accompanied by impaired mitochondrial function, but increased the level of Foxo1 in macrophages stimulated with LPS. M -KO However, KLF16 overexpression could positively regulate the mitochondrial TFAM level of Nrf1 under LPS stimulation and reduce mtDNA leakage in M-KO macrophages. Consistent with this finding, disruption of TFAM led to a decrease in the amount of mitochondrial DNA and a reduction in complex I activity, but promoted macrophage M1 polarization. Finally, overexpression of TFAM in macrophages significantly improved mitochondrial dysfunction and inflammatory responses. Taken together, these results revealed that the KLF16-TFAM axis was mechanistically involved in mitochondrial stress-dependent innate immune regulation.
[0051] In summary, our study clarified the functional role of the macrophage Nrf1-Foxo1 signaling pathway in the pathogenesis of liver fibrosis. The results showed that macrophage Nrf1 deficiency mediated liver fibrosis by impairing mitochondrial biogenesis and mitochondrial respiratory function. Mechanistically, Nrf1, as a transcriptional corepressor of Foxo1, exerted its function through direct interaction. The target gene KLF16 regulated by the Nrf1-Foxo1 complex was crucial for regulating mitochondrial function and immune responses. By clarifying the molecular pathway by which the Nrf1-Foxo1 axis mediated liver inflammation, our findings laid a theoretical foundation for the development of personalized treatment strategies targeting macrophage-mediated liver inflammatory responses and fibrosis.
[0052] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included in the protection scope of the present invention.
Claims
1. Use of TFAM or its upregulator or its activator in the preparation of a drug for treating liver fibrosis.
2. Use of TFAM or its upregulator or its activator in the preparation of a drug for inhibiting M1 polarization and mitochondrial damage in fibrotic liver.
3. The application according to claim 1 or 2, characterized in that: The upregulator is selected from small molecule compounds or biological macromolecules.
4. The application according to claim 1, characterized in that: The liver fibrosis is liver fibrosis caused by cholestasis, viral hepatitis or fatty liver.
5. Use of KLF16 or its upregulator or its activator in the preparation of a drug for treating liver fibrosis.
6. Use of KLF16 or its upregulator or its activator in the preparation of a drug for inhibiting M1 polarization and mitochondrial damage in fibrotic liver.
7. The application according to claim 5 or 6, characterized in that: The upregulator is selected from small molecule compounds or biological macromolecules.
8. The application according to claim 5, wherein: The liver fibrosis is liver fibrosis caused by cholestasis, viral hepatitis or fatty liver.
9. A pharmaceutical composition for treating liver fibrosis diseases, characterized in that: Comprising TFAM or its upregulator or its activator according to any one of claims 1-4, or KLF16 or its upregulator or its activator according to claims 5-8, and a pharmaceutically acceptable carrier.
10. A pharmaceutical composition for treating liver fibrosis diseases according to claim 9, characterized in that: The dosage form of the pharmaceutical composition is tablet, capsule, suspension, syrup, granule, cream, pill, gel, patch, spray, aerosol, oral liquid or injection.