Saccharomyces cerevisiae engineering bacterium for efficiently preparing 10-hydroxy-2-decenoic acid as well as construction method and application of saccharomyces cerevisiae engineering bacterium
By localizing and expressing specific genes in the mitochondria of Saccharomyces cerevisiae and optimizing the fermentation method, the problems of high cost and low yield in the production of 10-hydroxy-2-decenoic acid were solved, and efficient and low-cost preparation was achieved, with an output of 298.6 mg/L.
Patent Information
- Application Number
- CN202510545925.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-28
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2045-04-28
AI Technical Summary
In the prior art, the production method of 10-hydroxy-2-decenoic acid mainly relies on chemical synthesis, which has problems such as environmental pollution, high cost and difficult to increase yield. Moreover, the use of E. coli through biological pathway synthesis has problems such as low safety and strong product inhibition.
By localizing and expressing 10-HDA synthetic genes and auxiliary synthetic genes in the mitochondria of Saccharomyces cerevisiae, including the fatty acyl CoA oxidase gene ACO, the acyl CoA thioesterase gene FatB1 and the cytochrome P450 enzyme gene CYP153A33 (M228L)-CPRBM3, as well as the assisted synthetic NADH kinase gene POS5 and the helper protein gene Sil1, an efficient and low-cost engineering bacteria of Saccharomyces cerevisiae was constructed, and ethyl decanoate was used as a batch feed fermentation substrate to optimize the fermentation method.
The yield of 10-hydroxy-2-decenoic acid was significantly improved to 298.6 mg/L, reducing production costs, reducing the growth inhibition of decanoic acid on Saccharomyces cerevisiae, and optimizing the fermentation process.
Smart Images

Figure CN120349907A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to an engineered Saccharomyces cerevisiae strain for efficiently and low-costly preparing 10-hydroxy-2-decenoic acid, a construction method thereof, and an application thereof, belonging to the technical field of biological fermentation. Background Art
[0002] 10-Hydroxy-2-decenoic acid (10-HDA) is a special medium-chain fatty acid containing both a hydroxyl group and a carboxyl group, and also having an unsaturated double bond on the α and β carbons. 10-HDA is a natural organic acid with various biological activities and pharmacological effects, and is widely used in the fields of medicine, health products, cosmetics, etc. Research shows that 10-HDA has various biological activities such as antioxidant, antibacterial, anti-inflammatory, anti-tumor, and antiviral, and has significant effects on improving immune function, promoting cell proliferation, antioxidant and anti-aging, etc. In nature, this chemical substance only exists in royal jelly and is a unique and highly efficient bioactive substance.
[0003] At present, the production methods of 10-HDA on the market mostly adopt chemical synthesis methods, including Wittig reagent synthesis, ozonation, bromination elimination, Knoevenagel condensation, growth of carbon chain synthesis, etc. However, chemical synthesis methods are prone to environmental pollution and the reactions are difficult to control. Currently, 10-HDA is mainly prepared by chemical methods, but due to the high cost of chemical synthesis relying on harsh reaction conditions and the formation of various by-products, a large number of purification strategies are required.
[0004] At the same time, there are few reports on the biosynthesis of 10-HDA through biological pathways, and only the synthesis of 10-HDA by catalyzing decanoic acid in Escherichia coli has been reported. For example, Chinese patent document CN114958700A discloses an engineered Escherichia coli strain and an application, providing a genetically engineered strain with the FadB gene, FadR gene, and FadJ gene knocked out, for preparing 10-hydroxy-2-decenoic acid. However, due to the low safety of Escherichia coli and the easy generation of endotoxins during the production process, which are harmful to human health, and the strong inhibitory effect of the product 10-HDA on Escherichia coli, the yield cannot be further increased.
[0005] Saccharomyces cerevisiae is recognized as a generally regarded as safe (GRAS) microorganism and has high robustness to the environment, and the inhibitory effect of 10-HDA on it is lower than that on prokaryotes. In addition, Saccharomyces cerevisiae has multiple organelles, and each organelle regionalizes the cytoplasmic space and performs specific metabolic functions. Cellular compartmentalization can not only increase the product yield, but also reduce the toxicity of some products to the host. For example, mitochondria are organelles with a relatively high concentration of cofactors (such as NADH, NADPH) in cells, which is beneficial to the forward progress of enzymatic reactions.
[0006] Chinese Patent Document CN114958700A discloses a method for preparing 10-hydroxy-2-decenoic acid using a Saccharomyces cerevisiae engineering bacterium. However, this patent uses trans-2-decenoic acid as a substrate to prepare 10-HDA. Trans-2-decenoic acid is an intermediate product from capric acid to 10-HDA, with a very high price and extremely high production costs. Therefore, there is still a need to develop a new genetic engineering bacterium that can directly use capric acid as a substrate to efficiently and low-cost prepare 10-HDA. Summary of the Invention
[0007] In view of the deficiencies of the prior art, the present invention provides a Saccharomyces cerevisiae engineering bacterium for efficiently and low-cost preparing 10-hydroxy-2-decenoic acid, its construction method and application. By screening key catalytic elements of Saccharomyces cerevisiae, mitochondrial compartmentalization and cofactor supply, the present invention realizes the direct preparation of 10-HDA using ethyl caprate as a substrate, and optimizes the fermentation method, significantly improving the yield of 10-HDA.
[0008] The technical solution of the present invention is as follows:
[0009] A Saccharomyces cerevisiae engineering bacterium for efficiently and low-cost preparing 10-hydroxy-2-decenoic acid, which locates and expresses the 10-HDA synthesis gene and the auxiliary synthesis gene in the mitochondria of Saccharomyces cerevisiae;
[0010] The 10-HDA synthesis gene includes the acyl-CoA oxidase gene ACO, the acyl-CoA thioesterase gene FatB1, and the cytochrome P450 enzyme gene CYP153A33(M228L)-CPR BM3 ;
[0011] The auxiliary synthesis gene includes the NADH kinase gene POS5 and the auxiliary protein gene Sil1;
[0012] Among them, the acyl-CoA thioesterase gene FatB1 is derived from Cuphea palustris. Compared with the acyl-CoA thioesterase gene CtYdiI derived from Cronobacter turicensis and the acyl-CoA thioesterase gene ACOT5 derived from mice, this gene has the best catalytic effect. The auxiliary protein gene Sil1 expresses an auxiliary protein that promotes protein folding located in the endoplasmic reticulum. As a nucleotide exchange factor for the molecular chaperone Bip in the endoplasmic reticulum, by promoting the release of ADP from Bip and re-binding ATP, it prompts Bip to dissociate from the substrate, thereby assisting in the folding and expression of foreign proteins. The NADH kinase gene POS5 further improves the supply of the cofactor NADPH, thereby enhancing the catalytic efficiency of the P450 enzyme.
[0013] Preferably according to the present invention, the nucleotide sequence of the gene ACO is as shown in SEQ ID NO.1;
[0014] The nucleotide sequence of the gene FatB1 is shown in SEQ ID NO.2;
[0015] The gene CYP153A33(M228L)-CPR BM3 has a nucleotide sequence shown in SEQ ID NO.3;
[0016] The nucleotide sequence of the gene POS5 is shown in SEQ ID NO.4;
[0017] The nucleotide sequence of the gene Sil1 is shown in SEQ ID NO.5.
[0018] Preferably according to the present invention, the Saccharomyces cerevisiae is the engineered Saccharomyces cerevisiae strain WT-2KO in which POX2 and POX3 are knocked out. The construction method of this strain is prior art and has been disclosed in patent literature. For specific operations, please refer to paragraphs
[0058] to
[0123] of Chinese patent document CN116445311A, "A Method for Constructing an Engineered Saccharomyces cerevisiae Strain with High Yield of Fatty Acids".
[0019] The construction method of the above-mentioned engineered Saccharomyces cerevisiae strain for highly efficient and low-cost preparation of 10-hydroxy-2-decenoic acid includes the following steps:
[0020] (1) Using the plasmid pESC-Ura-CYP153A33(M228L)-CPR BM3 -Sil1 as a template, after double digestion with BamHⅠ and HandⅢ, a linearized plasmid fragment pESC-Ura with sticky ends is obtained;
[0021] Using the plasmid pESC-Ura-CYP153A33(M228L)-CPR BM3 -Sil1 as a template, PCR amplification is carried out using primers C-F / R to amplify a target gene COX4-CYP153A33(M228L)-CPRBM3 fragment containing a mitochondrial targeting sequence;
[0022] The target gene COX4-CYP153A33(M228L)-CPR BM3 fragment is ligated to the linearized plasmid fragment pESC-Ura to obtain a recombinant plasmid pESC-Ura-COX4-CYP153A33(M228L)-CPR BM3 -Sil1;
[0023] (2) Using the plasmid pESC-Leu-ACO-FatB1 as a template and L-F / R as primers, PCR amplification is carried out to obtain a target gene fragment LPD1-ACO;
[0024] Using plasmid pESC-Leu-ACO-FatB1 as a template and M-F / R as primers, the target gene fragment MMF1-FatB1 was obtained by PCR amplification.
[0025] The target gene fragment LPD1-ACO was ligated to the expression vector pESC-Leu to obtain the recombinant plasmid pESC-Leu-LPD1-ACO.
[0026] The target gene fragment MMF1-FatB1 was ligated to the recombinant plasmid pESC-Leu-LPD1-ACO to obtain the recombinant plasmid pESC-Leu-MMF1-FatB1-LPD1-ACO.
[0027] (3) Using the genome of the engineered Saccharomyces cerevisiae strain WT-2KO as a template and P1-F / R, P2-F / R, and P3-F / R as primers, the upstream homologous arm of the NADH kinase gene POS5, the P GAL1 -POS5-T CYC1 fragment, and the downstream homologous arm of the NADH kinase gene POS5 were respectively obtained by PCR amplification. The upstream homologous arm, the P GAL1 -POS5-T CYC1 fragment, and the downstream homologous arm were ligated together to obtain the Donor fragment containing the POS5 homologous arm.
[0028] Using plasmid pYTK as a template and PN-F / R as primers, a linearized plasmid containing the N20 fragment at the X-4 site was obtained by PCR amplification. Then, the linearized plasmid containing the N20 fragment at the X-4 site was transformed into competent Escherichia coli DH5α cells, and the plasmid was extracted to obtain plasmid pYTK-PN20.
[0029] (4) Plasmid pYTK-PN20 and the Donor fragment containing the POS5 homologous arm were co-transformed into the engineered Saccharomyces cerevisiae strain WT-2KO for the integration of the gene POS5, and positive clones were screened to obtain the engineered Saccharomyces cerevisiae strain 2K16.
[0030] (5) The recombinant plasmids pESC-Ura-COX4-CYP153A33(M228L)-CPR BM3 -Sil1 and pESC-Leu-MMF1-FatB1-LPD1-ACO were co-transformed into the engineered Saccharomyces cerevisiae strain 2K16, and positive clones were screened to obtain the engineered Saccharomyces cerevisiae strain 2K18 for the efficient and low-cost preparation of 10-hydroxy-2-decenoic acid.
[0031] Use of the above-mentioned engineered Saccharomyces cerevisiae strain in the preparation of 10-hydroxy-2-decenoic acid.
[0032] A method for preparing 10-hydroxy-2-decenoic acid using the above-mentioned engineered Saccharomyces cerevisiae, comprising the following steps:
[0033] (1) Inoculate the activated engineered yeast into SD-URA / LEU liquid seed medium, and culture it overnight with shaking at 25-35 °C and 180-220 rpm for 12-16 hours to obtain a seed solution;
[0034] (2) Inoculate the seed solution obtained in step (1) into a bioreactor containing 1 L of SD-URA / LEU liquid fermentation medium. After 24 hours of fermentation culture, add ethyl caprate at a concentration of 100 mg / L, and then supplement 100 mg / L every 4 hours until the total fermentation time reaches 64-72 hours. During the whole fermentation process, the total dosage of ethyl caprate is 1-1.2 g / L to prepare 10-hydroxy-2-decenoic acid (10-HDA).
[0035] Preferably according to the present invention, in step (1), the SD-URA / LEU liquid seed medium is: 20 g / L glucose, 6.7 g / L yeast nitrogen base, and 1.29 g / L double-deficient amino acid mixture.
[0036] Preferably according to the present invention, in step (2), the SD-URA / LEU liquid fermentation medium is: 40 g / L galactose, 6.7 g / L yeast nitrogen base, and 1.29 g / L double-deficient amino acid mixture.
[0037] Advantages of the present invention:
[0038] 1. By screening key catalytic elements, the present invention determines the optimal 10-HDA synthesis gene combination, including acyl-CoA oxidase gene ACO, acyl-CoA thioesterase gene FatB1, and cytochrome P450 enzyme gene CYP153A33(M228L)-CPR BM3 , significantly increasing the yield of trans-2-decenoic acid and providing a highly efficient precursor substance for the synthesis of 10-HDA.
[0039] 2. By constructing the 10-HDA synthesis pathway in the cytoplasm and mitochondria respectively and trying different pathway combinations, the present invention finds that the mitochondrial compartmentalization expression strategy has obvious advantages. Then, by localizing and expressing acyl-CoA oxidase gene ACO, acyl-CoA thioesterase gene FatB1, and cytochrome P450 enzyme gene CYP153A33(M228L)-CPR for 10-HDA synthesis in the mitochondria of Saccharomyces cerevisiae BM3, and the NADH kinase gene POS5 and the auxiliary protein gene Sil1 for assisting in the synthesis of 10-HDA were used to construct the engineered Saccharomyces cerevisiae strain 2K18 for the efficient and low-cost preparation of 10-hydroxy-2-decenoic acid, increasing the yield of 10-HDA to 40.50 mg / L.
[0040] 3. Ethyl caprate was used as the fed-batch fermentation substrate in the present invention. After entering the cells, ethyl caprate was slowly hydrolyzed into capric acid, reducing the growth inhibition of capric acid on Saccharomyces cerevisiae and contributing to the increase in the yield of 10-HDA. When the addition amount of ethyl caprate reached 1 g / L, the yield of 10-HDA reached 298.6 mg / L, providing an effective method for the optimization of the fermentation process. BRIEF DESCRIPTION OF THE DRAWINGS
[0041] Figure 1 are two pathways for the catalytic synthesis of 10-HDA from capric acid in Saccharomyces cerevisiae cells.
[0042] Figure 2 is the plasmid map of the recombinant plasmid pESC-Ura-COX4-CYP153A33(M228L)-CPR BM3 -Sil1.
[0043] Figure 3 is the plasmid map of the recombinant plasmid pESC-Leu-LPD1-ACO-MMF1-FatB1.
[0044] Figure 4 is the PCR verification result of the genome of the engineered Saccharomyces cerevisiae strain 2K14;
[0045] In the figure, lane 1 is COX4-CYP153A33(M228L)-CPR BM3 ; lane 2 is LPD1-ACO; lane 3 is MMF1-FatB1.
[0046] Figure 5 is the plasmid map of the plasmid pYTK-Cas9.
[0047] Figure 6 is the electrophoresis verification result of the plasmid pYTK-PN20;
[0048] In the figure, lanes 1-3 are the linearized bands of pYTK-PN20.
[0049] Figure 7 is the electrophoresis verification result of the Donor fragment containing the POS5 homologous arm.
[0050] Figure 8 is the yield of 10-hydroxycapric acid prepared by different engineered Saccharomyces cerevisiae strains in Test Example 1.
[0051] Figure 9 To determine the yields of 10-HDA and its intermediate products by different engineered Saccharomyces cerevisiae strains in Test Example 2;
[0052] In the figure, A represents the yields of 10-HDA and its intermediate products by engineered Saccharomyces cerevisiae strains 2K14, 2K15, and 2K18; B represents the yields of 10-HDA and its intermediate products by engineered Saccharomyces cerevisiae strains 2K14, 2K15, and 2K11.
[0053] Figure 10 To determine the yield of 10-HDA by engineered Saccharomyces cerevisiae strain 2K18 under different fermentation methods in Test Example 3. Detailed implementation manners
[0054] The content of the present invention will be further elaborated below in combination with embodiments, but the protected content of the present invention is not limited thereto. The operation methods not described in detail in the embodiments are all conventional operation methods well-known to those skilled in the art.
[0055] The reagents and drugs used in the present invention are all ordinary commercially available products.
[0056] The construction method of the engineered Saccharomyces cerevisiae strain WT-2KO is prior art and has been disclosed in patent literature. For specific operations, please refer to paragraphs
[0058] to
[0123] of Chinese Patent Document CN116445311A, "A method for constructing an engineered Saccharomyces cerevisiae strain with high-yield fatty acids".
[0057] Plasmid pESC-Ura-CYP153A33(M228L)-CPR BM3 -Sil1 was constructed as follows:
[0058] The genomic DNA of the engineered Saccharomyces cerevisiae strain WT-2KO was extracted using a kit. Then, using this genomic DNA as a template and 228-F / R and S-F / R as primers, the target genes CYP153A33 / M228L-CPR BM3 and the target gene sil1 were obtained by PCR amplification.
[0059] The sequences of primers 228-F / R and S-F / R are as follows:
[0060] 228-F:
[0061] 5’-AGAAAAAACCCCGGATCCATGCCCACCCTCCCCCGCACCTTCGACGACA-3’;
[0062] 228-R:
[0063] 5’-TACCAAGCTTACTCGAGTTAGCCGGCCCAGACGTCCTTGGCGTAGCGGC-3’.
[0064] S-F: 5’-AATTTTTGAAAATTCGAATTCATGGTCCGGATTCTTCCCAT-3’;
[0065] S-R: 5’-TCATCCTTGTAATCCATCGATCAGAGTTCATCTCTGAAATTTTTTATTCAATTT-3’.
[0066] The plasmid pESC-Ura and the target gene CYP153A33 / M228L-CPRBM3 were double-digested with restriction endonucleases BamHI and XhoI, then ligated and transformed using a seamless cloning kit to obtain the recombinant plasmid pESC-Ura-CYP153A33 / M228L-CPRBM3. The recombinant plasmid pESC-Ura-CYP153A33 / M228L-CPRBM3 and the target gene sil1 were double-digested with restriction endonucleases EcoRI and ClaI, then ligated and transformed using a seamless cloning kit to obtain the recombinant plasmid pESC-Ura-CYP153A33 / M228L-CPRBM3-sil1.
[0067] The plasmid pESC-Leu-ACO-FatB1 was constructed according to the method disclosed in Example 1 of Chinese Patent Document CN118813435A_ A Genetic Engineering Bacterium for Producing Trans-2-Decenoic Acid, Its Construction Method and Application.
[0068] YPD liquid medium (per liter): 20 g glucose, 20 g peptone, and 10 g yeast extract powder.
[0069] SD-URA liquid seed medium (per liter): 20 g glucose, 6.7 g yeast nitrogen base, and 1.29 g mixture of defective amino acids.
[0070] SD-URA solid seed medium: 20 g agar powder was added to the SD-URA liquid seed medium.
[0071] SD-URA liquid fermentation medium (per liter): 40 g galactose, 6.7 g yeast nitrogen base, and 1.29 g mixture of defective amino acids.
[0072] SD-URA solid fermentation medium: 20 g agar powder was added to the SD-URA liquid fermentation medium.
[0073] SD-URA / LEU liquid seed medium (per liter): 20 g glucose, 6.7 g yeast nitrogen base, and 1.29 g double-deficient amino acid mixture.
[0074] SD-URA / LEU solid seed medium: Add 20 g agar powder to the SD-URA / LEU liquid seed medium.
[0075] SD-URA / LEU liquid fermentation medium (per liter): 40 g galactose, 6.7 g yeast nitrogen base, and 1.29 g double-deficient amino acid mixture.
[0076] SD-URA / LEU solid fermentation medium: Add 20 g agar powder to the SD-URA / LEU liquid fermentation medium.
[0077] Example 1. Construction of the mitochondrial compartmentalized synthesis pathway
[0078] 1. As Figure 1 shown, after capric acid enters the Saccharomyces cerevisiae cell, it is catalytically synthesized into 10-HDA through two pathways.
[0079] Pathway 1 is: Capric acid is first catalytically synthesized into trans-2-decenoic acid by module 1, and then hydroxyl is added by module 2 to synthesize 10-HDA;
[0080] Pathway 2 is: Capric acid is first catalytically synthesized into 10-hydroxydecanoic acid by the P450 enzyme, and then catalytically synthesized into 10-HDA by module 1.
[0081] The said module 1 is the double-bond addition reaction catalyzed by acyl-CoA synthetase, acyl-CoA thioesterase, and acyl-CoA oxidase; module 2 is the hydroxyl addition reaction catalyzed by the P450 enzyme.
[0082] Through a series of screenings, the inventors of this application found that in these two pathways, the acyl-CoA oxidase gene ACO, the acyl-CoA thioesterase gene FatB1, and the cytochrome P450 enzyme gene CYP153A33(M228L)-CPR BM3 are the key enzymes. Further, the inventors of this application selected the mitochondrial targeting sequences COX4, LPD1, and MMF1 from Saccharomyces cerevisiae to localize and express these three key enzymes in the mitochondria of Saccharomyces cerevisiae.
[0083] The nucleotide sequence of the said gene ACO is as shown in SEQ ID NO.1;
[0084] The nucleotide sequence of the said gene FatB1 is as shown in SEQ ID NO.2;
[0085] The said gene CYP153A33(M228L)-CPR BM3The nucleotide sequence of [object] is shown in SEQ ID NO.3. The auxiliary protein gene Sil1 is a cofactor of cytochrome P450 enzyme and is expressed together with cytochrome P450 enzyme. The nucleotide sequence is shown in SEQ ID NO.5.
[0086] The nucleotide sequences of the mitochondrial targeting sequences COX4, LPD1, and MMF1 are shown in SEQ ID NOs. 6-8.
[0087] 2. Using plasmid pESC-Ura-CYP153A33(M228L)-CPR BM3 -Sil1 as a template, double digest it with restriction endonucleases BamHⅠ and HandⅢ, verify by gel electrophoresis after digestion, and recover the target band to obtain the plasmid linearized fragment pESC-Ura with sticky ends.
[0088] At the same time, using plasmid pESC-Ura-CYP153A33(M228L)-CPR BM3 -Sil1 as a template, perform PCR amplification using primers C-F / R to amplify the target gene COX4-CYP153A33(M228L)-CPR BM3 -Sil1 fragment containing the mitochondrial targeting sequence.
[0089] Subsequently, use the seamless cloning kit C112 to perform a recombination reaction on the plasmid linearized fragment pESC-Ura with sticky ends and the target gene COX4-CYP153A33(M228L)-CPR BM3 -Sil1 fragment. After picking and verifying the recombinant strains that grow on the resistant plate, obtain the recombinant plasmid pESC-Ura-COX4-CYP153A33(M228L)-CPR BM3 -Sil1. The specific plasmid map is as Figure 2 shown.
[0090] The sequences of primers C-F / R are as follows:
[0091] C-F: 5’-atgctttcactacgtcaatctataagatttttcaagccagccacaagaactttgtgtagctctagatatctgcttcagatgcccacc ctcccccgca-3’;
[0092] C-R: 5’-gtaccaagcttactcgagttagccggcccagacgtcctt-3’.
[0093] The PCR amplification system is as follows: 2.0 μL of 100 μM upstream primer, 2.0 μL of 100 μM downstream primer, 2.0 μL of template, 25 μL of 5 U / μL phanta enzyme, 19 μL of ddH2O, for a total of 50 μL.
[0094] The PCR amplification program is as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 2 min, 2 min 20 s, 2 min 20 s, 30 s, 1 min 10 s respectively, with 30 cycles; extension at 72°C for 5 min.
[0095] 3. Using plasmid pESC-Leu-ACO-FatB1 as the template and L-F / R as the primers, the target gene fragment LPD1-ACO was obtained by PCR amplification.
[0096] The sequences of primers C-F / R are as follows:
[0097] L-F: 5’-tcactaaagggcggccgcatgctgagaatcagatcttt-3’;
[0098] L-R: 5’-ccttgtaatccatcgatactagtttaacctcttctacctctagcagcc-3’.
[0099] Using plasmid pESC-Leu-ACO-FatB1 as the template and M-F / R as the primers, the target gene fragment MMF1-FatB1 was obtained by PCR amplification.
[0100] The sequences of primers C-F / R are as follows:
[0101] M-F: 5’-gctagccgcggtaccaagcttttaagttttaccagtggaaata-3’;
[0102] M-R: 5’-aggagaaaaaaccccggatccatgttcctgagaaact-3’.
[0103] The PCR amplification system and PCR amplification program are the same as above.
[0104] After double digestion of the expression vector pESC-Leu and the target gene fragment LPD1-ACO with NotⅠ and SpeⅠ, the digested fragments were ligated using the Novizan ClonExpress II One Step Cloning Kit to obtain the recombinant plasmid pESC-Leu-LPD1-ACO.
[0105] After double digestion of the recombinant plasmid pESC-Leu-LPD1-ACO and the target gene fragment MMF1-FatB1 with BamHⅠ and HandⅢ, the digested fragments were ligated using the Novizan ClonExpress II One Step Cloning Kit to obtain the recombinant plasmid pESC-Leu-LPD1-ACO-MMF1-FatB1. The specific plasmid map is as shown in Figure 3 shown.
[0106] 4. Respectively take 10 μL of the recombinant plasmid pESC-Ura-COX4-CYP153A33(M228L)-CPR BM3 -Sil1 and the recombinant plasmid pESC-Leu-LPD1-ACO-MMF1-FatB1 and add them to 100 μL of Escherichia coli DH5α competent cells. Gently mix and incubate on ice for 30 min; heat shock at 42 °C for 45 s, and then quickly place it in an ice bath to cool for 2 min; inoculate the competent cells transformed with the recombinant plasmid into 900 μL of antibiotic-free LB liquid medium, and culture it with shaking at 37 °C and 200 rpm for 60 min; centrifuge at 2500×g for 3 min, discard 900 μL of the supernatant, resuspend the bacteria in the remaining medium, and spread it on LB solid medium containing 100 mg / mL ampicillin; incubate upright in a 37 °C incubator for 30 min. After the bacterial liquid is absorbed, invert the plate and culture it at 37 °C for 12 - 16 h to obtain recombinant Escherichia coli colonies.
[0107] Pick a single colony of the recombinant Escherichia coli cultured above into 1 mL of LB liquid medium containing ampicillin, culture it with shaking at 37 °C and 200 rpm for 8 h, pipette 1 μL of the bacterial liquid, and perform colony PCR identification according to the 20 μL PCR reaction system. If the target band appears and the band is single, it indicates that the colony is a positive clone. At the same time, send it to a sequencing company for sequencing to further prove the correctness of the constructed positive clone.
[0108] Transform the verified recombinant plasmid pESC-Ura-COX4-CYP153A33(M228L)-CPR BM3 -Sil1 and the recombinant plasmid pESC-Leu-LPD1-ACO-MMF1-FatB1 into the engineered Saccharomyces cerevisiae strain WT-2KO. The specific steps are as follows:
[0109] ①. Mix 350 μL of the ZOMANBIO Quick Type High Efficiency Competent Cell Preparation Kit for Saccharomyces cerevisiae TM transformation solution with the recombinant plasmid pESC-Ura-COX4-CYP153A33(M228L)-CPR BM3 -Sil1 and the recombinant plasmid pESC-Leu-LPD1-ACO-MMF1-FatB1 evenly to obtain a premixed solution;
[0110] ②. Add 360 μL of the premixed solution to the competent cells of the Saccharomyces cerevisiae strain WT-2KO, aspirate and blow repeatedly to mix well, and perform transformation.
[0111] ③. Incubate in a 30 °C water bath for 50 min, mix once every 10 min, and centrifuge at 3000×g for 3 min.
[0112] ④. Discard the supernatant, resuspend the cells with 500 μL of YPD liquid medium, incubate in a 30 °C shaker for 1 h, centrifuge at 3000×g for 5 min, and discard the supernatant.
[0113] ⑤. After adding 100 μL of sterile water to the precipitate to resuspend the cells, spread them on the SD-URA solid seed medium and incubate at 30 °C for 4 days to screen for positive clones, obtaining the Saccharomyces cerevisiae engineering strain pESC-Leu-LPD1-ACO-MMF1-FatB1-pESC-Ura-COX4-CYP153A33(M228L)-CPR BM3 -Sil1, denoted as 2K14.
[0114] 5. Pick a single colony of the Saccharomyces cerevisiae engineering strain 2K14 into a sterilized glycerol tube containing 1 mL of SD-URA liquid seed medium, take 1 mL of the bacterial solution after overnight culture, centrifuge at 12000 rpm and 4 °C for 1 min, aspirate 50 μL of 20 mmol sodium hydroxide solution into a 1.5 mL centrifuge tube; use an inoculation loop to pick a small amount of Saccharomyces cerevisiae single colonies into a 1.5 mL centrifuge tube containing 50 μL of 20 mmol sodium hydroxide solution; boil in boiling water for 10 min, and take the supernatant as the solution containing the genome of the Saccharomyces cerevisiae engineering strain 2K14, and then perform PCR verification, and the results are as Figure 4 shown.
[0115] As Figure 4 can be seen, the target gene COX4-CYP153A33(M228L)-CPR BM3 in lane 1 is 3273 bp; the target gene LPD1-ACO in lane 2 is 2211 bp; the target gene MMF1-FatB1 in lane 3 is 1314 bp, indicating that the target genes CYP153A33(M228L)-CPR BM3 ACO, and FatB1 were all successfully heterologously expressed in mitochondria.
[0116] Example 2. Optimization of cofactor supply
[0117] To further improve the synthesis efficiency of 10-HDA, the supply of NADPH in mitochondria was increased by overexpressing the mitochondrial NADH kinase gene POS5. Therefore, based on the engineered Saccharomyces cerevisiae strain WT-2KO, the mitochondrial NADH kinase gene POS5 was integrated into the X-4 site of the genome of the engineered Saccharomyces cerevisiae strain WT-2KO using the CRISPR-Cas9 system.
[0118] The plasmid pYTK (from the Addgene MoClo-Yeast Toolkit (YTK) kit) was used to construct the backbone of the knockout plasmid. This plasmid contains gRNAs targeting different genes or gene spacers, and the gRNAs were designed according to the website (CHOPCHOP).
[0119] 1. Using the Golden Gate cloning technique, the modular plasmids from the MoClo-Yeast Toolkit (YTK) kit were assembled directionally, and a plasmid pYTK-Cas9 based on the CRISPR-Cas9 system was successfully constructed. The specific plasmid map is as Figure 5 shown.
[0120] Using the plasmid pYTK as a template and PN-F / R as primers, a linearized plasmid containing the N20 fragment of the X-4 site was obtained by PCR amplification. Then, the linearized plasmid containing the N20 fragment of the X-4 site was transformed into competent Escherichia coli DH5α cells to circularize the linear fragment, and the plasmid was extracted to obtain the plasmid pYTK-PN20.
[0121] Among them, the N20 fragment of the X-4 site targeted by the gRNA was predicted and determined by the website CHOPCHOP.
[0122] The PCR amplification system was: 2.0 μL of 100 μM upstream primer, 2.0 μL of 100 μM downstream primer, 2.0 μL of template, 25 μL of 5 U / μL phanta enzyme, and 19 μL of ddH2O, for a total of 50 μL.
[0123] The PCR amplification program was: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 15 s, annealing at 60 °C for 15 s, extension at 72 °C for 2 min, 2 min 20 s, 2 min 20 s, 30 s, and 1 min 10 s respectively, for 30 cycles; extension at 72 °C for 5 min.
[0124] The plasmid pYTK-PN20 was verified by electrophoresis, and the results are as Figure 6 shown.
[0125] From Figure 6It can be seen that by comparing and analyzing the gene band size with DNA Maker (DL15000), it is 8982bp, indicating that the plasmid pYTK-PN20 was successfully constructed.
[0126] 2. Locate the sequence of the X chromosome of Saccharomyces cerevisiae BY4741 on the NCBI official website, and construct a Donor fragment containing homologous arms (upstream homologous arm - P GAL1 -POS5-T CYC1 - downstream homologous arm) through SnapGene software.
[0127] Using the genome of Saccharomyces cerevisiae engineering strain WT-2KO as a template and P1-F / R, P2-F / R, and P3-F / R as primers, through PCR amplification, the upstream homologous arm (423bp) of the NADH kinase gene POS5, P GAL1 -POS5-T CYC1 fragment, and the downstream homologous arm (422bp) of the NADH kinase gene POS5 were obtained respectively.
[0128] The specific sequences of primers P1-F / R, P2-F / R, and P3-F / R are as follows:
[0129] P1-F: 5’-atctgctcaattttcagcttctacaagtgactcgagaccac-3’;
[0130] P1-R: 5’-ggcggcttctaatccgacagcctattgccccagtg-3’.
[0131] P2-F: 5’-cactggggcaataggctgtcggattagaagccgcc-3’;
[0132] P2-R: 5’-ttcccatgcctgttgctgcttcgagcgtcccaaaa-3’.
[0133] P3-F: 5’-ttttgggacgctcgaagcagcaacaggcatgggaa-3’;
[0134] P3-R: 5’-agcttcgttactcatgctttggttggcttcttgaaagtgtc-3’.
[0135] Then connect the upstream homologous arm (423bp), P GAL1 -POS5-T CYC1 fragment, and the downstream homologous arm (422bp) together to obtain a Donor fragment containing POS5 homologous arms (upstream homologous arm - PGAL1 -POS5-T CYC1 -downstream homologous arm).
[0136] The PCR amplification system and PCR amplification program are the same as above.
[0137] Electrophoresis verification was performed on the Donor fragment containing the POS5 homologous arm, and the results are as Figure 7 shown.
[0138] As can be seen from Figure 7 this, the construction of the Donor fragment containing the POS5 homologous arm was successful.
[0139] 3. Co-transform the plasmid pYTK-PN20 and the Donor fragment containing the POS5 homologous arm into the engineered Saccharomyces cerevisiae strain WT-2KO for the integration of POS5, screen for positive clones, and obtain the engineered Saccharomyces cerevisiae strain X-4::P GAL1 -POX5-T CYC1 , denoted as 2K16.
[0140] Then transform the recombinant plasmid pESC-Ura-COX4-CYP153A33(M228L)-CPR BM3 -Sil1 constructed in Example 1 into the engineered Saccharomyces cerevisiae strain 2K16, screen for positive clones, and obtain the engineered Saccharomyces cerevisiae strain X-4::P GAL1 -POS5-T CYC1 pESC-Ura-COX4-CYP153A33(M228L)-CPR BM3 -Sil1, denoted as 2K17.
[0141] Example 3. Construction of an engineered Saccharomyces cerevisiae strain for the efficient and low-cost production of 10-hydroxy-2-decenoic acid
[0142] A method for constructing an engineered Saccharomyces cerevisiae strain for the efficient and low-cost production of 10-hydroxy-2-decenoic acid, comprising the following steps:
[0143] Co-transform the recombinant plasmid pESC-Ura-COX4-CYP153A33(M228L)-CPR BM3 -Sil1 and the recombinant plasmid pESC-Leu-LPD1-ACO-MMF1-FatB1 into the engineered Saccharomyces cerevisiae strain 2K16 constructed in Example 2, screen for positive clones, and obtain the engineered Saccharomyces cerevisiae strain X-4::P GAL1 -POS5-T CYC1 -pESC-Leu-LPD1-ACO-MMF1-FatB1-pESC-Ura-COX4-CYP153A33(M228L)-CPR BM3-Sil1, denoted as 2K18.
[0144] Comparative Example 1
[0145] Using pESC-His-CpFatB1 as a template and C-1-F / R as primers, the target gene fragment FatB1 was obtained by PCR amplification.
[0146] Using pET28a-ACO as a template and AO-F / R as primers, the target gene fragment ACO was obtained by PCR amplification.
[0147] The sequences of primers C-1-F / R and AO-F / R are as follows:
[0148] C-1-F: 5’-TTGATTTCCGAAGAAGACCTCGAGATGGTTGCCGCCGCTGCTTCTT-3’;
[0149] C-1-R: 5’-CGGTTAGAGCGGATCTTAGCTAGCtcaTGTCTTACCAGTAGAGATAGCACCG TTGG-3’.
[0150] AO-F: 5’-GTAAGAATTTTTGAAAATTCGAATTCatgaccgtccacgaaaagttagcacc-3’;
[0151] AO-R: 5’-TAATCCATCGATACTAGTGCGGCCGCtcaacctcttctacct-3’.
[0152] The PCR amplification system and PCR amplification program were the same as those in Example 1.
[0153] Then, the recombinant plasmid pESC-Leu-FatB1-ACO was constructed according to the digestion and ligation methods described in Example 1.
[0154] The recombinant plasmids pESC-Ura-COX4-CYP153A33(M228L)-CPRBM3-Sil1 and pESC-Leu-FatB1-ACO obtained in Example 1 were co-transformed into the Saccharomyces cerevisiae strain WT-2KO, and positive clones were screened to obtain the Saccharomyces cerevisiae engineering strain pESC-Leu-FatB1-ACO-pESC-Ura-COX4-CYP153A33(M228L)-CPR BM3 -Sil1, denoted as 2K15.
[0155] Comparative Example 2
[0156] The plasmid pESC-Ura-CYP153A33(M228L)-CPR BM3 -Sil1 and the pESC-Leu-FatB1-ACO described in Comparative Example 1 were co-transformed into the Saccharomyces cerevisiae strain WT-2KO, and positive clones were screened to obtain the genetically engineered Saccharomyces cerevisiae pESC-Leu-FatB1-ACO-pESC-Ura-CYP153A33(M228L)-CPR BM3 -Sil1, denoted as 2K11.
[0157] Comparative Example 3
[0158] Based on the genetically engineered Saccharomyces cerevisiae WT-2KO, a recombinant strain 2K08 was constructed by expressing the P450 enzyme using the inducible promoter GAL1 / 10.
[0159] Comparative Example 4
[0160] The recombinant plasmid pESC-Ura-COX4-CYP153A33(M228L)-CPRBM3-Sil1 obtained in Example 1 was transformed into the Saccharomyces cerevisiae strain WT-2KO, and positive clones were screened to obtain the genetically engineered Saccharomyces cerevisiae pESC-Ura-COX4-CYP153A33(M228L)-CPR BM3 -Sil1, denoted as 2K13.
[0161] Test Example 1
[0162] To determine the effect of the plasmid POS5 gene on the production of 10-hydroxydecanoic acid, the genetically engineered Saccharomyces cerevisiae 2K08 described in Comparative Example 3, the genetically engineered Saccharomyces cerevisiae 2K13 described in Comparative Example 4, and the genetically engineered Saccharomyces cerevisiae 2K17 described in Example 2 were used as production strains to prepare 10-hydroxydecanoic acid.
[0163] This 10-hydroxydecanoic acid is an intermediate for the synthesis of 10-hydroxy-2-decenoic acid (10-HDA). The specific preparation method is as follows:
[0164] The engineered Saccharomyces cerevisiae was spread on SD-URA solid fermentation medium or SD-URA / LEU solid seed medium and activated in an incubator at 30°C for 24 h. All the cells on the solid medium were inoculated into 50 mL of SD-URA liquid seed medium or SD-URA / LEU liquid seed medium and cultured on a shaker at 30°C for 16 h. When the final OD reached 1.1, the cells were transferred to 300 mL of SD-URA liquid fermentation medium or SD-URA / LEU liquid fermentation medium and cultured at 30°C for 24 h. The cells were collected by centrifugation at 5000 rpm. The cells were resuspended in fresh liquid fermentation medium at a final concentration of 200 mg / mL, and 0.1 g / L of capric acid was added as a substrate. The mixture was cultured on a shaker at 30°C for 36 h, and samples were taken at 12, 18, 24, 30, and 36 h. Then, the yield of 10-hydroxydecanoic acid in the reactants was detected by a gas chromatograph at 12, 18, 24, 30, and 36 h of the reaction. The results are as Figure 8 shown
[0165] It can be Figure 8 seen that the engineered Saccharomyces cerevisiae 2K08 described in Comparative Example 3 is an unoptimized strain, and the yield of 10-hydroxydecanoic acid is very low, only 26.43 mg / L. The yield of 10-hydroxydecanoic acid of the engineered Saccharomyces cerevisiae 2K13 described in Comparative Example 4 is 80.23 mg / L. The yield of 10-hydroxydecanoic acid of the engineered Saccharomyces cerevisiae 2K17 described in Example 2 is 87.06 mg / L.
[0166] For the engineered Saccharomyces cerevisiae 2K13 described in Comparative Example 4, the P450 enzyme was localized to the mitochondria for expression, and the folding protein Sil1 was overexpressed, so that the yield of 10-hydroxydecanoic acid was increased to 80.23 mg / L. Compared with the engineered Saccharomyces cerevisiae 2K08 expressing the P450 enzyme in the cytoplasm, the conversion rate was increased by 203.56%.
[0167] For the engineered Saccharomyces cerevisiae 2K17 described in Example 2, the mitochondrial NADH kinase gene POS5 was integrated into the genomic X-4 locus on the basis of the engineered Saccharomyces cerevisiae 2K13, and the yield of 10-hydroxydecanoic acid was further increased to 87.06 mg / L. Compared with the engineered Saccharomyces cerevisiae 2K13 without expressing the POS5 gene, the conversion rate was increased by 85.23%, and compared with the engineered Saccharomyces cerevisiae 2K08 expressing the P450 enzyme in the cytoplasm, it was increased by 229.5%.
[0168] Test Example 2
[0169] The effects of optimizing cofactor supply on the yield of 10-HDA were verified by different engineered Saccharomyces cerevisiae.
[0170] A method for preparing 10-hydroxy-2-decenoic acid using the engineered Saccharomyces cerevisiae 2K14 includes the following steps:
[0171] Inoculate the engineered Saccharomyces cerevisiae strain 2K14 described in Example 1 into SD-URA / LEU liquid seed medium and shake culture at 30 °C for 16 hours to obtain a seed solution; then transfer the seed solution to another fresh SD-URA / LEU liquid fermentation medium and induce culture for 24 hours until the OD600 is 1.0 - 1.2, and collect the cells.
[0172] Resuspend the collected cells with SD-URA liquid fermentation medium, add capric acid with a final concentration of 0.1 g / L, and carry out whole-cell catalytic reaction for 24 hours to prepare 10-hydroxy-2-decenoic acid (10-HDA).
[0173] Then, using the engineered Saccharomyces cerevisiae strain 2K11 described in Comparative Example 2, the engineered Saccharomyces cerevisiae strain 2K15 described in Comparative Example 1, and the engineered Saccharomyces cerevisiae strain 2K18 described in Example 3 as production strains respectively, prepare 10-hydroxy-2-decenoic acid (10-HDA) according to the same method as above.
[0174] Then, detect the yields of trans-2-decenoic acid, 10-hydroxydecanoic acid, and 10-hydroxy-2-decenoic acid (10-HDA) by a gas chromatograph, and the results are as Figure 9 shown
[0175] As Figure 9 can be seen, the 10-HDA yield of the engineered Saccharomyces cerevisiae strain 2K11 described in Comparative Example 2 is 12.32 mg / L.
[0176] The 10-HDA yield of the engineered Saccharomyces cerevisiae strain 2K14 described in Example 1 is 35.95 mg / L.
[0177] The 10-HDA yield of the engineered Saccharomyces cerevisiae strain 2K15 described in Comparative Example 1 is 29.48 mg / L.
[0178] The 10-HDA yield of the engineered Saccharomyces cerevisiae strain 2K18 described in Example 3 is 40.50 mg / L.
[0179] Test Example 3
[0180] 1. According to the method described in Test Example 2, use the engineered Saccharomyces cerevisiae strain 2K18 described in Example 3 as the production strain to prepare 10-HDA, with the difference that the final concentration of capric acid is 0.1 g / L.
[0181] At this capric acid concentration, the 10-HDA yield is 40.50 mg / L.
[0182] 2. In order to increase the yield of 10-hydroxy-2-decenoic acid, the inventors of this application further optimized the fermentation method.
[0183] A method for efficiently preparing 10-hydroxy-2-decenoic acid using the Saccharomyces cerevisiae engineering strain 2K18 described in Example 3, comprising the following steps:
[0184] (1) Inoculate the Saccharomyces cerevisiae engineering strain 2K18 described in Example 3 into 30 mL of SD-URA liquid seed medium, and culture it overnight with shaking at 30 °C and 200 rpm for 16 hours to obtain a seed solution;
[0185] (2) Inoculate the seed solution obtained in step (1) into a bioreactor containing 1 L of SD-URA liquid fermentation medium. After fermentation for 24 h, add ethyl caprate at a concentration of 100 mg / L, and then add 100 mg / L every 4 hours until the total fermentation time reaches 64 h. During the whole fermentation process, the total dosage of ethyl caprate is 1 g / L to prepare 10-hydroxy-2-decenoic acid (10-HDA).
[0186] Then, use a gas chromatograph to detect the contents of capric acid and ethyl caprate in the reactants, the contents of by-products trans-2-decenoic acid and 10-hydroxycapric acid, and the yield of the product 10-hydroxy-2-decenoic acid (10-HDA) at 28, 32, 36, 40, 44, 48, 52, 56, 60, and 64 h of the reaction. The results are as Figure 10 shown.
[0187] It can be seen from Figure 10 that when the addition amount of ethyl caprate reaches 1 g / L, the yield of 10-HDA reaches 298.6 mg / L.
[0188] By comparing the two methods, it can be seen that when ethyl caprate is used as the substrate, fed-batch fermentation can further increase the yield of 10-HDA. This is because as the concentration of capric acid increases, it will have an inhibitory effect on the growth of Saccharomyces cerevisiae. Using the fed-batch addition of ethyl caprate can avoid the inhibition of the fermentation bacteria caused by adding excessive capric acid, and thus can maintain the efficient progress of fermentation.
Claims
1. An engineered Saccharomyces cerevisiae for efficiently and low-costly preparing 10-hydroxy-2-decenoic acid, characterized in that, Locate and express the 10-HDA synthesis gene and auxiliary synthesis genes in the mitochondria of Saccharomyces cerevisiae; The 10-HDA synthetic gene includes the acyl-CoA oxidase gene ACO, the acyl-CoA thioesterase gene FatB1, and the cytochrome P450 enzyme gene CYP153A33(M228L)-CPR BM3 ; The auxiliary synthesis genes include the NADH kinase gene POS5 and the auxiliary protein gene Sil1.
2. The engineered Saccharomyces cerevisiae as claimed in claim 1, wherein, The nucleotide sequence of the gene ACO is shown in SEQ ID NO.1; the nucleotide sequence of the gene FatB1 is shown in SEQ ID NO.2; the nucleotide sequence of the gene CYP153A33(M228L)-CPR BM3 is shown in SEQ ID NO.3; the nucleotide sequence of the gene POS5 is shown in SEQ ID NO.4; the nucleotide sequence of the gene Sil1 is shown in SEQ ID NO.
5.
3. The engineered Saccharomyces cerevisiae strain according to claim 1, wherein, The Saccharomyces cerevisiae is the engineered strain WT-2KO of Saccharomyces cerevisiae with POX2 and POX3 knocked out.
4. The construction method of the engineered Saccharomyces cerevisiae strain for highly efficient and low-cost preparation of 10-hydroxy-2-decenoic acid as claimed in claim 1, comprising the following steps: (1) Using plasmid pESC-Ura-CYP153A33(M228L)-CPR BM3 -Sil1 as a template, after double digestion with BamHⅠ and HandⅢ, a linearized plasmid fragment pESC-Ura with sticky ends was obtained; Using plasmid pESC-Ura-CYP153A33(M228L)-CPR BM3 -Sil1 as a template, PCR amplification was performed using primers C-F / R to amplify the target gene COX4-CYP153A33(M228L)-CPRBM3 fragment containing a mitochondrial targeting sequence; The target gene COX4-CYP153A33(M228L)-CPR BM3 The fragment was ligated to the linearized plasmid pESC-Ura to obtain the recombinant plasmid pESC-Ura-COX4-CYP153A33(M228L)-CPR BM3 -Sil1; (2) Using plasmid pESC-Leu-ACO-FatB1 as a template and L-F / R as primers, perform PCR amplification to obtain the target gene fragment LPD1-ACO; Using plasmid pESC-Leu-ACO-FatB1 as a template and M-F / R as primers, perform PCR amplification to obtain the target gene fragment MMF1-FatB1; Connect the target gene fragment LPD1-ACO to the expression vector pESC-Leu to obtain the recombinant plasmid pESC-Leu-LPD1-ACO; Connect the target gene fragment MMF1-FatB1 to the recombinant plasmid pESC-Leu-LPD1-ACO to obtain the recombinant plasmid pESC-Leu-LPD1-ACO-MMF1-FatB1; (3) Using the genome of the engineered Saccharomyces cerevisiae strain WT-2KO as a template and P1-F / R, P2-F / R, and P3-F / R as primers, the upstream homologous arm of the NADH kinase gene POS5, the P GAL1 -POS5-T CYC1 fragment, and the downstream homologous arm of the NADH kinase gene POS5 were obtained by PCR amplification; the upstream homologous arm, the P GAL1 -POS5-T CYC1 fragment, and the downstream homologous arm were ligated together to obtain a Donor fragment containing the POS5 homologous arm; Using plasmid pYTK as a template and PN-F / R as primers, perform PCR amplification to obtain a linearized plasmid containing the N20 fragment at the X-4 site; then transform the linearized plasmid containing the N20 fragment at the X-4 site into competent Escherichia coli DH5α cells, extract the plasmid to obtain plasmid pYTK-PN20; (4) Co-transform plasmid pYTK-PN20 and the Donor fragment containing the POS5 homologous arm into the engineered Saccharomyces cerevisiae strain WT-2KO for integration of the gene POS5, and screen for positive clones to obtain the engineered Saccharomyces cerevisiae strain 2K16; (5) Co-transform the recombinant plasmid pESC-Ura-COX4-CYP153A33(M228L)-CPR BM3 -Sil1 and the recombinant plasmid pESC-Leu-LPD1-ACO-MMF1-FatB1 into the engineered Saccharomyces cerevisiae 2K16, screen positive clones, and obtain the engineered Saccharomyces cerevisiae 2K18 for the high-efficiency and low-cost preparation of 10-hydroxy-2-decenoic acid.
5. The application of the engineered Saccharomyces cerevisiae strain as claimed in claim 1 in the preparation of 10-hydroxy-2-decenoic acid.
6. A method for preparing 10-hydroxy-2-decenoic acid using the engineered Saccharomyces cerevisiae strain described in claim 1, characterized in that, Comprising the following steps: (1) Inoculate the activated engineered yeast strain into the SD-URA / LEU liquid seed medium, and culture it overnight with shaking at 25-35 °C and 180-220 rpm for 12-16 hours to obtain a seed solution; (2) Inoculate the seed solution obtained in step (1) into a bioreactor containing 1 L of SD-URA / LEU liquid fermentation medium, after fermentation for 24 h, add ethyl caprate at a concentration of 100 mg / L, and then add 100 mg / L every 4 hours until the total fermentation time reaches 64-72 h. During the whole fermentation process, the total dosage of ethyl caprate is 1-1.2 g / L to prepare 10-hydroxy-2-decenoic acid (10-HDA).
7. The method for preparing 10-hydroxy-2-decenoic acid according to claim 6, wherein In step (1), the SD-URA / LEU liquid seed medium is: 20 g / L glucose, 6.7 g / L yeast nitrogen base, and 1.29 g / L double-deficient amino acid mixture; In step (2), the SD-URA / LEU liquid fermentation medium is: 40 g / L galactose, 6.7 g / L yeast nitrogen base, and 1.29 g / L double-deficient amino acid mixture.
Citation Information
Patent Citations
Novel method for adding decanoic acid in fermentation process of daptomycin
CN102703551A
Variant thioesterases and methods of use
CN107087416A
Recombinant saccharomyces cerevisiae for producing methyl ketone as well as construction method and application of recombinant saccharomyces cerevisiae
CN114752516A
Method for constructing high-yield fatty acid saccharomyces cerevisiae engineering bacteria
CN116445311A
Biosynthesis method for preparing royal jelly acid and application of royal jelly acid in skin care
CN116790685A