Chrysosporium merdarium nccg-2 and application thereof

Abstract

The application discloses a Chaetomium globosum NCCG-2 and application thereof, and belongs to the technical field of microorganisms. The Chaetomium globosum NCCG-2 is preserved in the China General Microbiological Culture Collection Center, and has a preservation number of CGMCC: 40316. The Chaetomium globosum NCCG-2 and fermentation liquor thereof can inhibit a plurality of crop pathogenic bacteria. Compared with the reported Chaetomium globosum strains, the Chaetomium globosum NCCG-2 provided by the application is a rice endophyte, has a host adaptability advantage, and simultaneously has three functions of broad-spectrum bacteriostasis, soil microecological regulation and crop growth promotion, breaks through the single crop targeting limitation, and shows application potential in rice, oil crops and economic crops, and provides a multifunctional germplasm resource for developing biological pesticides and microbial fertilizers.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial technology, in particular to a Chaetomium globosum NCCG-2 and application thereof. BACKGROUND

[0002] Plant diseases seriously threaten the growth of crops and food safety. Traditional chemical pesticides have been used as the main means to combat plant diseases, effectively controlling the spread of diseases in the short term, but their long-term overuse has caused a series of problems - pathogenic bacteria produce resistant populations through genetic mutation; pesticide residues accumulate in the food chain, and pesticide components are detected in surface water, soil and even polar organisms; pollination insects, soil microorganisms and other non-target organisms in the farmland ecosystem are greatly reduced, and the ecological balance is destroyed. These difficulties force the agricultural field to urgently seek more sustainable disease control solutions.

[0003] Under this background, the concept of using microorganisms for biological control has gradually become the focus of research. Biocontrol microorganisms are considered an ideal choice to replace chemical pesticides due to their strong specificity, environmental friendliness, and difficulty in inducing resistance. Chaetomium globosum, as a representative group among them, can secrete chitinase, beta-1, 3-glucanase and other antibacterial substances to inhibit the growth of pathogenic bacteria, and at the same time, can promote crop growth by producing plant hormones or improving the root microenvironment, showing dual application value in biological control and plant growth promotion. In recent years, many strains of C. globosum have been isolated from soil, plant rhizosphere and other habitats, and their biocontrol effects have been verified in the control of diseases in crops such as cucumber and tomato, providing a new technical path for green agricultural production.

[0004] However, the currently developed C. globosum strains still have obvious defects in practical application. Most strains only have inhibitory effect on a single or a few pathogenic bacteria, and often cannot achieve the expected effect in the face of complex disease complex infection in the field; some strains grow poorly under extreme temperature, high salt or low nutrition and other abiotic stress conditions, making it difficult to stably colonize in different regions or in farmland with serious continuous cropping obstacles; in addition, the yield and activity of the metabolic products of the strains are easily affected by environmental factors, resulting in large fluctuations in field control effect. These problems of single function and insufficient environmental adaptability greatly restrict the large-scale application of C. globosum in agricultural production, and it is urgent to develop biocontrol germplasm resources with broad-spectrum disease resistance and strong environmental adaptability through high-quality strain screening and function optimization. SUMMARY

[0005] The application aims to provide a strain of Chaetomium globosum NCCG-2 and an application thereof, so as to solve the problems in the prior art. The Chaetomium globosum NCCG-2 provided by the application is a rice endophyte, has host adaptability advantages, has three functions of broad-spectrum bacteriostasis, soil micro-ecological regulation and crop growth promotion, breaks through the single crop targeting restriction, and has application potential in rice, oil and economic crops, and provides a multifunctional germplasm resource for the development of biological pesticides and microbial fertilizers.

[0006] To achieve the above-mentioned purpose, the application provides the following solutions.

[0007] The application provides a strain of Chaetomium globosum NCCG-2, which is preserved in the China General Microbiological Culture Collection Center, and the preservation number is CGMCC: 40316.

[0008] The application also provides a microbial agent, which comprises the Chaetomium globosum NCCG-2 and / or a fermentation product thereof.

[0009] The application also provides an application of the Chaetomium globosum NCCG-2 or the microbial agent in inhibiting crop pathogenic bacteria, and the crop pathogenic bacteria comprise Colletotrichum gloeosporioides, Fusarium oxysporum, Pythium ultimum, Macrophomina phaseoli Ashby, Phomopsis asparagi (Sacc.) Bubak, Pyricularia grisea (Cooke) Sacc., Verticillium dahliae, Phytophthora capsici, Fusarium fujikuroi, Sclerotium rolfsii Sacc., Sclerotium rolfsii, Macrophomina phaseolina, Fusarium solani (Mart.) Sacc. and Fusarium graminearum.

[0010] Optionally, the Chaetomium globosum NCCG-2 can inhibit Colletotrichum gloeosporioides, Fusarium oxysporum, Aspergillus nomius, Phomopsis sojae, Sclerotinia sclerotiorum, Verticillium dahliae, Phytophthora capsici, Fusarium fujikuroi, Sclerotium rolfsii, Rhizoctonia solani, Fusarium solani and Fusarium graminearum.

[0011] Optionally, the spore-producing culture medium of the Chaetomium globosum NCCG-2 comprises rice straw, rice bran and corn powder, and the mass ratio of the rice straw, the rice bran and the corn powder is 5:2.5:2.5.

[0012] Optionally, the fermentation liquor of the Chaetomium globosum NCCG-2 can inhibit Colletotrichum gloeosporioides, Fusarium oxysporum, Pythium ultimum, Aspergillus nomius, Phomopsis sojae, Sclerotinia sclerotiorum, Verticillium dahliae, Phytophthora capsici, Fusarium fujikuroi, Sclerotium rolfsii, Rhizoctonia solani, Fusarium solani and Fusarium graminearum, and the Sclerotium rolfsii is Sclerotium rolfsii.

[0013] The application further provides application of the Chaetomium globosum NCCG-2 or the microbial agent in prevention and treatment of crop diseases, and the crop diseases include citrus anthracnose, peanut root rot, sesame stem blight, asparagus stem blight, rice blast, cotton verticillium wilt, pepper phytophthora disease, rice sheath blight, pepper white rot, sesame root rot, rice sheath blight, peanut root rot and rice damping-off.

[0014] The application further provides application of the Chaetomium globosum NCCG-2 or the microbial agent in promoting growth of rice, and the promoting growth of rice includes increasing seedling height of rice, increasing root number of rice and promoting main root thickening.

[0015] The application further provides application of the Chaetomium globosum NCCG-2 or the microbial agent in prevention and treatment of peanut brown spot, peanut black spot and peanut leaf spot.

[0016] The application further provides application of the Chaetomium globosum NCCG-2 or the microbial agent in prevention and treatment of chrysanthemum root rot and stem rot.

[0017] The application discloses the following technical effects:

[0018] The Chaetomium globosum NCCG-2 provided by the application not only shows significant inhibitory activity (the prevention effect is more than 80%) on Pyricularia grisea (Cooke) Sacc., but also breaks through the limitation of the existing function of Chaetomium globosum. Experiments show that the strain has a broad-spectrum inhibitory effect on 15 important crop pathogenic fungi, including Colletotrichum gloeosporioides, Phomopsis asparagi (Sacc.) Bubak, Botrytis cinerea, Fusarium fujikuroi and Verticillium dahliae, and the inhibitory spectrum covers multiple groups such as ascomycetes, basidiomycetes and deuteromycetes. Further research shows that the Chaetomium globosum NCCG-2 can directionally regulate the soil microbial community structure, significantly inhibit soil-borne pathogens such as Fusarium spp., and at the same time promote the proliferation of beneficial microorganisms to form a disease-inhibiting micro-ecology. In addition, the strain can significantly increase the biomass of rice seedlings and achieve the effect of strengthening roots, realizing the synergistic effect of disease prevention and growth promotion. In field experiments, the prevention effects of the strain on peanut brown spot, black spot and leaf spot are 83.62%, 81.72% and 89.63% respectively, and the prevention effects on chrysanthemum root rot and stem base rot are both more than 70%, showing the characteristics of cross-crop and multi-target application.

[0019] Compared with the reported Chaetomium globosum strains, the Chaetomium globosum NCCG-2 provided by the application is a rice endophyte, has the advantage of host adaptability, and has the functions of broad-spectrum inhibition, soil micro-ecological regulation and crop growth promotion, breaking through the limitation of single crop targeting, and showing application potential in rice, oil and economic crops, and providing a multifunctional germplasm resource for the development of biological pesticides and microbial fertilizers. BRIEF DESCRIPTION OF DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0021] Figure 1 It is a colony morphology (A) and spore morphology (B) diagram of Chaetomium globosum NCCG-2;

[0022] Figure 2 It is an ITS molecular identification phylogenetic tree diagram of Chaetomium globosum NCCG-2;

[0023] Figure 3 Figure is a chart of the confrontation culture results of Chaetomium globosum NCCG-2 on 15 kinds of crop pathogenic fungi;

[0024] Figure 4 Figure is a chart of the bacteriostatic effect of Chaetomium globosum NCCG-2 fermentation liquor on 15 kinds of crop pathogenic fungi;

[0025] Figure 5 Figure is a chart of the growth-promoting effect of Chaetomium globosum NCCG-2 on rice seedlings, wherein A is a chart of the effect of Chaetomium globosum NCCG-2 on seedling height, and B is a chart of the effect of Chaetomium globosum NCCG-2 on seedling roots;

[0026] Figure 6 Figure is a chart of the control effect of Chaetomium globosum NCCG-2 live bacteria soil drenching on rice blast;

[0027] Figure 7 Figure is a chart of the control effect of Chaetomium globosum NCCG-2 fermentation liquor spraying on rice blast;

[0028] Figure 8 Figure is a chart of the inhibitory regulation effect of Chaetomium globosum NCCG-2 on soil harmful microorganisms;

[0029] Figure 9 Figure is a chart of the field control effect of Chaetomium globosum NCCG-2 on main diseases of peanut leaves;

[0030] Figure 10 Figure is a chart of the field control effect of Chaetomium globosum NCCG-2 on root rot and stem rot of Wuyuan imperial chrysanthemum. DETAILED DESCRIPTION

[0031] A number of exemplary embodiments of the present application are described in detail below, which should not be considered limiting on the present application, but rather as a description of certain aspects, features, and embodiments of the present application.

[0032] It should be understood that the terms used in the present application merely describe particular embodiments, and are not intended to limit the present application. In addition, for numerical ranges in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is specifically disclosed. Each intermediate value within any stated value or stated range, and any other stated value or intermediate value within the stated range, is also included within the present application. The upper limit and the lower limit of these smaller ranges can be included or excluded independently.

[0033] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as those commonly understood by one of ordinary skill in the art to which this application pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All documents mentioned herein are incorporated by reference to disclose and describe in full the methods and / or materials useful in connection to the documents. In case of conflict between the content of the specification and that of any document incorporated herein by reference, the content of the specification prevails.

[0034] Many modifications and variations of the present application described in the specification are possible without departing from the scope or spirit of the application. Other implementations of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples are illustrative only.

[0035] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having" and the like are open-ended terms that are intended to permit but not limit the inclusion of elements or the number of elements, as well as the possibility that one or more elements can be incorporated into the composition, method, or the like, as well as the possibility that one or more elements can be replaced by other elements.

[0036] Example 1 Isolation and identification of Chaetomium globosum NCCG-2

[0037] 1. Isolation of Chaetomium globosum NCCG-2

[0038] The tissue isolation method was used. The panicle neck joint segments of the disease-resistant rice variety "Tetep" at the early breaking stage were collected in the field, rinsed with clean water for 2-3 times, and dried. The panicle neck joint segments were cut into 1-2 cm long panicle segments with sterile surgical scissors on a sterile operation table, surface sterilized with 0.1% mercury solution for 45 seconds, then sterilized with 75% alcohol for 90 seconds, transferred to sterile water for rinsing 3 times, placed on sterilized filter paper to absorb water and dry, and then picked up with tweezers and placed on PDA medium for constant temperature culture at 28°C for 3-4 days. When the mycelium grew on the edge of the cut panicle segments, the edge mycelium was picked and transferred to new PDA medium for purification culture, and finally a strain of endophytic fungus was obtained, which was recorded as strain NCCG-2.

[0039] 2. Morphological identification of Chaetomium globosum NCCG-2

[0040] Strain NCCG-2 was inoculated on PDA plates and cultured at 28°C for 5 days, and the colony morphology and color were observed. The spores of strain NCCG-2 in the culture dish were washed with water, filtered with three layers of gauze to obtain a spore suspension, and the color, morphology and size of the spores were observed under a 10x40 optical microscope.

[0041] The culture results of strain NCCG-2 showed that the mycelium on PDA was initially white, and later turned light brown Figure 1A). Light microscopic observation showed that the perithecia were grayish-brown to olive-brown, medium-sized, scattered or aggregated, ovoid; attached to the substrate by many dark olive-brown rhizoids; ascospores lemon-shaped, dark brown to olive-brown Figure 1 B).

[0042] 3. Molecular identification of Chaetomium globosum NCCG-2

[0043] The strain of endophytic fungus NCCG-2 isolated from the panicle neck of rice was amplified with ITS1 (TCCGTAGGTGAACCTGCGG, SEQ ID NO. 1) and ITS4 (TCCTCCGCTTATTGATATGC, SEQ ID NO. 2) as primers, and the amplified product was sequenced, and the sequencing result is shown in SEQ ID NO. 3:

[0044] SEQ ID NO. 3:

[0045] CATTACAGAGTTGCAAAACTCCCTAAACCATTGTGAACGTTACCTATACCGTTGCTTCGGCGGGCGGCCCCGGGGTTTACCCCCCGGGCGCCCCTGGGCCCCACCGCGGGCGCCCGCCGGAGGTCACCAAACTCTTGATAATTTATGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCCGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAAAGCAGTGGCGGGCTCGCTGTCGCACCGAGCGTAGTAGCATACATCTCGCTCTGGTCGCGCCGCGGGTTCCGGCCGTTAAACCACCTTTTAACCCAAGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATA.

[0046] Through blast search, sequence alignment, ML algorithm was used by Mega7.0 software, and bootstrap 500 times tree was built to establish the phylogenetic tree, as shown inFigure 2 The strain was identified as Chaetomium, and was presumed to be Chaetomium globosum.

[0047] Therefore, the isolated strain screened is named Chaetomium globosum NCCG-2, and is preserved in the China General Microbiological Culture Collection Center (CGMCC, located at No. 1, Xibahe Yard, Beijing Chaoyang District, China Institute of Microbiology, Chinese Academy of Sciences), with a preservation number of CGMCC: 40316 and a preservation date of September 16, 2022.

[0048] Example 2 Determination of the antibacterial effect of Chaetomium globosum NCCG-2

[0049] 1. Determination of Chaetomium globosum NCCG-2 on 15 kinds of crop pathogenic fungi by confrontation culture

[0050] The chrysosporium NCCG-2 which is cultured on PDA medium flat plate is made into a 5mm diameter bacterial dish with a puncher, and is transferred to a new PDA plate 2cm away from the dish edge. The same method is used to transfer the 15 kinds of pathogenic fungi which have been cultured to the PDA medium plate inoculated with chrysosporium NCCG-2, and the two kinds of fungi are kept on the same horizontal line with the same distance from the dish edge. The plate with only pathogenic fungi is set as a control. Among them, the 15 kinds of pathogenic fungi include: citrus anthracnose fungus (Colletotrichum gloeosporioides), peanut root rot fungus (Fusarium oxysporum), Pythium ultimum, sesame stem spot disease fungus (Macrophomina phaseoli Ashby), asparagus stem rot fungus (Phomopsis asparagi (Sacc.) Bubak), rice blast fungus (Pyricularia grisea (Cooke) Sacc.), cotton verticillium wilt fungus (Verticillium dahliae), pepper phytophthora blight fungus (Phytophthora capsici), rice bakanae fungus (Fusarium fujikuroi), pepper white rot fungus (Sclerotium rolfsii Sacc.), sesame root rot fungus (Macrophomina phaseolina), rice sheath blight fungus (Thanatephorus cucumeris), peanut root rot fungus (Fusarium solani (Mart.) Sacc.) and rice damping-off fungus (Fusarium graminearum).

[0051] The inoculated plate is transferred to a constant temperature incubator at 28℃ for constant temperature culture for 5 days, and the colony diameter of the pathogenic fungus is measured by cross-intersection method, and the inhibition rate of chrysosporium NCCG-2 to the pathogenic fungus is calculated.

[0052] After 5 days of culture, the confrontation culture results of chrysosporium NCCG-2 to 15 kinds of crop pathogenic fungi are shown in Table 1. Figure 3 After measuring the colony diameter of the pathogenic fungus by cross-intersection method, the inhibition rate of chrysosporium NCCG-2 to the pathogenic fungus is calculated and shown in Table 1.

[0053] Table 1 Inhibition effect of chrysosporium NCCG-2 on main crop pathogenic fungi

[0054]

[0055] The results show that the Chaetomium globosum NCCG-2 has inhibitory effect on 14 kinds of pathogenic fungi except Pythium ultimum, and the inhibition rate is between 4.17% and 86.48%, among which the inhibition rate of 11 kinds of pathogenic fungi such as Colletotrichum gloeosporioides, Fusarium oxysporum, Macrophomina phaseoli Ashby, Phomopsis asparagi (Sacc.) Bubak, Pyricularia grisea (Cooke) Sacc., Phytophthora capsici, Fusarium fujikuroi, Macrophomina phaseolina, Thanatephorus cucumeris, Fusarium solani (Mart.) Sacc. and Fusarium graminearum is more than 60%.

[0056] 2. Inhibition test of Chaetomium globosum NCCG-2 fermentation broth on 15 kinds of crop pathogenic fungi

[0057] Chaetomium globosum NCCG-2 cultured on PDA medium flat plate was made into a 5mm diameter disc with a puncher, and was transferred to PDB liquid medium for shake flask fermentation culture at a speed of 150 r / min and 28℃ constant temperature for 15 days. The mycelium was filtered with three layers of gauze to obtain fermentation broth, and the sterile filter was used to obtain sterile fermentation broth for standby. The sterile fermentation broth and the sterilized PDA liquid medium were mixed at a volume ratio of 1:9, shaken well, and poured flat to obtain the drug-containing flat plate. The 15 kinds of pathogenic fungi cultured were transferred to the center of the drug-containing flat plate, and the flat plate without fermentation broth was set as a control. 28℃ constant temperature culture, when the control indicator bacteria were cultured to about 80% of the whole plate, the colony diameter was measured by cross method, and the inhibition rate of Chaetomium globosum NCCG-2 fermentation broth (10 times dilution) on pathogenic fungi was calculated.

[0058] After culture, the results of 15 kinds of plant pathogenic fungi cultured by the drug-containing PDA flat plate prepared from 10 times dilution of Chaetomium globosum NCCG-2 fermentation broth are as follows Figure 4As shown in Table 2, the inhibition rate of the fermentation liquor of Chaetomium globosum NCCG-2 against the pathogenic fungi was determined by calculating the colony diameters of the pathogenic fungi measured by the cross method.

[0059] Table 2 Inhibition effect of the fermentation liquor of Chaetomium globosum NCCG-2 on the main pathogenic fungi of crops

[0060]

[0061] The results show that the fermentation liquor of Chaetomium globosum NCCG-2 has certain inhibition effect on 14 kinds of plant pathogenic fungi except for Sclerotium rolfsii. The inhibition rate on Phomopsis asparagi is as high as 97.01%, and the inhibition rate on Magnaporthe grisea is 81.43%, which has great potential for biocontrol application.

[0062] Example 3 Optimization screening of sporulation medium of Chaetomium globosum NCCG-2

[0063] Rice straw, rice bran and corn powder are used as the main raw materials for the sporulation culture of Chaetomium globosum NCCG-2, and the best sporulation solid medium is screened out according to different mass ratios of the six formula combinations.

[0064] Formula one: rice straw parts∶rice bran parts∶corn powder parts = 3∶4∶3;

[0065] Formula two: rice straw parts∶rice bran parts∶corn powder parts = 4∶3∶3;

[0066] Formula three: rice straw parts∶rice bran parts∶corn powder parts = 5∶2.5∶2.5;

[0067] Formula four: rice straw parts∶rice bran parts∶corn powder parts = 6∶2∶2;

[0068] Formula five: rice straw parts∶rice bran parts∶corn powder parts = 5∶5∶0;

[0069] Formula six: rice straw parts∶rice bran parts∶corn powder parts = 5∶0∶5.

[0070] The sporulation powder of Chaetomium globosum NCCG-2 is obtained by inoculating 2% Chaetomium globosum NCCG-2 spore suspension into the solid medium with different ratios, culturing at 28°C for 15 days, drying at room temperature, and crushing. The spore suspension is obtained by eluting 1g of the sporulation powder with clean water and filtering with double-layer gauze. The spore amount per gram of the sporulation powder is calculated by counting under a microscope after dilution at different gradients. The counting results are shown in Table 3.

[0071] Table 3 Optimization screening results of sporulation medium of Chaetomium globosum NCCG-2

[0072]

[0073] The data in Table 3 shows that the sporulation yield of Formula One is 1.44 x 10 8 cfu / g, the sporulation yield of Formula Two is 1.41 x 10 8 cfu / g, the sporulation yield of Formula Three is 6.83 x 10 8 cfu / g, the sporulation yield of Formula Four is 5.12 x 10 8 cfu / g, the sporulation yield of Formula Five is 1.32 x 10 8 cfu / g, and the sporulation yield of Formula Six is 1.65 x 10 8 cfu / g. From the above results, it can be determined that Formula Three (the number of parts of rice straw: the number of parts of rice bran: the number of parts of corn flour = 5:2.5:2.5) is the best sporulation medium formula for Chaetomium globosum NCCG-2.

[0074] Example 4: Promoting effect of Chaetomium globosum NCCG-2 on rice seedlings

[0075] The Chaetomium globosum NCCG-2 spore powder preparation was treated by substrate mixing with the fungus (the mass ratio of spore powder to substrate was 1:500) and root irrigation with spore solution (100 times liquid, 200 mL per pot) to carry out field mechanical transplanted rice seedling raising (seedling pot specifications: 58 cm x 28 cm x 2 cm), and the seed was soaked with the conventional imazamox as a control agent.

[0076] The seedling quality was investigated 25 days after sowing, and the results are shown in Table 4 and Figure 5

[0077] Table 4: Effect of Chaetomium globosum NCCG-2 on field seedling quality

[0078]

[0079] Combining Figure 5 the data in Table 4, it can be seen that, by substrate mixing with the fungus, Chaetomium globosum NCCG-2 was significantly higher than the blank control and imazamox seed soaking treatment in terms of average fresh weight of seedlings, and was not different from imazamox seed soaking and blank control treatment in terms of seedling height and seedling root number, but the main root was significantly thicker than the blank control and imazamox seed soaking treatment. By root irrigation with spore solution, Chaetomium globosum NCCG-2 was significantly higher than the blank control and imazamox seed soaking treatment in terms of seedling height, and was not different from imazamox seed soaking and blank control treatment in terms of seedling root number and seedling fresh weight. In conclusion, Chaetomium globosum NCCG-2 has a significant promoting effect on rice seedlings.

[0080] Example 5: Determination of the control effect of Chaetomium globosum NCCG-2 on rice blast

[0081] The rice blast susceptible variety "Yexiang Youhang 1573" was selected as the test variety.

[0082] ​Treatment 1: The spores of Chaetomium globosum NCCG-2 were mixed with soil at a mass ratio of 1:200 (spore powder: soil) to seed seedlings, and when the seedlings reached the 3-leaf 1-heart stage, they were sprayed with Pyricularia oryzae spore suspension for inoculation. The seedlings were incubated at 26°C under constant humidity, and after 7 days, the disease level was investigated and the control effect was calculated.

[0083] Treatment 2: The susceptible variety "Yexiang Youhang 1573" was sown in plastic pots (20 cm in diameter and 10 cm in height) after normal seed soaking and germination. When the seedlings reached the 3-leaf 1-heart stage, they were first sprayed with the fermentation filtrate of Chaetomium globosum NCCG-2 (50 times liquid, 30 mL per pot) and then incubated at room temperature for 24 hours. After that, the seedlings were sprayed with Pyricularia oryzae spore suspension for inoculation (the amount of spraying was the same as in treatment 1), and the amount of spraying was adjusted so that no water flowed from the rice leaves. The seedlings were incubated at 26°C under constant humidity, and after 7 days, the disease level was investigated and the control effect was calculated.

[0084] The preparation method of the fermentation filtrate is as follows: the cultured Chaetomium globosum NCCG-2 PDA plate was punched into a 5 mm diameter disc using a puncher, and potato sucrose liquid medium (potato 200 g, sucrose 20 g, water 1000 mL) was prepared and divided into 250 mL triangular bottles (100 mL per bottle). The bottles were sterilized at 121°C for 20 minutes. After cooling to room temperature, the Chaetomium globosum NCCG-2 disc was inoculated into the triangular bottles containing the potato sucrose liquid medium under sterile conditions, and incubated in a constant temperature and speed shaker for 15 days (temperature 27°C, speed 180 rpm). The mycelium was filtered with three layers of gauze to obtain the fermentation broth, which was diluted 50 times and then 1% Tween 20 was added for use in spraying the rice seedlings.

[0085] The test results are shown in Table 5, and the data in Table 5 show that the use of Chaetomium globosum NCCG-2 spores to colonize the susceptible variety "Yexiang Youhang 1573" in the soil has a control effect on seedling blast of 82.62%, and the fermentation broth has a control effect on rice blast leaf blast of 80.25%. The results show that Chaetomium globosum NCCG-2 has good control effect on rice blast (P < 0.05). Figure 6 and Figure 7 ).

[0086] Table 5 Control effect of Chaetomium globosum NCCG-2 on rice blast

[0087]

[0088] Example 6 Regulation and inhibition of Chaetomium globosum NCCG-2 on soil harmful microorganisms

[0089] The endophytic fungus Chaetomium globosum NCCG-2 spores were mixed with soil to seed the susceptible rice variety Yexiang Youhang 1573 for rice blast control (spore powder: soil mass ratio = 1:500), and no fungus was used as a control.

[0090] The results are shown inFigure 8 As shown in the control without bacteria, a large number of pathogenic fungal hyphae (microscopic observation of Fusarium) grew in the roots and soil of the seedlings, and caused the occurrence of rice seedling damping-off, while in the potting with the application of rice endophytic fungus Chaetomium globosum NCCG-2, no disease occurred at the base of the rice stem, and no growth of other miscellaneous bacteria in the culture soil. Therefore, the rice endophytic fungus Chaetomium globosum NCCG-2 has an inhibitory and regulatory effect on harmful microorganisms in the rhizosphere soil of rice.

[0091] Example 7 Prevention and treatment effect of Chaetomium globosum NCCG-2 on main leaf diseases of peanut

[0092] The fermentation broth (50 times liquid) of Chaetomium globosum NCCG-2 was sprayed after the flowering period of peanut (the spraying amount was 50 Kg / acre) to prevent and treat peanut leaf diseases. The prevention and treatment effect is shown in Table 6 and Figure 9 .

[0093] Table 6 Prevention and treatment effect of Chaetomium globosum NCCG-2 on main leaf diseases of peanut

[0094]

[0095] The results of field test showed that the field prevention and treatment effect of Chaetomium globosum NCCG-2 fermentation broth (50 times liquid) on peanut brown spot, black spot and leaf spot was 83.62%, 81.72% and 89.63% respectively. The results showed that Chaetomium globosum NCCG-2 had a significant prevention and treatment effect on main leaf diseases of peanut, and had a wide application prospect.

[0096] Example 8 Prevention and treatment effect of Chaetomium globosum NCCG-2 on root rot and stem rot of imperial chrysanthemum

[0097] The test selected Wuyuan imperial chrysanthemum as the test variety, and used Chaetomium globosum NCCG-2 spore powder (spore amount was 100 million cfu / g) mixed with organic fertilizer (mass ratio of NCCG-2 spore powder: organic fertilizer = 1:500) to treat and prevent root rot and stem rot of imperial chrysanthemum when transplanting in spring. The prevention and treatment effect is shown in Table 7 and Figure 10 .

[0098] Table 7 Prevention and treatment effect of Chaetomium globosum NCCG-2 on root rot and stem rot of Wuyuan imperial chrysanthemum

[0099]

[0100] The results of field test showed that the field prevention and treatment effect of Chaetomium globosum NCCG-2 spore powder on root rot and stem rot of Wuyuan imperial chrysanthemum was 85.91% and 78.65% respectively. It can be seen that Chaetomium globosum NCCG-2 has a good prevention and treatment effect on root rot and stem rot of imperial chrysanthemum.

[0101] The above described embodiments are only to illustrate the preferred modes of the present application, and are not intended to limit the scope of the present application. Any modification and improvement made by those skilled in the art to the technical solutions of the present application without departing from the design spirit of the present application shall fall within the protection scope of the present application.

Claims

1. A strain of Chaetomium globosum ( Chaetomium globosum ) NCCG-2, characterized in that It was deposited in the General Microbiology Center of China Culture Collection Administration on September 16, 2022, with the deposit number CGMCC: 40316.

2. A microbial agent, characterized in that: The invention comprises the Chaetomium globosum NCCG-2 according to claim 1 and / or its sterile fermentation liquid.

3. Use of the Chaetomium NCCG-2 according to claim 1 or the microbial agent according to claim 2 in inhibiting crop pathogens, characterized in that: The crop pathogens include Colletotrichum gloeosporioides ( Colletotrichum gloeosporioides ), Fusarium oxysporum ( Fusarium oxysporum ), Phaseolus vulgaris ( Macrophomina phaseoli Ashby )、Phomopsis asparagus( Phomopsis asparagi (Sacc.) Bubak )、Pyricularia cinerea( Pyricularia grisea (Cooke) Sacc. ), Verticillium dahliae ( Verticillium dahliae )、Phytophthora capsici( Phytophthora capsici )、Fusarium fujikura( Fusarium fujikuroi ), Sclerotium uniformis ( Sclerotium rolfsii ), Fusarium solani ( Fusarium solani (Mart.) Sacc. ) and Rhizoctonia solani ( Thanatephorus cucumeris ).

4. The use according to claim 3, characterized in that The Chaetomium globosum NCCG-2 can inhibit Colletotrichum gloeosporioides, Fusarium oxysporum, Coccidioides phaseoli, Phomopsis asparagus, Pyricularia cinerea, Verticillium dahliae, Phytophthora capsici, Fusarium fujikura, Sclerotium solani, Fusarium solani and Rhizoctonia solani.

5. The use according to claim 4, characterized in that The spore production culture medium components of Chaetomium globosum NCCG-2 include rice straw, rice bran and corn flour, and the mass ratio of the rice straw, rice bran and corn flour is 5:2.5:2.

5.

6. The use according to claim 3, characterized in that The sterile fermentation liquid of the Chaetomium globosum NCCG-2 can inhibit Colletotrichum gloeosporioides, Fusarium oxysporum, Pythium ultimum, Coccidioides phaseolus, Phomopsis asparagus, Pyricularia grisea, Verticillium dahliae, Phytophthora capsici, Fusarium fujikurai, Sclerotium rolfsii, Fusarium solani and Rhizoctonia solani; the Sclerotium rolfsii is Sclerotium rolfsii.

7. Use of the Chaetomium NCCG-2 according to claim 1 or the microbial agent according to claim 2 in preventing and controlling crop diseases, characterized in that: The crop diseases include citrus anthracnose, peanut root rot, sesame stem blight, asparagus stem blight, rice blast, cotton verticillium wilt, pepper blight, rice seedling blight, powdery mildew, sesame root rot, rice sheath blight, peanut root rot and rice damping-off.

8. Use of the Chaetomium globosum NCCG-2 according to claim 1 or the microbial agent according to claim 2 in promoting rice growth, characterized in that: The promoting of rice growth is to increase the height of rice seedlings.

9. Use of the sterile fermentation liquid of Chaetomium globosum NCCG-2 according to claim 1 in preventing and treating peanut brown spot disease, peanut black spot disease and peanut leaf spot disease.

10. Use of the Chaetomium globosum NCCG-2 according to claim 1 or the microbial agent according to claim 2 in preventing and controlling root rot and stem rot of chrysanthemum.

Images