Rice residue oligopeptide and application thereof in reducing uric acid

Abstract

The invention belongs to the technical field of biochemistry, and particularly relates to a rice residue oligopeptide and application thereof in reducing uric acid, and the amino acid sequence of the rice residue oligopeptide is any one of SEQ ID NO: 3, SEQ ID NO: 9 and SEQ ID NO: 10. The rice residue oligopeptide can realize multi-target simultaneous intervention of multiple links of uric acid metabolism, has the characteristics of inhibiting uric acid generation, promoting uric acid excretion and resisting oxidation, can realize an excellent uric acid reducing effect, and provides a further theoretical basis for deep development of rice processing byproducts.

Description

Technical Field

[0001] The present invention belongs to the technical field of biochemistry, and particularly relates to a rice residue short peptide and its application in reducing uric acid. Background Art

[0002] Due to the increasing consumption of foods rich in purine and fructose, such as seafood, broth, milk tea, and beer, the prevalence of hyperuricemia (HUA) has increased significantly globally. Uric acid (UA) is the end product of the purine metabolic pathway. The occurrence of abnormal serum uric acid (SUA) levels is due to higher production by liver metabolism and cell renewal, lower excretion by the kidneys and gastrointestinal tract, or a combination of the two processes. Uric acid is mainly excreted by the proximal renal tubules. The kidneys play a crucial role in regulating circulating uric acid levels. Dysfunction of the kidneys in handling UA may be a common pathophysiological feature supporting HUA. And continuous serum uric acid levels above the point (>6.8 mg / dL) can lead to the conversion of uric acid into monosodium urate (MSU) crystals.

[0003] To overcome the burden of HUA, one of the main methods is to reduce UA levels, which can be achieved by inhibiting the synthesis and reabsorption of UA or increasing its excretion. There are many drugs for treating HUA on the market, such as allopurinol that reduces UA production and benzbromarone that increases UA excretion, but long-term use may cause liver and kidney toxicity and allergic reactions. Therefore, it is necessary to explore alternative treatment options that can effectively manage HUA with low or no side effects. Natural compounds extracted from foods and plants have the potential to reduce UA levels. Food-derived bioactive peptides (Fbp), as a kind of bioactive functional ingredient, have received extensive attention. Fbp can reduce blood UA levels and alleviate HUA by inhibiting key enzymes such as xanthine oxidase, increasing renal UA excretion, inhibiting renal UA reabsorption, increasing antioxidant activity, regulating inflammatory mediators, and resolving intestinal microbiota dysbiosis. It has great research potential. A large amount of by-products are generated during rice processing in our country every year, such as broken rice, rice bran, and rice residues, and a large number of uric acid-lowering peptides exist in the protein hydrolysates of these by-products.

[0004] Related studies have obtained peptides with good uric acid-lowering ability by multi-stage separation technology or by screening uric acid-lowering peptides with a single receptor, but their methods are time-consuming and costly, and the obtained uric acid-lowering peptides are often limited to one type of action mechanism. Summary of the Invention

[0005] The purpose of the present invention is to provide a rice residue short peptide that can intervene in uric acid metabolism through multiple targets to achieve the effect of reducing uric acid.

[0006] Achieving the above purpose includes the following technical solutions.

[0007] The first aspect of the present invention provides a rice residue short peptide, and the amino acid sequence of the rice residue short peptide is any one of SEQ ID NO: 3, SEQ ID NO: 9, and SEQ ID NO: 10.

[0008] In some embodiments, the amino acid sequence of the rice residue short peptide is as shown in SEQ ID NO: 3.

[0009] In some embodiments, the amino acid sequence of the rice residue short peptide is as shown in SEQ ID NO: 10.

[0010] The second aspect of the present invention provides an application of the rice residue short peptide as described above in the preparation of a preparation for inhibiting uric acid production.

[0011] In some embodiments, the amino acid sequence of the rice residue short peptide is as shown in SEQ ID NO.10.

[0012] The third aspect of the present invention provides an application of the rice residue short peptide as described above in the preparation of a preparation for promoting uric acid excretion.

[0013] In some embodiments, the amino acid sequence of the rice residue short peptide is as shown in SEQ ID NO.3.

[0014] The fourth aspect of the present invention provides an application of the rice residue short peptide as described above in the preparation of a drug for reducing uric acid.

[0015] In some embodiments, the rice residue short peptide reduces uric acid levels by inhibiting uric acid production, regulating uric acid reabsorption and excretion, and enhancing the body's antioxidant level.

[0016] In some embodiments, the rice residue short peptide reduces uric acid levels by inhibiting the activity of XOD, regulating the expression of uric acid transporters GLUT9 and OAT1, binding to the Keap1 receptor, and inhibiting sodium urate crystallization.

[0017] The fifth aspect of the present invention provides a pharmaceutical composition, and the active ingredient of the pharmaceutical composition includes the rice residue short peptide as described above; wherein, the dosage form of the pharmaceutical composition can be tablets, capsules, powders, granules, pills, etc.

[0018] The sixth aspect of the present invention provides a preparation for inhibiting uric acid production or a preparation for promoting uric acid excretion, and the active ingredient of the preparation includes the rice residue short peptide as described above; wherein, the dosage form of the preparation can be tablets, capsules, powders, granules, pills, etc.

[0019] The seventh aspect of the present invention provides a nutritional preparation composition, and the active ingredient of the nutritional preparation composition includes the rice residue short peptide as described above.

[0020] Three rice residue short peptides with excellent uric acid-lowering effects were obtained in the present invention, and it was found that these three rice residue short peptides could simultaneously intervene in multiple links of uric acid metabolism at multiple targets, and had the characteristics of inhibiting uric acid production, promoting uric acid excretion and antioxidation (among them, the rice residue short peptide shown by SEQ ID NO.3 had excellent antioxidant activity and performance in promoting uric acid excretion, and the rice residue short peptide shown by SEQ ID NO.10 had excellent performance in inhibiting uric acid production), and could achieve excellent uric acid-lowering effects, providing a further theoretical basis for the in-depth development of rice processing by-products. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 are the XOD inhibition rates of the hydrolysates after GI under different solid-to-liquid ratios and the XOD inhibition rates of the three components after ultrafiltration of the hydrolysate with a solid-to-liquid ratio of 1:25; *: p < 0.05, significantly different from the control group; **: p < 0.01, extremely significantly different from the control group.

[0022] Figure 2 is the antioxidant activity analysis of the three components after ultrafiltration of the hydrolysate with a solid-to-liquid ratio of 1:25.

[0023] Figure 3 is the in vitro XOD inhibition rate of the positive control allopurinol and five pure peptides and the fitted IC 50 .

[0024] Figure 4 is the effect diagram of RPH, RPH(<3kDa) on the in vivo uric acid content in hyperuricemic zebrafish larvae induced by XSS+PO, #: p < 0.05, significantly different from the blank group, *: p < 0.05, significantly different from the control group.

[0025] Figure 5 is the effect diagram of five peptides with different concentrations on the in vivo uric acid content in hyperuricemic zebrafish larvae induced by XSS+PO and the comparison diagram of the uric acid-lowering intensity of five peptides in the same batch, #: p < 0.05, significantly different from the blank group, *: p < 0.05, significantly different from the control group.

[0026] Figure 6 is the uric acid content in the modeling solution of hyperuricemic zebrafish larvae induced by XSS+PO after 1d by five peptides, *: p < 0.05, significantly different from the control group.

[0027] Figure 7 is the effect diagram of three peptides on the expression level of the uric acid production gene HPRT1 homologous to humans in zebrafish; #: p < 0.05, significantly different from the blank group, *: p < 0.05, significantly different from the control group.

[0028] Figure 8 Effect diagrams of three peptides on the expression levels of uric acid excretion genes GLUT9 and OAT1 homologous to zebrafish and humans; #: p < 0.05, significantly different from the blank group, *: p < 0.05, significantly different from the control group.

[0029] Figure 9 Effect diagram of the scavenging rate of superoxide anion by five peptides.

[0030] Figure 10 Effect diagram of the scavenging of ROS in zebrafish by peptide No. 117; #: p < 0.05, significantly different from the blank group, *: p < 0.05, significantly different from the control group.

[0031] Figure 11 Effect diagram of the effect of peptide No. 117 on the enzyme activity of antioxidant enzymes in zebrafish; #: p < 0.05, significantly different from the blank group, *: p < 0.05, significantly different from the control group.

[0032] Figure 12 Effect diagram of the effect of peptide No. 56 on the enzyme activities of ADA and XOD in zebrafish; #: p < 0.05, significantly different from the blank group, *: p < 0.05, significantly different from the control group.

[0033] Figure 13 Effect diagram of the effect of rice residue short peptides on the contents of urea and creatinine in zebrafish larvae; #: p < 0.05, significantly different from the blank group, *: p < 0.05, significantly different from the control group.

[0034] Figure 14 Effect diagram of the inhibition of sodium urate crystallization by rice residue short peptides, including precipitation effect diagram and change diagram of uric acid content in the supernatant after 24 h.

[0035] Figure 15 Morphology diagram of sodium urate crystals after 24 h in the sodium urate crystal system after adding rice residue short peptides.

[0036] Figure 16 Infrared spectrum diagram of sodium urate crystals after 24 h in the sodium urate crystal system after adding rice residue short peptides.

[0037] Figure 17 Diagram of chemical parameters and amino acid sequences of three rice residue short peptides.

[0038] Figure 18 Molecular docking results of the three best peptide sequences for uric acid production, uric acid excretion, and antioxidant activity respectively. Specific implementation mode

[0039] For the convenience of understanding the present invention, the present invention will be described more comprehensively below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, these embodiments are provided to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0040] The experimental methods without specific conditions noted in the following examples are generally carried out according to conventional conditions or according to the conditions recommended by the manufacturer. All common chemical reagents used in the examples are commercially available products.

[0041] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the technical field to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not used to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0042] The English abbreviations in the following embodiments represent the meanings shown in Table 1.1 below.

[0043] Table 1.1 English Abbreviation Table

[0044]

[0045] Example 1 Preparation and Characterization of Rice Residue Protease Hydrolysate

[0046] Experimental Method

[0047] 1 Preparation and Enzymatic Hydrolysis of Rice Residue Protein

[0048] 1.1 Enzymatic Hydrolysis of Rice Residue Protein

[0049] Weigh 1 g of freeze-dried rice residue protein (crude protein content 88%, Zhejiang Hecheng Biotechnology Co., Ltd.) and disperse it in distilled water at ratios of 1:20, 1:25, and 1:30 (g / mL). Stir at 50 °C for 60 min to ensure full hydration of the protein. Adjust the pH of the sample solution to 3 with 1 mol / L hydrochloric acid. Then, add pepsin (1:3000) and incubate in a constant-temperature electromagnetic water bath at 37 °C for 2 h, maintaining a constant pH to simulate gastric digestion. Further, adjust the pH of the solution to 7 with 1 mol / mL sodium hydroxide, add trypsin (1:100), and incubate in a constant-temperature electromagnetic water bath at 37 °C for 2 h, maintaining a constant pH to simulate intestinal digestion. Place the sample in a boiling water bath for 10 min to stop digestion. Centrifuge the sample at 8000 g for 20 min, collect the supernatant, freeze-dry the solution, and store it at 4 °C for further analysis.

[0050] 1.2 Determination of Molecular Weight Distribution of Rice Residue Proteinase Hydrolysate

[0051] The relative molecular weight distribution of the obtained rice residue protease hydrolysate was determined using a gel chromatography column TSKgel G2000 SWXL (300 nm * 7.8 mm). A mixed solution of acetonitrile, water, and trifluoroacetic acid was used as the mobile phase, with a mixing ratio of 45:55:0.1. Sample detection conditions: injection volume 10 μL, flow rate 0.5 mL / min, detection wavelength 214 nm, running time 30 min, and sample protein concentration 4 mg / mL. Cytochrome C (12384 Da), aprotinin (6511.44 Da), bacitracin (1423 Da), oxidized glutathione (612.63 Da), Gly-GlyTyr-Arg (451 Da), and Gly-Gly-Gly (189 Da) were used as protein standards. The regression equation of the standard curve was obtained by calculation and then substituted for solution.

[0052] 1.3 Ultrafiltration separation components of rice residue protease hydrolysate

[0053] The enzymolyzed solution after GI or the dissolved solution of the freeze-dried powder was passed through the Guoxin nanofiltration tangential flow separation system, and ultrafiltration membranes with cut-off molecular weights of 5 kDa and 3 kDa were used to intercept and separate the components before and after, respectively. The components >5 kDa, 3 - 5 kDa, and <3 kDa were collected separately, freeze-dried, and stored at 4 °C for further analysis.

[0054] 1.4 Determination of XOD inhibitory activities of enzymolyzed products and ultrafiltration components under different conditions

[0055] Mix 50 μL of the sample with 50 μL of XOD (0.05 U / mL) and incubate at 25 °C for 5 min. Then add 150 μL of the substrate xanthine solution (0.48 mM), mix well, and incubate at 25 °C for 25 min. Measure the absorbance at 290 nm using an enzyme-linked immunosorbent assay reader. Preparation of PBS reagent: Dissolve 7.16 g of sodium dihydrogen phosphate and 3.12 g of disodium hydrogen phosphate in 100 mL of distilled water respectively. Take 81 mL of the sodium dihydrogen phosphate solution and 19 mL of the disodium hydrogen phosphate solution and mix them. Adjust the pH to 7.4 to obtain 0.2 mol / L PBS reagent. The blank in the system was made up with PBS.

[0056] Calculation formula:

[0057] XOD inhibition rate (%) = (1 - (A1 - A2) / (A3 - A4)) × 100%

[0058] Where: A1: Absorbance value of the sample + enzyme + substrate at 290 nm; A2: Absorbance value of the sample + substrate at 290 nm; A3: Absorbance value of the enzyme + substrate at 290 nm; A4: Absorbance value of the substrate at 290 nm.

[0059] 1.5 Determination of antioxidant activities of enzymolyzed products and ultrafiltration components under different conditions

[0060] The ABTS scavenging rate was detected by the national standard method. 200 mg of ABTS and 34.4 mg of potassium persulfate were dissolved in 50 mL of distilled water, and the mother liquor was obtained after 24 h in the dark at room temperature. When in use, it was diluted with 95% ethanol to an absorbance of 0.7 ± 0.02 (OD 734 ). 3.6 mL of the ABTS working solution was mixed with 0.4 mL of the sample, and the reaction was carried out in the dark at room temperature for 5 min.

[0061] Calculation formula:

[0062] ABTS scavenging rate (%) = (A b - A s ) / A b ) × 100%

[0063] Where: A b Absorbance value of distilled water plus ABTS at 734 nm; A s : Absorbance value of the sample plus ABTS at 734 nm.

[0064] The DPPH scavenging rate was detected by the national standard method. 5.0 mg of DPPH was weighed and made up to a volume of 100 ml with absolute ethanol to prepare a 50 μg / mL solution. 1 mL of the sample was mixed with 3 mL of the DPPH solution and incubated in the dark at room temperature for 30 min. The absorbance was measured at 517 nm, and the sample solvent was used to zero the instrument.

[0065] Calculation formula:

[0066] DPPH scavenging rate (%) = (1 - (A s - A c ) / A b ) × 100%

[0067] Where: A b Absorbance value of distilled water plus DPPH at 517 nm; A s : Absorbance value of the sample plus DPPH at 517 nm, A C : Absorbance value of the sample plus absolute ethanol at 517 nm.

[0068] The superoxide radical scavenging ability was determined by the reported method. Prepare the luminol buffer solution by mixing 0.1 mol / L luminol solution and 0.05 mol / L carbonate buffer solution with pH 10.2 in a ratio of 1:9. Then, the sample solution, 1.0 mol / L pyrogallol solution, and luminol buffer solution were added to the measuring tube in sequence. Finally, the luminescence intensity of the sample solution was measured using a BPCL ultra-weak luminescence measuring instrument. The blank sample was prepared in the same way as above, except that pure water was used instead of the sample solution. Mark and record the peak luminescence intensity, and the scavenging rate = (blank - sample) / blank.

[0069] 1.6 Result Analysis

[0070] 1.6.1 Analysis of XOD Inhibitory Activity of GI Hydrolysates with Different Solid-Liquid Ratios

[0071] The enzyme-linked immunosorbent assay (ELISA) is a simple and widely used method for measuring the XOD inhibition rate. Xanthine reacts with XOD to produce uric acid, and the enzyme activity of XOD can be inferred by measuring the content of uric acid. The XOD inhibition rates of GI hydrolysates under different solid-liquid ratios are as Figure 1 shown. It can be seen that the GI hydrolysate has the best XOD inhibitory effect at a solid-liquid ratio of 1:25, and the 1:25 condition was used for GI in the subsequent experiments.

[0072] 1.6.2 Analysis of Molecular Weight Distribution of Hydrolysates under Optimal Production Conditions

[0073] Table 1.2 Molecular Weight Distribution of Hydrolysates at a Solid-Liquid Ratio of 1:25

[0074] Relative molecular weight / Da Protein hydrolysate of rice residue <200 6.66±0.02％ 200-1000 44.45±1.24％ 1000-3000 31.29±0.63％ 3000-5000 9.19±0.18％ 5000-10000 6.67±0.46％ >10000 1.75±0.02％

[0075] The regression equation obtained by calculating with the standard is: y = -4.0816x + 29.1788 (R 2 = 0.9629). Among them, x is the logarithm of the molecular weight of the sample, and y is the retention time (min). Through this equation, the molecular weight distribution of the rice residue protease hydrolysate can be calculated. As can be seen from Table 1.2, the component with a molecular weight < 3 kDa accounts for more than 80% of the hydrolysate, the component with a molecular weight of 3 - 5 kDa accounts for 9.19 ± 0.18%, and the component with a molecular weight > 5 kDa accounts for less than 10%. From the perspective of production yield, the subsequent separation and purification are for the components of < 3 kDa, 3 - 5 kDa, and > 5 kDa.

[0076] 1.6.3 Analysis of the in Vitro Uric Acid-Lowering Activity of Different Components of Hydrolysates

[0077] As Figure 1 shown, the component with a molecular weight < 3 kDa has stronger XOD inhibitory activity than the components with molecular weights of 3 - 5 kDa and > 5 kDa at each concentration. Therefore, the component with a molecular weight < 3 kDa is more suitable for subsequent experiments.

[0078] When XOD is abnormally activated, a large amount of uric acid is generated while a large amount of ROS is also generated. The accumulation of ROS will cause oxidative stress in the body and even lead to apoptosis of cells, thus providing more endogenous uric acid production raw materials for the body and further promoting the accumulation of uric acid. Therefore, antioxidant activity can help patients with hyperuricemia control and reduce uric acid. DPPH, ABTS, and superoxide anion are common free radicals, and the antioxidant strength of the sample can be reflected by the scavenging activity of free radicals. As Figure 2As shown, the three components have good scavenging ability for the three free radicals, indicating that they all have the potential of antioxidant activity. Combining the results of in vitro inhibition of XOD, the fraction <3 kDa was finally selected for subsequent experiments.

[0079] Example 2 Identification and Simulated Screening of Protein Hydrolysates from Rice Residue

[0080] Experimental Methods

[0081] 2.1 Identification of Peptide Sequences by LC-MS / MS

[0082] After desalting treatment, the polypeptide sample was centrifuged and dried, then redissolved in 100 μL of Nano-LC mobile phase A (0.1% formic acid aqueous solution) and bottled for online LC-MS analysis. The sample was injected into a nanoViper C18 pre-column (3 μm particles, pore size) with a volume of 2 μL and rinsed with a volume of 20 μL for desalting. The liquid chromatography system was an Easy nLC1200 nano-scale liquid chromatography system (Thermo Fisher, USA). After desalting on the pre-column, the sample entered the analytical column for separation. The analytical column was a C18 reversed-phase chromatography column (Acclaim PepMap RSLC, 75 μm × 25 cm, C18, 2 μm, ). The gradient of mobile phase B (80% acetonitrile, 0.1% formic acid) gradually increased from 5% to 38% over 60 minutes.

[0083] The mass spectrometer was a ThermoFisher Q Exactive system (Thermo Fisher, USA), combined with a nano-spray ion source Nano Flex (Thermo Fisher, USA). The spray voltage was 1.9 kV, and the heating temperature of the ion transfer tube was set at 275 °C. The mass spectrometry was operated in data-dependent acquisition mode (DDA, Data Dependent Analysis). The resolution of the first-order mass spectrometry scan was set at 70000, the scan range was 100 - 1500 m / z, and the maximum injection time was 100 ms. In each DDA cycle, up to 20 precursor ion secondary mass spectra with charge states from 1+ to 3+ were collected. The maximum injection time of the secondary mass spectrometry was 50 ms, the collision energy of high-energy collision-induced dissociation (HCD) was set at 28 eV for all precursor ions, and the dynamic exclusion time was 6 seconds.

[0084] 2.2 Screening of Peptide Sequences by Bioinformatics

[0085] PiptideRanker (http: / / distilldeep.ucd.ie / PeptideRanker / ) is a website widely used to predict the activity potential of polypeptides. It gives scores based on the alignment of input peptide sequences to a database, with scores ranging from 0 to 1. The predicted activity is proportional to the score value.

[0086] 2.3 Molecular docking screening of uric acid-lowering rice residue short peptides

[0087] Uric acid-lowering rice residue short peptides were initially screened by forward molecular docking with XOD, and then the screened peptide sequences were reversely docked to uric acid excretion receptors and antioxidant receptors. Potential multi-target uric acid-lowering rice residue short peptides were screened based on the comprehensive docking results.

[0088] The crystal structure of XOD (PDB ID: 3NVZ) was obtained from the Protein Data Bank (PDB, https: / / www.rcsb.org / ). After dehydration and hydrogenation, the ligand was removed and converted into a pdbqt file. The structure diagram of the rice residue short peptide was drawn and modeled using KingDraw software, and then semi-flexible molecular docking was performed using Autodock Vina software. After obtaining the protein sequences of URAT1 and GLUT9 from the NCBI database, homology modeling was performed by matching the best templates through Swissmodel to obtain the 3D protein structure. The 3D structure of Keap1 (PDB ID: 2FLU) was obtained from the PDB database in the same way as XOD. The PDB file was processed by adding hydrogen atoms and removing water molecules, and semi-flexible molecular docking was also performed using Autodock Vina software. Nine optimal positions were obtained through docking, and the interaction binding energy of Vina was used as the standard to predict the best binding positions of polypeptides. The interaction schematic diagram between the ligand with the best binding energy and the receptor was drawn using ligplot and pymol.

[0089] 2.4 Bioinformatics prediction of the physicochemical properties of high-potential uric acid-lowering rice residue short peptides (hereinafter referred to as uric acid-lowering peptides)

[0090] ToxinPred (https: / / webs.iiitd.edu.in / raghava / toxinpred / ) can be used to predict properties such as polypeptide toxicity, molecular weight, isoelectric point, etc. AdmetSAR (http: / / lmmd.ecust.edu.cn / admetsar3 / ) can be used to predict polypeptide blood-brain penetration and gastrointestinal absorption.

[0091] 2.5 Result analysis

[0092] 2.5.1 Identification of peptide sequences in rice residue protease hydrolysates

[0093] According to the scoring of Peaks Studio software and the retrieval of the uniprot database, 2446 peptide sequences were identified from RPH, and all the obtained peptide sequences were homologous proteins or polypeptides of rice.

[0094] 2.5.2 Screening of potentially highly bioactive peptide sequences from rice bran protein

[0095] The 2446 peptide sequences were put into the PiptideRanker database for calculation and scoring. Peptide sequences with a Ranker value > 0.8 were regarded as potentially highly bioactive peptides. Finally, a total of 119 polypeptides had a Ranker value > 0.8. The peptide sequences were numbered from smallest to largest according to the scores, namely peptides No. 1 - 119.

[0096] Table 2.1 PeptideRanker Top8 Score Table

[0097] ID SEQ ID NO: Peptide Score ID SEQ ID NO: Peptide Score 119 1 GGPFVFF 0.983211 115 5 SPPLPFL 0.963825 118 2 FQPMFR 0.978011 114 6 SSLFF 0.961297 117 3 FFAFGR 0.977037 113 7 GWLLPPFA 0.959424 116 4 ALLPFF 0.977022 112 8 GWVGF 0.955818

[0098] 2.5.2 Results analysis of screening uric acid - lowering peptides by forward and reverse molecular docking

[0099] There were 119 high - potential bioactive peptides. First, 13 peptide sequences with a binding energy < - 7.5 Kcal / mol were screened through forward docking with XOD. Subsequently, the 13 peptide sequences were reversely docked with the uric acid excretion receptors URAT1 and GLUT9, and the antioxidant receptor Keap1. Finally, 9 high - potential multi - target uric acid - lowering peptides were screened out. The docking scores of all target molecules are shown in Table 2.2.

[0100] Table 2.2 Comprehensive Binding Energy Score Table of Molecular Docking

[0101]

[0102]

[0103] The table only shows the peptide sequences with a docking binding energy less than - 7.5 Kcal / mol for all receptors.

[0104] 2.6.3 Bioinformatics analysis results of the physicochemical properties of potential uric acid - lowering peptides

[0105] The basic physicochemical properties of 9 high - potential multi - target uric acid - lowering peptides were calculated through ToxinPred and admetSAR data as shown in Table 2.3, and all 9 peptides were predicted to be non - toxic.

[0106] Table 2.3 Prediction Table of Physicochemical Properties of High - Potential Uric Acid - Lowering Peptides

[0107]

[0108] In the table, H+ indicates gastrointestinal absorbability, and B- indicates non-penetration through the blood-brain barrier.

[0109] Example 3 Screening of the Multi-Target Uric Acid-Lowering Activity of Rice Residue Oligopeptides and Mechanism Study

[0110] 3.1 Materials

[0111] 103 synthetic peptide (DSDAGLFGGF), 56 synthetic peptide (FGHPEW), 117 synthetic peptide (FFAFGR), 79 synthetic peptide (FGAPY), 67 synthetic peptide (GVAHWF), 2 synthetic peptide (GSHPFYMDVR), 64 synthetic peptide (PAGVAHWF), 59 synthetic peptide (FNYANW), 36 synthetic peptide (FLPLYI), Sangon Biotech Co., Ltd.

[0112] 3.2 Experimental Methods

[0113] 3.2.1 In Vitro XOD Inhibitory Activity and Antioxidant Activity of Uric Acid-Lowering Peptides

[0114] Same as 1.4 - 1.5

[0115] 3.2.2 Zebrafish Cultivation

[0116] The fish used in the experiment were healthy wild-type AB strain zebrafish, purchased from Hubei Chuangxin Zebrafish Breeding Center. The feeding conditions were as follows: The zebrafish were placed in a circulating water culture system, and the water quality was purified by reverse osmosis. The pH value was maintained at 7.0 - 7.6, and the water temperature was kept at 27.5°C - 29°C. The light cycle was 14 hours of light and 10 hours of darkness, and brine shrimp were fed twice a day. Zebrafish embryos were incubated in a constant temperature incubator at 28.5°C. Fish pairing and egg collection: 1 hour after dinner, zebrafish were placed in a pairing tank at a male-female ratio of 1:1 and separated by a partition. The water volume in the tank was two-thirds of the tank. The partition was removed the next morning, and the fish eggs were collected 1 hour after the zebrafish laid eggs. The collected fish eggs were placed in a culture dish, and dead eggs and impurities were removed. After being rinsed several times with culture water, they were transferred to a constant temperature incubator at 28.5°C. The fish eggs were checked every day, and unfertilized eggs and dead eggs were removed and the culture water was changed. This experiment was carried out in accordance with the experimental animal care guidelines of Changsha University of Science and Technology and approved by the Ethics Committee.

[0117] 3.2.3 Method for Establishing a Hyperuricemic Zebrafish Model

[0118] Select 5-dpf larvae with normal development, randomly divide the selected fish into equal groups, set three parallel wells for each group, place them in a six-well plate respectively, with 40 larvae in each well, the volume of the solution in a single well is 4 mL, mark each culture dish with the group and treatment method, and incubate in an incubator at 28.5 °C for 24 h. The blank group uses zebrafish culture water; the model group is PO 200 μM + XSS 10 μM; the positive control group is the modeling solution plus APL 2 mM.

[0119] 3.2.4 Acute toxicity study of uric acid-lowering peptide

[0120] Set 7 concentration gradients for the hydrolysate, its components and each uric acid-lowering peptide, which are 1000, 500, 200, 100, 50, 20, 10 μg / mL respectively. Divide 5-dpf zebrafish larvae into 6 groups, set three parallels for each group (n = 50), administer different concentrations of hydrolysate and uric acid-lowering peptide solutions respectively, after incubating in a constant temperature incubator at 28.5 °C for 24 h, record the mortality of each group.

[0121] 3.2.5 Effect of uric acid-lowering peptide on uric acid content in zebrafish

[0122] Set the control group, model group and sample group respectively. After the modeling and drug administration are completed, add PBS and homogenize, take the tissue supernatant after centrifugation, and determine the uric acid content in zebrafish through Red Uric Acid / Uricase Assay Kit.

[0123] 3.2.6 Effect of uric acid-lowering peptide on uric acid excretion in zebrafish

[0124] Set the control group, model group and sample group respectively. After the modeling and drug administration are completed, collect the modeling solution to test the uric acid content. In addition, extract the total RNA of zebrafish in each group through an RNA rapid extraction kit, and detect the concentration and purity of the total RNA by a spectrophotometer and agarose electrophoresis. Take 2.0 μg of the total RNA of zebrafish samples, operate according to the instructions of the cDNA first-strand synthesis kit to synthesize 10.0 μL of cDNA, and detect the expression of β-actin, HPRT1, GLUT9 and OAT1 genes by q-PCR. Use β-actin as the internal reference for gene expression to calculate the relative RNA expression levels of HPRT1, OAT1 and GLUT9 genes. The primer sequence information is shown in Table 3.1.

[0125] Table 3.1 Primer sequence information table

[0126] Gene SEQ ID NO: Primer sequence 5'-3' β-actin Forward 17 TCGAGCAGGAGATGGGAACC β-actin Reverse 18 CTCGTGGATACCGCAAGATTC HPRT1 Forward 19 CACGCTAACAGGAAAGAACG HPRT1 Reverse 20 GGTGTCCTCTTCACCAGCAA OAT1 Forward 21 GGACGATATCCTGCCAGCTC OAT1 Reverse 22 CGTCCTGTAAGGCCAGATCC GLUT9 Forward 23 AGATCGAACGCAGCATCACA GLUT9 Reverse 24 GCGTCATATTTCGGTTCCAGC

[0127] 3.2.7 Chronic toxicity study of uric acid-lowering peptide

[0128] The acute toxicity of the uric acid-lowering peptide within 1 day is known, but the antioxidant model requires 4 days of modeling. Therefore, a 4-day chronic toxicity test was conducted on the uric acid-lowering peptide and the positive control. Four concentration gradients were set for both GSH and the 117-peptide, namely 100, 40, 20, and 10 μg / mL. The 3-day post-fertilization (3dpf) zebrafish larvae were divided into 2 groups, with 3 replicates in each group (n = 50). They were incubated with different concentration solutions in a constant temperature incubator at 28.5°C for 4 days, and the mortality of each group was recorded.

[0129] 3.2.8 Effect of the uric acid-lowering peptide on the antioxidant level of zebrafish

[0130] Modeling method for the oxidative stress zebrafish model: The larvae (3dpf, with normal development) were randomly divided into 6 groups: Control: blank control group, Model: H2O2 (300 μM), Positive control (positive control group): GSH (10 μg / mL) + H2O2 (300 μM), High concentration of 117-peptide: 117 (40 μg / mL) + H2O2 (300 μM), Medium concentration of 117-peptide: 117 (20 μg / mL) + H2O2 (300 μM), Low concentration of 117-peptide: 117 (10 μg / mL) + H2O2 (300 μM), and they were treated for 4 days.

[0131] The control group, model group, and sample group were set up respectively, and the corresponding modeling solutions were added. After culturing for 4 days, the activities of antioxidant enzymes CAT, SOD, and GSH-px in the zebrafish larvae were measured using the Solarbio enzyme activity detection kit. The ROS level in the larvae was tested using the ROS detection kit from Nanjing Jiancheng. After washing the larvae 3 times with hatching water, 1 mL of 10 μmol / L DCFH-DA detection solution was added, and they were incubated at 28.5°C for 30 min. After washing 3 times with hatching water, they were observed using a Zeiss stereomicroscope.

[0132] 3.2.9 Effect of the uric acid-lowering peptide on the renal function level of zebrafish

[0133] The control group, model group, and sample group were set up respectively, and the corresponding modeling solutions were added. After culturing for 1 day, the contents of creatinine and urea nitrogen in the zebrafish larvae were measured using the kits from Nanjing Jiancheng and the urea nitrogen kit.

[0134] 3.2.10 Effect of the uric acid-lowering peptide on the activities of ADA and XOD in zebrafish

[0135] The control group, model group, and sample group were set up respectively, and the corresponding modeling solutions were added. After culturing for 1 day, the activities of ADA and XOD in the zebrafish larvae were measured using the ADA and XOD kits from Nanjing Jiancheng.

[0136] 3.2.11 Effect of the uric acid-lowering peptide on uric acid crystallization

[0137] First, solutions A and B were prepared in a 37 °C water bath. 7.5 mL of solution A consisted of 11.73 mM uric acid dissolved in 15 mM NaOH, and 2.5 mL of aqueous solution B consisted of 660 mM NaCl. The pH values of these solutions were adjusted to 7.4 using 1 M HCl or 1 M NaOH. After mixing solutions A and B, MSUM crystals could crystallize at 37 °C. To study the effect of uric acid-lowering peptides on sodium urate crystallization, a 100 μg / mL uric acid-lowering peptide solution was used. For the sodium urate system in the early reaction stage, the urate concentration in the supernatant was measured using a UV spectrophotometer. For the sodium urate system after 24 hours of crystallization, after centrifugation at 10,000 rpm for 5 minutes, it was washed three times with pure water, and the sodium urate precipitate was collected. Then the crystals were dried in a vacuum oven at 37 °C for 24 hours. The dried crystals were directly observed for morphology, and after being crushed, MSUM powder was obtained for infrared characterization.

[0138] 3.2.12 Molecular Structure and Molecular Simulation of Multi-Target Uric Acid-Lowering Peptides to Explain Their Uric Acid-Lowering Mechanisms

[0139] The molecular structure of the uric acid-lowering peptide was drawn by KingDraw, and the analysis of the molecular docking results was the same as that obtained by the previous Autodock Vina screening.

[0140] 3.3 Results and Discussion

[0141] 3.3.1 In Vitro XOD Inhibitory Activity and Antioxidant Activity of Uric Acid-Lowering Peptides

[0142] As Figure 3 shown, among the 9 high-potential multi-target uric acid-lowering peptides screened by molecular docking, a total of 5 peptides had an in vitro IC50 for XOD < 2000 μg / mL. The top three peptide sequences in terms of in vitro XOD inhibitory activity were 103 > 56 > 117, and the specific data are shown in Table 3.2. These five uric acid-lowering peptides consisted of 5 - 10 amino acids and had a molecular weight between 500 - 1000. Therefore, peptide sequences with a small molecular weight may be more beneficial for lowering uric acid.

[0143] Table 3.2 List of IC50 of Uric Acid-Lowering Peptides against Xanthine Oxidase

[0144] Name Fitted best IC50 (μg / mL) IC50 range (μg / mL) APL 133.8 124.0-143.5 56 476.3 451.6-502.4 67 1053.0 958.5-1156 79 705.8 664.2-750.1 103 200.5 186.7-214.3 117 673.8 631.3-719.3

[0145] Superoxide anion is an important by-product in the process of uric acid production and is also the main cause of subsequent oxidative stress. The antioxidant activity of 5 XOD inhibitory peptides was reflected by detecting their superoxide anion radical scavenging activity. As Figure 9 shown, except for peptide No. 79, 4 out of the 5 XOD inhibitory peptides had certain superoxide anion scavenging activity. Therefore, these 4 peptides may have a multi-target effect on lowering uric acid. Peptide No. 117 had the highest radical scavenging activity. Therefore, peptide No. 117 was selected for subsequent antioxidant research.

[0146] 3.3.2 Toxicity Analysis of Uric Acid-Lowering Peptides

[0147] As shown in Table 3.3, the experimental results indicate that the concentration-dose groups selected for the <3 kDa hydrolysate are 500, 200, and 100 μg / mL, the concentration-dose groups selected for the whole-component hydrolysate are 200, 100, and 50 μg / mL, the concentration-dose groups selected for Peptides 56, 67, and 117 are 100, 50, and 20 μg / mL, and the concentration-dose groups selected for Peptides 79 and 103 are 50, 20, and 10 μg / mL. At these concentrations, the corresponding samples have no toxic effects.

[0148] Table 3.3 Acute Toxicity of Hydrolysates and Uric Acid-Lowering Peptides to 5-dpf Zebrafish for 1 Day

[0149]

[0150] As shown in Table 3.4, the experimental results indicate that the concentration-dose groups selected for Peptide 117 are 40, 20, and 10 μg / mL, and the concentration-dose group selected for GSH is 10 μg / mL.

[0151] Table 3.4 Chronic Toxicity of GSH and Peptide 117 to 3-dpf Zebrafish for 4 Days

[0152]

[0153] 3.3.3 Analysis of the Effect of Uric Acid-Lowering Peptides in Vivo

[0154] From Figure 4 and Figure 5 it can be seen that the uric acid production increased after PO and XSS treatment in the model group; compared with the model group, after treatment with the hydrolysate and its separated components, and Peptides 56, 67, 79, 103, and 117, the uric acid content in zebrafish decreased significantly, and except for Peptide 67, the other four peptides showed concentration dependence in the corresponding administration concentration-dose groups. Subsequently, the optimal uric acid-lowering concentrations of the five peptides were compared in the same group experiment, and it was found that the peptide sequence with the strongest uric acid-lowering effect in vivo was Peptide 56, and the maximum administration concentrations of Peptides 56 and 117 were 100 μg / mL, indicating their higher biocompatibility.

[0155] Low expression of HPRT1 can lead to excessive purines being broken down into uric acid and excreted from cells, which is one of the reasons for the increase in blood uric acid concentration. qRT-PCR is a commonly used method for quantitatively detecting the mRNA expression level. From Figure 7 it can be seen that the expression level of the HPRT1 gene decreased significantly after PO and XSS treatment in the model group; compared with the model group, after treatment with the optimal concentrations of Peptides 56, 103, and 117, the expression level of the HPRT1 gene increased significantly.

[0156] 3.3.4 Analysis of the uric acid excretion-promoting ability of the uric acid-lowering peptides

[0157] As Figure 6 shown, the test results indicate that peptides No. 56, 103, and 117 can significantly promote uric acid excretion in hyperuricemic zebrafish. Based on this, the peptide sequences that simultaneously possess the activities of reducing uric acid production, promoting uric acid excretion, and antioxidation are determined to be peptides No. 56, 103, and 117, that is, peptides No. 56, 103, and 117 are preliminarily considered as multi-target uric acid-lowering peptides.

[0158] GLUT9 is a transporter involved in the reabsorption of urate in the renal tubules, which can reabsorb urate from the renal tubular cell membrane back into the blood; while OAT1, as a transporter for uric acid excretion, functions to absorb uric acid from the blood into renal tubular cells. As Figure 8 shown, the test results indicate that after treatment with PO and XSS in the model group, the expression level of the OAT1 gene significantly decreases, while the expression level of the GLUT9 gene significantly increases; compared with the model group, after treatment with peptides No. 56, 103, and 117, the expression level of GLUT9 can be significantly reduced, while after treatment with peptides No. 56 and 117, the expression level of OAT1 can be increased. Therefore, all three peptides can reduce the uric acid content in the zebrafish body by promoting uric acid excretion. Combining all the previous results, it can be obtained that peptide No. 56 has the strongest inhibitory effect on uric acid production, and peptide No. 117 has the strongest antioxidation and uric acid excretion-promoting effects. Subsequently, in-depth studies on these two peptides will be carried out separately.

[0159] 3.3.5 Effects of the uric acid-lowering peptides on the antioxidation activity in zebrafish

[0160] DCFH-DA itself has no fluorescence and can freely cross the cell membrane. When it enters the cell, it will be hydrolyzed by the relevant esterases in the cell into DCFH (Dichlorofluorescin). DCFH cannot permeate the cell membrane, so the probe can be easily labeled inside the cell. When there are reactive oxygen species in the cell, DCFH is oxidized into a strong green fluorescent substance.

[0161] As Figure 10 shown, after treatment with H2O2, the production of ROS increases; compared with the H2O2 group, after treatment with peptide No. 117 and GSH, the production of ROS decreases; compared with GSH, peptide No. 117 significantly inhibits the secretion of ROS. As Figure 11 shown, after treatment with H2O2, the antioxidase activity decreases; compared with the H2O2 group, after treatment with peptide No. 117, the activities of the three enzymes are significantly restored, indicating that peptide No. 117 at a high concentration group can increase the antioxidase activity of the body.

[0162] 3.3.6 Effects of the uric acid-lowering peptides on the uric acid-lowering enzyme activity in zebrafish

[0163] As Figure 12It can be seen that after the PO and XSS treatments in the model group, the activities of ADA and XOD enzymes were significantly increased; compared with the model group, the 56th peptide at 20-100 μg / mL could reduce the enzyme activities, but only the 56th peptide at 100 μg / mL could significantly reduce the ADA enzyme activity, and the 56th peptide at 50-100 μg / mL could significantly reduce the XOD enzyme activity.

[0164] 3.3.7 Effect of uric acid-lowering peptides on renal function in zebrafish

[0165] Creatinine and blood urea nitrogen (Cr, BUN) are usually important indicators for measuring the health of renal tissue. Cr is a metabolite of creatine and phosphocreatine, and it can indirectly reflect the filtration function of glomeruli. BUN is the main product of protein metabolism, and this level is affected by protein intake, metabolic level, and liver function.

[0166] It can be seen from Figure 13 that after the PO and XSS treatments in the model group, the contents of Cr and BUN in the zebrafish tissue fluid increased; compared with the model group, after the treatments with the 56th, 103rd, and 117th peptides, the contents of Cr and BUN decreased; all three peptides extremely significantly reduced the Cr content in the tissue fluid of juvenile fish; compared with the 56th and 103rd peptides, the 117th peptide could also significantly reduce the BUN content. Therefore, all three multi-target uric acid-lowering peptides can improve the renal function damage caused by uric acid accumulation.

[0167] 3.3.8 Effect of uric acid-lowering peptides on the uric acid crystallization process

[0168] When uric acid accumulates in the human body to a certain extent, needle-shaped sodium urate monohydrate crystals will be formed. The deposition of these crystals in joints and tissue fluid will cause gouty arthritis, deposition in the kidneys will cause uric acid nephritis and stones, and deposition in blood vessels will cause atherosclerosis, increasing the risks of hypertension, heart disease, and stroke. Therefore, directly inhibiting the growth of pathological uric acid crystals also has important clinical significance.

[0169] It can be seen from Figure 14 that in the blank group, white precipitates began to precipitate at 2 h, that is, its nucleation induction time. Compared with the blank group, after the addition of the 56th and 103rd peptides, the nucleation induction time was delayed to 4 h, while after the addition of the 117th peptide, the nucleation induction time was extended to 6 h; at 12 h, except for the group with the addition of the 117th peptide, the urate content in the supernatant had completed nucleation and reached the lowest level, and at 24 h, the urate in the supernatant of all groups had completed precipitation and nucleation.

[0170] It can be seen from Figure 15 the microscopic morphology differences of the dried crystals separated after 24 h that, at the same scale, the crystals generated in the blank group were significantly more slender, and the growth of sodium urate crystals is a process from short to long, which indicates that the addition of peptides inhibited the growth of crystals. Combining Figure 16The infrared data showed that the addition of the peptide slowed down the crystal growth without changing the crystal's structural composition.

[0171] Therefore, Peptide 117 was the most effective in significantly inhibiting the rate of uric acid crystal formation and had great potential for inhibiting MSUM formation.

[0172] 3.3.9 Analysis of Molecular Simulation Results of Multi-Target Uric Acid-Lowering Peptides and Multiple Receptors

[0173] As shown in Table 3.5 and Figure 17 it can be seen that the multi-target uric acid-lowering peptides mainly bind to each key target through hydrogen bonds and hydrophobic interactions. Combining all the previous data, Peptide 56 has the strongest XOD inhibitory activity, and Peptide 117 has the strongest uric acid excretion-promoting and antioxidant activities. Therefore, residues such as Asn650, Gln1122, and Asp1115 in the table may be important active sites of XOD, residues such as Ala368, Gly202, and Phe451 may be important active sites of GLUT9, and residues such as Asp389 and Ser431 may be important active sites of Keap1. Figure 18 It is a molecular docking example diagram between each target and the uric acid-lowering peptide with the highest activity after verification.

[0174] Table 3.5 Interaction Forces between Multi-Target Uric Acid-Lowering Peptides and Receptor Molecular Docking

[0175]

[0176] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as within the scope described in this specification.

[0177] The above-described embodiments only represent several implementation manners of the present invention. Their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims.

Claims

1. A rice residue short peptide, characterized in that, The amino acid sequence of the rice residue oligopeptide is any one of SEQ ID NO: 3, SEQ ID NO: 9, and SEQ ID NO:

10.

2. The rice residue short peptide according to claim 1, wherein, The amino acid sequence of the rice residue oligopeptide is as shown in SEQ ID NO:

3.

3. The rice residue short peptide according to claim 1, wherein The amino acid sequence of the rice residue oligopeptide is as shown in SEQ ID NO:

10.

4. Use of the rice residue oligopeptide according to any one of claims 1-3 in the preparation of a preparation for inhibiting uric acid production.

5. According to the use described in claim 4, the amino acid sequence of the rice residue oligopeptide is as shown in SEQ ID NO:

10.

6. Use of the rice residue oligopeptide according to any one of claims 1-3 in the preparation of a preparation for promoting uric acid excretion.

7. According to the use described in claim 6, the amino acid sequence of the rice residue oligopeptide is as shown in SEQ ID NO:

3.

8. Use of the rice residue oligopeptide according to any one of claims 1-3 in the preparation of a drug for reducing uric acid.

9. A pharmaceutical composition, characterized in that, The active ingredient of the pharmaceutical composition comprises the rice residue oligopeptide according to any one of claims 1-3.

10. A preparation for inhibiting uric acid production or promoting uric acid excretion, characterized in that, The active ingredient of the preparation comprises the rice residue oligopeptide according to any one of claims 1-3.

Images