Lactobacillus mucilaginosus and application thereof

Through the application of Lactobacillus fermentation mucosa and its specific primers, effective prevention and treatment of vaginal infection has been achieved, and the problems of high antibiotic resistance and recurrence rate in the prior art have been solved. Lactobacillus fermentation mucosa inhibits the formation of pathogenic bacteria by producing organic acids, showing a strong inhibitory effect on pathogenic bacteria.

CN120349909APending Publication Date: 2025-07-22HANGZHOU GRAND BIOLOGIC PHARMA INC
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
CN202410088916.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-01-22
Publication Date
2025-07-22

AI Technical Summary

Technical Problem

The prior art has problems with increased antibiotic resistance and high recurrence rates when treating vaginal infections and related diseases, especially bacterial vaginosis and vulvac Candida disease, and the efficacy of probiotic preparations has not been fully verified.

Method used

It provides a Lactobacillus fermentation mucosa and its specific primers. It can identify and use the strain to prepare microbial preparations for preventing and treating vaginal infections. Lactobacillus fermentation mucosa can produce organic acids to inhibit the formation of pathogenic bacteria biofilm and inhibit the growth of pathogenic bacteria.

Benefits of technology

Lactobacillus fermented mucinous showed strong inhibitory effects on pathogenic bacteria such as Gardner vaginal and Candida white, reducing recurrence rates, and without risk of antibiotic resistance, and having good therapeutic effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120349909A_ABST
    Figure CN120349909A_ABST
Patent Text Reader

Abstract

The invention relates to lactobacillus mucilaginosus and application thereof. Wherein the gene of the molecular marker for fermenting lactobacillus mucus has one of the following nucleotide sequences: (1) a nucleotide sequence as shown in SEQ ID NO: 24; (2) a nucleotide sequence having at least 97%, 98%, 99% or higher homology with the nucleotide sequence as shown in SEQ ID NO: 24; and (3) a nucleotide sequence with one or more nucleotide sequences, such as 1, 2, 3, 4, 5 or more nucleotide substitutions, deletion or insertion, in the nucleotide sequence as shown in SEQ ID NO: 24. The fermented lactobacillus mucus provided by the invention is non-toxic, has good biological characteristics, has good curative effects on prevention and / or treatment of vaginal infection and related diseases, and avoids the problems of increased drug resistance, high recurrence rate and the like caused by use of antibiotic and other antibacterial drugs during treatment of vaginal infection and related diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine. Specifically, the present invention relates to a fermented Lactobacillus mucosae and its use in the preparation of a medicament for preventing and / or treating vaginal infections and related diseases. Background Art

[0002] With the economic development and the improvement of living standards, female genital tract diseases are becoming increasingly prevalent, and the incidence of vaginitis is even more common, which has seriously affected the quality of life, physical and mental health of women.

[0003] Among the diseases related to vaginal infections, bacterial vaginosis (BV) is the most common. Epidemiological investigations show that the incidence of BV in China ranges from 4.96% to 36.00%. The typical clinical features of bacterial vaginosis are the appearance of foul-smelling, watery or grayish secretions in the vagina of patients. Patients may also suffer from various complications caused by the ascending infection of pathogens, such as chronic cervicitis, pelvic inflammatory disease, endometritis, and even infertility.

[0004] Vulvovaginal candidiasis (VVC) is a vaginal infection with an incidence second only to bacterial vaginosis. Studies have found that approximately 78% of women have at least one episode of VVC caused by Candida albicans infection in their lifetime, 65% of women have 3 or fewer annual episodes, and 35% of women have 4 or more annual episodes. VVC usually presents as vulvar itching, burning, dysuria, and vaginal curd-like secretions, often resulting in a decline in the quality of life of patients.

[0005] For the treatment of BV, Western medicine treatment is currently the main approach, with the frequent use of antibacterial drugs such as antibiotics, including metronidazole, clindamycin, tinidazole, etc. However, the formation and persistence of pathogen biofilms can lead to disease recurrence. Reports show that the recurrence rates of BV patients after oral metronidazole treatment at the 1st, 3rd, 6th, and 12th months are 23%, 49%, 59%, and 68% respectively. By the 12th month after treatment, 84% of the patients still had abnormal vaginal flora. In addition, long-term and extensive use of antibiotics not only increases the drug resistance of pathogens but also inhibits the reproduction of some vaginal flora, while allowing the original small amount of Candida albicans to multiply in large numbers, resulting in vaginal flora disorders. Currently, the role of live bacterial agents in the treatment of BV is still controversial. Relevant clinical studies show that the application of current live bacterial agents is mainly divided into two types: the application of probiotics after conventional antibiotic treatment or the application of probiotics alone. Among them, the clinical trial results of multiple combination treatments are inconsistent, and it is impossible to determine whether the combination of antibiotics and probiotics can be used for the treatment of bacterial vaginitis. In addition, some studies have shown that some patients did not obtain satisfactory curative effects when using probiotic preparations alone. Therefore, there is still a great deal of controversy about the effect of probiotics alone in the treatment of BV, and a large number of experiments are still needed for exploration and research. Currently, the only probiotic drug on the market for the treatment of bacterial vaginitis is Ding Junsheng (Live Lactobacillus Capsules for Vaginal Use) developed by Inner Mongolia Shuangqi Pharmaceutical Co., Ltd.

[0006] For the treatment of VVC, the drugs commonly used clinically are mainly azoles and polyenes. For example, compound clotrimazole suppositories are often used to treat vulvovaginal candidiasis. However, with the long-term use of clinical antifungal drugs, Candida shows phenotypic changes and virulence factor mutations, the infection of non-Candida albicans increases, posing challenges to the therapeutic effects of traditional antibacterial drugs. In the treatment of various VVC patients, lactobacilli can be used as adjuvant therapeutic drugs in combination with antibacterial drugs such as azole drugs, and have certain curative effects. However, compared with conventional antifungal drug treatment, there is currently not enough evidence to show that the use of lactobacillus preparations alone has certain curative effects on the treatment of VVC. Summary of the Invention

[0007] Aiming at the above problems, the object of the present invention is to provide a fermented Lactobacillus mucosae and its use in the preparation of drugs for preventing and / or treating vaginal infections and their related diseases. This fermented Lactobacillus mucosae is a new strain screened by the inventor of the present invention, has good biological characteristics, and has good curative effects on preventing and / or treating vaginal infections and their related diseases.

[0008] The above object of the present invention is achieved by providing the following technical solutions:

[0009] In the first aspect, the present invention provides a gene (or DNA molecule) for a molecular marker of fermented Lactobacillus mucosae, which has a nucleotide sequence selected from one of the following:

[0010] (1) The nucleotide sequence shown in SEQ ID NO:24;

[0011] (2) A nucleotide sequence having at least 97%, 98%, 99% or higher homology with the nucleotide sequence shown in SEQ ID NO:24;

[0012] (3) A nucleotide sequence having one or more, such as 1, 2, 3, 4, 5 or more nucleotide substitutions, deletions or insertions in the nucleotide sequence shown in SEQ ID NO:24;

[0013] Preferably, the gene of the molecular marker for fermenting Lactobacillus mucosae has the nucleotide sequence shown in SEQ ID NO:24, or its nucleotide sequence is as shown in SEQ ID NO:24.

[0014] In a second aspect, the present invention provides a Lactobacillus mucosae for fermentation comprising the gene of the molecular marker for fermenting Lactobacillus mucosae according to the present invention.

[0015] In a third aspect, the present invention provides a primer set for identifying the Lactobacillus mucosae for fermentation according to the present invention, which comprises a forward primer and a reverse primer, wherein:

[0016] The nucleotide sequence of the forward primer is as shown in SEQ ID NO:1;

[0017] The nucleotide sequence of the reverse primer is as shown in SEQ ID NO:2.

[0018] In a fourth aspect, the present invention provides a method for identifying the Lactobacillus mucosae for fermentation according to the present invention, which comprises: amplifying the genomic DNA of the strain to be identified using the primer set according to the present invention, and then detecting the amplification product.

[0019] Preferably, the method comprises the following steps: extracting a genomic DNA sample from the strain to be identified, performing PCR amplification on the genomic DNA sample using the primer set according to the present invention, and then comparing the amplification product with the gene of the molecular marker according to the present invention. If the amplification product contains the gene of the molecular marker according to the present invention, the strain to be identified is the Lactobacillus mucosae for fermentation according to the present invention.

[0020] Preferably, if the amplification product contains the nucleotide sequence shown in SEQ ID NO:24, the strain to be identified is the Lactobacillus mucosae for fermentation according to the present invention.

[0021] Fifth aspect, the present invention provides the use of the gene for molecular markers according to the present invention in identifying the Limosilactobacillus fermentum of the present invention.

[0022] The term "molecular marker" as used in the present invention refers to a specific DNA fragment that can reflect a certain difference in the genome between biological individuals or populations.

[0023] Sixth aspect, the present invention provides a Limosilactobacillus fermentum, which comprises a nucleotide sequence selected from one of the following:

[0024] (1) The nucleotide sequence shown in SEQ ID NO:23;

[0025] (2) A nucleotide sequence having at least 99.8%, 99.9% or higher homology with the nucleotide sequence shown in SEQ ID NO:23;

[0026] (3) A nucleotide sequence having one or more, such as 1, 2, 3, 4, 5 or more nucleotide substitutions, deletions or insertions in the nucleotide sequence shown in SEQ ID NO:23.

[0027] Preferably, the genome of the Limosilactobacillus fermentum comprises the nucleotide sequence shown in SEQ ID NO:23.

[0028] Preferably, the 16S rDNA gene sequence of the Limosilactobacillus fermentum is as shown in SEQ ID NO:23.

[0029] Preferably, the Limosilactobacillus fermentum is Limosilactobacillus fermentum with the deposit number of CGMCC No.26501. Specifically, the Limosilactobacillus fermentum (HY757) provided by the present invention has been deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms (abbreviation: CGMCC), the address of the deposit unit: No. 3, Building 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, the deposit number is CGMCC No.26501, and the deposit date is February 7, 2023.

[0030] This strain has the following properties:

[0031] 1. Colony morphological characteristics:

[0032] After culturing on MRS plates, this strain forms round, smooth-edged, milky white colonies with a raised center.

[0033] 2. Strain morphological characteristics:

[0034] After staining, the strain can be observed under an optical microscope, and it can be determined that the bacteria are Gram-positive and short rod-shaped.

[0035] 3. Physiological and biochemical characteristics:

[0036] The culture temperature of this strain is 35 - 38 °C, and the optimal growth temperature is 37 °C.

[0037] The carbon sources that this strain can utilize include maltose, sucrose, raffinose, and lactose.

[0038] 4. Nutritional characteristics:

[0039] The culture of this strain does not require special nutrients. It is cultured using a basal medium and is facultatively anaerobic. Among them, the basal medium is MRS medium.

[0040] In the present invention, the fermented Lactobacillus mucosae can be isolated from naturally fermented foods or human samples. Among them, the naturally fermented foods are naturally fermented foods with regional characteristics; the human samples are selected from one or more of vaginal secretions, feces, and breast milk.

[0041] In a seventh aspect, the present invention provides a microbial preparation for preventing and / or treating vaginal infections and related diseases, which comprises the fermented Lactobacillus mucosae according to the present invention.

[0042] Preferably, the fermented Lactobacillus mucosae is the only probiotic active ingredient in the microbial preparation.

[0043] Preferably, the total viable count of fermented Lactobacillus mucosae in the microbial preparation is not less than 1×10 5 CFU / g, preferably 1×10 5 to 1×10 10 CFU / g.

[0044] Preferably, the microbial preparation further comprises pharmaceutically acceptable excipients.

[0045] More preferably, the pharmaceutically acceptable excipients are selected from one or more of surfactants, preservatives, antioxidants, hardeners, thickeners, and absorption promoters.

[0046] Preferably, the microbial preparation is a suppository.

[0047] In an eighth aspect, the present invention provides a combined drug for preventing and / or treating vaginal infections and related diseases, the combined drug comprising the fermented Lactobacillus mucosae according to the present invention or the microbial preparation according to the present invention, and other antibacterial drugs.

[0048] In a ninth aspect, the present invention provides the use of the fermented Lactobacillus mucosae according to the present invention or the microbial preparation according to the present invention in the preparation of a medicament for preventing and / or treating vaginal infections and related diseases.

[0049] Preferably, the vaginal infections and related diseases are bacterial vaginosis and / or vulvovaginal candidiasis.

[0050] More preferably, the pathogenic bacteria of the bacterial vaginosis are selected from one or more of Gardnerella vaginalis, Escherichia coli., Staphylococcus aureus, Atopobium vaginae, and Prevotella bivia.

[0051] Even more preferably, the Gardnerella vaginalis is Gardnerella vaginalis with the deposit number of ATCC 14018.

[0052] Even more preferably, the Escherichia coli is Escherichia coli with the deposit number of ATCC 25922.

[0053] Even more preferably, the Staphylococcus aureus is Staphylococcus aureus with the deposit number of ATCC 25923.

[0054] Even more preferably, the Atopobium vaginae is Atopobium vaginae with the deposit number of CCUG 38953.

[0055] Even more preferably, the Prevotella bivia is Prevotella bivia with the deposit number of NCTC 11156.

[0056] The present invention has at least the following beneficial effects:

[0057] The specific primers of the fermented Lactobacillus mucosae provided by the present invention can highly match the DNA sequence of the fermented Lactobacillus mucosae of the present invention, and specifically amplify only the DNA sequence of the fermented Lactobacillus mucosae of the present invention. The method of the present invention can efficiently and simply identify and detect the fermented Lactobacillus mucosae of the present invention.

[0058] The present invention provides a novel fermented Lactobacillus mucosae, which is non-toxic and has good biological characteristics, and has good curative effects on preventing and / or treating vaginal infections and related diseases. Specifically, the fermented Lactobacillus mucosae of the present invention can produce organic acids with antibacterial effects. The fermented Lactobacillus mucosae of the present invention can inhibit the biofilm formation of pathogenic bacteria that cause vaginal infections and related diseases, and thus has a strong inhibitory effect on pathogenic bacteria that cause vaginal infections and related diseases such as Gardnerella vaginalis (GV), Candida albicans (CA), etc.

[0059] Through conventional antibacterial experiments, co-culture antibacterial experiments and in-vivo pharmacodynamic experiments of animals, the present invention demonstrates the therapeutic potential of this strain for bacterial vaginitis caused by GV and vulvovaginal candidiasis caused by CA, etc.

[0060] The fermented Lactobacillus mucosae screened in the present invention avoids problems such as increased drug resistance and high recurrence rate caused by the use of antibacterial drugs such as antibiotics in the treatment of vaginal infections and related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Hereinafter, the embodiments of the present invention will be described in detail with reference to the drawings, wherein:

[0062] Figure 1 is the colony morphology diagram of the fermented Lactobacillus mucosae of the present invention. Among them, the left figure is the colony diagram by the three-zone streaking method; the right figure is the colony diagram by the plate coating method.

[0063] Figure 2 is the cell morphology diagram of the fermented Lactobacillus mucosae of the present invention.

[0064] Figure 3 is the PCR amplification electrophoresis pattern of the specific nucleotide sequences of 4 fermented Lactobacillus mucosae with primer 2-p1 according to the embodiment of the present invention. Among them, M is Marker, 1 uses the supernatant after lysis of HY757 as the template, 2 uses the supernatant after lysis of HY00810 as the template, 3 uses the supernatant after lysis of HY10008 as the template, and 4 uses the supernatant after lysis of HY00406 as the template.

[0065] Figure 4 is the PCR amplification electrophoresis pattern of the specific nucleotide sequences of 4 fermented Lactobacillus mucosae with primer 1-p1 according to the embodiment of the present invention. Among them, M is Marker, 1 uses the supernatant after lysis of HY757 as the template, 2 uses the supernatant after lysis of HY00810 as the template, 3 uses the supernatant after lysis of HY10008 as the template, and 4 uses the supernatant after lysis of HY00406 as the template.

[0066] Figure 5 is the hemolysis experiment result of using the fermented Lactobacillus mucosae of the present invention.

[0067] Figure 6 These are the results of the efficacy test of the VVC animal model. Specific implementation manners

[0068] The present invention will be further described in detail below in conjunction with specific implementation manners. The examples given are only for clarifying the present invention and not for limiting the scope of the present invention.

[0069] Examples

[0070] 1.1 Experimental method

[0071] 1.1.1 Isolation of Lactobacillus mucosae fermentum

[0072] (1) Collection of samples

[0073] The sample source was vaginal secretion samples of volunteers collected by gynecologists from the First People's Hospital of Yuhang, Hangzhou, who met the inclusion criteria (healthy, disease-free, no use of antibiotics and other drugs in the past month, no oral probiotic products).

[0074] (2) Isolation of strains

[0075] The samples were serially diluted tenfold with normal saline, and the diluents at appropriate dilution gradients were spread on MPYG plates and anaerobic blood plates (purchased from Huankai Microorganisms), and cultured in an anaerobic workstation at 37 °C for 48 - 72 h. Single colonies with different morphologies were picked and streaked for purification on blood plates, and then continued to be cultured. The pure cultures were picked for 16S rDNA sequencing for species identification. After determining the species of the strains, the pure cultures were inoculated into MPYG liquid medium for amplification culture. When the strains grew to an appropriate concentration, a sterile 50% (v / v) glycerol solution was mixed evenly with the same volume of liquid culture and stored in a -80 °C strain bank.

[0076] 1.1.2 Identification of Lactobacillus mucosae fermentum

[0077] (1) Colony characteristics

[0078] Dip the inoculation loop into the bacterial liquid in the strain tube and streak-inoculate it on the MRS plate, and observe the colony morphology after anaerobic culture at 37 °C for 48 h (as shown on the left); dilute and spread the bacterial liquid, and observe the colony morphology on the plate after anaerobic culture at 37 °C for 48 h (as shown on the right). Figure 1 Left as shown Figure 1 Right as shown

[0079] (2) Staining and microscopic examination

[0080] Use an inoculation loop to pick up one loop of sterile distilled water onto a clean glass slide, pick a single colony from the MRS plate, mix it with distilled water and evenly spread it on the glass slide, and stain according to the instructions of the Gram staining solution kit (purchased from Qingdao Haibo Biotechnology Co., Ltd.). Then observe the bacterial morphology.

[0081] (3) Biochemical identification and analysis

[0082] ① Lactobacillus culture: The target strain was inoculated into MRS broth medium (purchased from Qingdao Haibo Biotechnology Co., Ltd.), placed in an anaerobic incubator, and cultured at 37° C. for 24 h.

[0083] ② Preparation of bacterial suspension: Centrifuge the fermentation liquid of the strain at 4000rpm for 5 minutes in a centrifuge, remove the supernatant, wash the bacterial mud with physiological saline, centrifuge at 4000rpm for 5 minutes, remove the supernatant, wash the bacterial mud with physiological saline again, centrifuge at 4000rpm for 5 minutes, remove the supernatant, add physiological saline and bacterial mud and mix evenly for use.

[0084] ③1% sodium hippurate identification experiment: aspirate 50μL of bacterial suspension, add to 1% sodium hippurate identification tube, seal with sealing film and incubate in 37℃ water bath for 2h, then slowly add 200μL ninhydrin solution (3.5% ninhydrin solution: 0.175g hydrated ninhydrin, 2.5mL acetone, 2.5mL butanol) along the tube wall, do not shake, place in 37℃ water bath for 10min and then judge the result.

[0085] ④Other identification experiments: aspirate 50 μL of bacterial suspension, add it to the biochemical identification tube (Note: after adding the bacterial solution to the aesculin identification tube, the liquid surface needs to be covered with sterile liquid paraffin), seal it with a sealing film, place it in an anaerobic incubator, and culture it at 37°C for 48 hours before interpreting the results.

[0086] (4) 16S rDNA identification

[0087] The fermented mucus lactobacillus was amplified and sequenced by 16S rDNA, and the sequence was obtained and then compared with BLAST in the NCBI database.

[0088] (5) Specific fragment molecular markers

[0089] ① Specific primer design

[0090] a. Screening of specific nucleotide sequences: The whole genome of the HY757 strain was sequenced and analyzed, and the genome sequence of the fermentative mucus Lactobacillus strain included in the NCBI database was compared and analyzed to screen out the specific nucleotide sequence of the fermentative mucus Lactobacillus HY757.

[0091] b. Primer design: Design primers for the specific nucleotide sequences screened in step a. Design primer fragments with a predicted product length of approximately 200 to 800 bp as shown in Table 1 for the screened specific nucleotide sequences, and design 10 pairs of primers for other nucleotide sequences on the whole genome as controls. The primer sequences are shown in Table 1.

[0092] Table 1 Primer list

[0093]

[0094]

[0095] c. Primer screening: Use Lactobacillus mucosae HY757 and 3 strains of the same species as the control group (specific strain information is shown in Table 2) to prepare templates. Pick single colonies into 50 μL of lysis buffer (TaKaRa) respectively. After simple centrifugation, lyse at 80 °C for 15 min, centrifuge at 4000 rpm for 5 min, and the supernatant is the template. Through primer screening, select 2-p1 for PCR amplification experiment. The PCR amplification system is 12.5 μL of Taq enzyme, 1 μL of F, 1 μL of R, 1.5 μL of template, and make up to 25 μL with ddH2O; the PCR reaction conditions are as shown in Table 3 below, and perform the PCR experiment. After the PCR experiment, add 1.5 g of agarose to 100 mL of 1×TAE buffer, heat and melt it thoroughly, add 5 μL of Gel Red dye, pour it into the gel plate and let it solidify for use. Take 4 μL of the PCR product for agarose gel electrophoresis. The electrophoresis conditions are as follows: voltage 130 V, current 400 mA, time 35 min.

[0096] Table 2 Strain information

[0097] Strain number Identification name HY757 Limosilactobacillus fermentum HY00810 Limosilactobacillus fermentum HY10008 Limosilactobacillus fermentum HY00406 Limosilactobacillus fermentum

[0098] Note: The strains with strain numbers HY00810, HY10008, and HY00406 in the above table are Lactobacillus mucosae screened by the inventor from the samples collected in Example 1. In order to verify the specificity of the above specific nucleotide sequences for Lactobacillus mucosae HY757, the above primers were used to perform PCR amplification on HY757 and 3 strains of the same species respectively.

[0099] Table 3 PCR reaction conditions

[0100]

[0101]

[0102] 1.1.3 Strain characteristics

[0103] (1) Antibiotic sensitivity test

[0104] Lactobacillus mucosae HY757 was cultured in MRS broth medium, and then the bacterial solution was evenly spread on an MRS plate. After the bacterial solution was absorbed and dried, antibiotic susceptibility test strips were applied, and anaerobic culture was carried out at 37 °C for 48 h. The diameter of the inhibition zone was measured using a vernier caliper. Whether the strain was sensitive to the antibiotic was judged according to the inhibition diameter.

[0105] (2) Toxicity test

[0106] ① Hemolysis experiment

[0107] The bacterial solution in the frozen storage tube of the strain was dipped and streaked on an anaerobic blood plate, and anaerobic culture was carried out at 37 °C for 48 h, and the change in the color of the blood plate around the colony was observed.

[0108] ② Mouse toxicity experiment

[0109] Five mice weighing 18 - 22 g were used, and each was orally gavaged with 0.5 mL of fresh bacterial solution (not less than 1.0×10 9 CFU / 0.5 ml) once a day for 3 consecutive days. From the first day of gavage, continuous observation was carried out until the 7th day, and the survival and weight of the mice were observed.

[0110] (3) Determination of metabolite content

[0111] ① D-lactic acid detection

[0112] A D-lactic acid detection kit (purchased from Sigma-Aldrich) was used to detect the D-lactic acid production in the supernatant of Lactobacillus. The principle adopted by this kit is that D-lactic acid is oxidized by a specific D-lactic acid dehydrogenase to produce a color reaction, and there is a proportional relationship with the D-lactic acid concentration, and the absorbance at 450 nm was measured.

[0113] ② L-lactic acid detection

[0114] The supernatant was filtered using a 0.22 μm sterile filter membrane. A biosensor was used to determine the L-lactic acid concentration.

[0115] 1.1.4 Application function analysis

[0116] (1) Bacteriostatic experiment

[0117] ① Preparation of working bacterial solution: Lactobacillus was inoculated into MM medium (modified MRS broth, with the following composition: peptone 10 g / L, beef extract 5.0 g / L, yeast extract 4.0 g / L, glucose 15 g / L, K2HPO4 2.0 g / L, ammonium citrate 1.0 g / L, sodium acetate 2.5 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.05 g / L) at an inoculation amount of 0.5%, and cultured in an anaerobic workstation. The following 6 pathogenic bacteria were cultured using the appropriate medium (Gardnerella vaginalis ATCC14018, abbreviated as GV; Escherichia coli.ATCC 25922, abbreviated as EC; Staphylococcus aureus ATCC 25923, abbreviated as SA; Fannyhessea vaginae CCUG 38953, abbreviated as FV; Prevotella bivia NCTC 11156, abbreviated as PB; Canidia albicans ATCC 10231, abbreviated as CA, and all the above six pathogenic bacteria can be obtained by purchase). After culturing the target strain, the supernatant was obtained by centrifugation and filtered through a 0.22 μm filter to obtain a cell-free supernatant, which was used immediately or stored in a -80°C refrigerator. After culturing the pathogenic bacteria, the OD 600 value was measured, and it was diluted to an OD 600 value of approximately 0.005 (the viable cell count was maintained at 5.0×10 5 CFU / mL to 5.0×10 6 CFU / mL) (WS / T 650—2019 Antibacterial and Bacteriostatic Effect Evaluation Methods).

[0118] ② Interaction: Take the same volume of the supernatant and the pathogenic bacteria solution and mix them evenly. Immediately take 100 μL of the evenly mixed bacterial solution and put it into a blank 96-well plate to measure the OD 600 . The remaining culture solution was placed at 37°C and cultured anaerobically or aerobically according to the culture conditions of the pathogenic bacteria. After 48 hours of culture, 100 μL of the evenly mixed bacterial solution was taken and put into a blank 96-well plate to measure the OD 600 . A blank control group was set up, with 2 replicates for each sample. According to the following formula, the bacteriostatic rate of Lactobacillus against pathogenic bacteria was calculated.

[0119] Bacteriostatic rate = (A - B) / A * 100%

[0120] A: The OD 600 value increased within 48 hours in the positive control group (i.e., blank medium);

[0121] B: The OD 600 value increased within 48 hours in the experimental group.

[0122] (2) Co-culture Bacteriostatic Experiment

[0123] ① Co-culture experiment of Lactobacillus and CA

[0124] Cultivation of Lactobacillus: Take a glycerol tube of Lactobacillus fermentum mucosae and inoculate it into MM medium (modified MRS broth, the composition of which is: peptone 10 g / L, beef extract 5.0 g / L, yeast extract 4.0 g / L, glucose 15 g / L, K2HPO4 2.0 g / L, ammonium citrate 1.0 g / L, sodium acetate 2.5 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.05 g / L). Concentrate or dilute the cultured bacterial liquid to about 1×10 9 CFU / mL as the working bacterial liquid of Lactobacillus.

[0125] Cultivation of CA: Take a CA glycerol tube and inoculate it into Sabouraud medium. Incubate it aerobically at 37°C. Centrifuge the cultured bacterial liquid to remove the supernatant, and then adjust the concentration of the bacterial liquid to about 1.0×10 7 CFU / mL as the working bacterial liquid of CA.

[0126] Take 400 μL of the working bacterial liquids of Lactobacillus and CA respectively and inoculate them into 40 mL of MM liquid medium. CA inoculated alone serves as the positive control group, with 2 replicates in each group. Gently shake the bacterial liquid and incubate it in an anaerobic workstation at 37°C. Sampling is carried out 20 h after cultivation, and a chromogenic medium for Candida (purchased from bioMérieux, France) is used to count the viable bacteria of CA.

[0127] ② Co-culture experiment of Lactobacillus and GV

[0128] Cultivation of Lactobacillus: Take a glycerol tube of Lactobacillus fermentum mucosae and inoculate it into MM medium (modified MRS broth, the composition of which is: peptone 10 g / L, beef extract 5.0 g / L, yeast extract 4.0 g / L, glucose 15 g / L, K2HPO4 2.0 g / L, ammonium citrate 1.0 g / L, sodium acetate 2.5 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.05 g / L). Concentrate or dilute the cultured bacterial liquid to a concentration of about 1×10 9 CFU / mL as the working bacterial liquid of Lactobacillus.

[0129] Cultivation of GV: Take a GV glycerol tube and inoculate it into BHI liquid medium containing 10% fetal bovine serum. Incubate it anaerobically at 37°C. Centrifuge the cultured bacterial liquid to remove the supernatant, and then adjust the concentration of the bacterial liquid to about 1.0×10 7 CFU / mL as the working bacterial liquid of GV.

[0130] 400 μL of Lactobacillus and GV working bacterial solution were respectively inoculated into 40 mL of BHI liquid medium containing 10% fetal bovine serum. GV was inoculated alone as the positive control group, with 2 replicates in each group. They were cultured in an anaerobic workstation and sampled at 27 h after culture. The viable count of GV was detected by fluorescence quantitative qPCR method using GV-specific probe primers.

[0131] (3) Biofilm clearance experiment

[0132] ① Lactobacillus biofilm clearance experiment against GV

[0133] The bacterial solution after culturing GV was adjusted to 1.0×10 7 CFU / mL and inoculated into a 96-well plate. A total of 2 groups were set up, with 4 parallels in each group. The two groups were respectively added with the same volume of blank MM liquid medium (modified MRS broth, composition: peptone 10 g / L, beef extract 5.0 g / L, yeast extract 4.0 g / L, glucose 15 g / L, K2HPO4 2.0 g / L, ammonium citrate 1.0 g / L, sodium acetate 2.5 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.05 g / L) and the supernatant of fermented Lactobacillus mucosae. They were cultured in an anaerobic workstation at 37°C for 24 h.

[0134] After the culture was completed, the inhibitory effect of fermented Lactobacillus mucosae on GV biofilm formation was determined by the microplate crystal violet staining method.

[0135] ② Lactobacillus biofilm clearance experiment against CA

[0136] Inhibitory biofilm clearance experiment: The bacterial solution after culturing CA was adjusted to 1.0×10 7 CFU / mL and inoculated into a 96-well plate. A total of 2 groups were set up, with 4 parallels in each group. The two groups were respectively added with the same volume of Sabouraud dextrose liquid medium and the supernatant of Lactobacillus. They were cultured in an anaerobic workstation at 37°C for 24 h. After the culture was completed, the inhibitory effect of Lactobacillus on CA biofilm formation was determined by the microplate crystal violet staining method.

[0137] Biofilm clearance experiment: The bacterial solution after culturing CA was adjusted to 1.0×10 7CFU / mL. Take 100 μL and inoculate it into a 96-well plate. A total of 2 groups are set up, with 4 parallels in each group. Incubate in an anaerobic workstation at 37 °C for 24 h. After 24 h of incubation, discard the mixture in the wells and wash with sterile PBS. Add 100 μL of MM medium (modified MRS broth, with the following composition: peptone 10 g / L, beef extract 5.0 g / L, yeast extract 4.0 g / L, glucose 15 g / L, K2HPO4 2.0 g / L, ammonium citrate 1.0 g / L, sodium acetate 2.5 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.05 g / L) and the supernatant of Lactobacillus to each group, and incubate at 37 °C for 24 h. After the incubation, use the microplate crystal violet staining method to determine the effect of the Lactobacillus supernatant on the clearance of mature CA biofilm.

[0138] (4) Cell adhesion experiment

[0139] ① Preparation of working bacterial solution: Culture Lactobacillus and detect the OD 600 value of the bacterial solution. Centrifuge the cultured Lactobacillus culture solution at 4000 rpm for 5 min at 4 °C, discard the supernatant, wash it three times repeatedly with PBS, and finally resuspend Lactobacillus with MEM complete medium (purchased from Zhongqiao Xinzhou). Take an appropriate amount of the resuspended solution and use the plate coating method to detect the viable cell count, which is L1.

[0140] ② Cell culture: Seed Hela cells into a 24-well plate, with 1.5×10 5 cells / mL in each well, and culture for 16 h until the confluence rate reaches 90%. Wash the HeLa cells cultured in the 24-well plate with serum-free MEM medium (purchased from Zhongqiao Xinzhou), and then count, denoted as C1.

[0141] ③ Interaction: Inoculate Lactobacillus into the cells at a ratio of 100:1, and incubate in an environment of 37 °C and 5% CO2 for 1.5 h. Add the centrifuged supernatant to the cells as a blank control group. After 1.5 h, collect the culture solution in the wells, wash the cells in the wells with MEM medium, then add trypsin digestion to each well, and then add MEM complete medium to terminate the reaction. Collect the suspension, take a part to count the cell number C2, and use the plate coating method to detect the viable cell count L2 of Lactobacillus adhering to the cells.

[0142] ④ Calculate the adhesion number and adhesion rate: Average cell adhesion number of Lactobacillus = L2 / C2, Adhesion rate (%) = 100*L2 / L1.

[0143] (5) Efficacy test of VVC animal model

[0144] Healthy SPF-grade Balb / c mice, female, 6 - 8 weeks old, were used for modeling. The animals were adaptively cultured and then randomly divided into groups of 8 each, including a model group (M), an experimental group (Lactobacillus mucosae HY757), and a positive control group (Metronidazole and Clotrimazole Suppository). Each group was pretreated with subcutaneous injection of estradiol benzoate injection; from D0 to D2, CA (15 μL / mouse) was continuously administered, and from D3 - D7, the experimental group was given Lactobacillus mucosae HY757 (5×10 9 CFU / mL, 20 μL) vaginally every day, the positive control group was given Metronidazole and Clotrimazole Suppository (30 mg), and the model group was given an equal volume of normal saline (20 μL). On D8, the vagina was lavaged, and the lavage fluid was diluted and spread on a Candida albicans identification medium (chromogenic medium). After culturing at 37 °C for 48 h, the number of green colonies on the culture dish was observed and counted. One-way ANOVA was performed using GraphPad Prism 5 software, and statistical significance was considered at P < 0.05.

[0145] 1.2 Experimental results

[0146] 1.2.1 Screening and isolation of Lactobacillus mucosae

[0147] Through identification and screening, a strain of Lactobacillus mucosae was obtained and named Lactobacillus mucosae HY757.

[0148] 1.2.2 Identification of Lactobacillus mucosae

[0149] (1) Colony characteristics

[0150] As Figure 1 shown, the strain formed round, smooth-edged, milky white colonies with a raised center on the MRS plate after cultivation.

[0151] (2) Staining and microscopic examination

[0152] As Figure 2 shown, after staining the strain and observing it through an optical microscope, it could be determined that the cells were Gram-positive and short rod-shaped.

[0153] (3) Biochemical identification analysis

[0154] According to the instruction manual of the lactic acid bacteria biochemical identification tube, the results of the target lactic acid bacteria biochemical identification tube were interpreted. The interpretation results are shown in Table 4.

[0155] Table 4 Interpretation results of the Lactobacillus mucosae identification tube

[0156]

[0157] Note: + represents positive; - represents negative; +w represents weakly positive.

[0158] The biochemical identification results showed that the fermented Lactobacillus mucosae could utilize fewer carbon sources, and the carbon sources it could utilize were maltose, sucrose, raffinose, and lactose.

[0159] (4) 16S rDNA identification

[0160] The 16S rDNA alignment results showed that this strain belonged to Lactobacillus mucosae. The 16S rDNA determined gene sequence (SEQ ID NO: 23) is shown as follows:

[0161]

[0162] (5) Specific fragment molecular marker results

[0163] Among the primers designed for the specific nucleotide sequence, when using 2-p1 as the primer for PCR amplification experiment, only HY757 had a specific amplification band, and the band was clear and of high concentration, with relatively few primer dimers, while HY00810, HY10008, and HY00406 had no amplification bands. The agarose gel electrophoresis detection map is shown in Figure 3 . When using primers designed for other nucleotide sequences for PCR amplification experiment, there were situations where no bands could be amplified in each group or the control bacteria group also amplified bands (taking 1-p1 as an example, the agarose gel electrophoresis detection map is shown in Figure 4 ). Therefore, it shows that the primer corresponding to 2-p1 is the molecular marker primer of HY757, and the amplification product generated by this primer is the molecular marker of Lactobacillus fermentum HY757. The size of the amplification product of the 2-p1 primer is 261 bp, and the nucleotide sequence is as shown in SEQ ID NO:24. Thus, it is determined that the nucleotide sequence shown in SEQ ID NO:24 is a part of the specific nucleotide sequence screened in step a, further verifying that the primer 2-p1 can be used as the specific primer of Lactobacillus fermentum HY757, and the nucleotide shown in SEQ ID NO:24 is the specific nucleotide sequence marker of Lactobacillus fermentum HY757, which provides a reliable tool and basis for identifying and detecting Lactobacillus fermentum HY757.

[0164] CAAGAAAGGCCAGCGGATTGTATGGAACCCGACCATTAAGAGCGGGAAGAATCAGATTCCTATTAAGAAAGTCGCGATTAACAATGGGGTTAACATCACGCCAAAGAAGTCTCTTACATCCACAACTGGCAAAATAACATTACCGATGCTAGGATACAAGAGCCTCAACTACCAGGTAAGGGTAAATGGCAAAAATGTCTCGTACACAATCAATGGTTTGTACCTTGCTATCCATCAACATCATCTCAGTCGTTCGGACGT (SEQ ID NO:24).

[0165] In addition, the inventor found during the experiment that when using the 2-p1 primer to sequence multiple Lactobacillus fermentum HY757 samples, it was found that there were differences in individual bases between the amplified product sequence and the nucleotide sequence shown in SEQ ID NO:24, but compared with the control bacteria, there were specific amplification bands, and the bands were clear and of high concentration, with relatively few primer dimers.

[0166] Therefore, after multiple sequencing and alignment, the homology range between the molecular marker of Lactobacillus mucosae HY757 and the nucleotide sequence shown in SEQ ID NO: 24 was determined, that is, the nucleotide sequence of the molecular marker of Lactobacillus mucosae HY757 has at least 97%, 98%, 99% or higher homology with the nucleotide sequence shown in SEQ ID NO: 24.

[0167] 1.2.3 Strain characteristics

[0168] (1) Antibiotic sensitivity test

[0169] The antibiotic sensitivity of the strain was judged by the diameter of the inhibition zone of the strain to antibiotic susceptibility test strips. The results are shown in the following table. The strain was resistant to metronidazole, norfloxacin and kanamycin, moderately sensitive to ofloxacin and ciprofloxacin, and sensitive to clindamycin and cefuroxime.

[0170] Table 5 Results of antibiotic sensitivity test

[0171]

[0172]

[0173] Note: S: Sensitive (15 - 20 mm high sensitivity; > 20 mm extremely sensitive); I: Moderate (10 - 14 mm medium sensitivity); R: Resistant (< 10 mm insensitive)

[0174] (2) Toxicity test

[0175] ① Hemolysis

[0176] The results of the hemolysis experiment are as Figure 5 shown. Small grayish-white colonies appeared in the medium around the colonies, and there was no hemolysis ring around the colonies, indicating that Lactobacillus mucosae HY757 was γ-hemolytic, that is, non-hemolytic.

[0177] ② After mice were intragastrically administered with fresh bacterial solution of Lactobacillus mucosae HY757, all of them survived healthily and their body weights increased.

[0178] (3) Determination of metabolite content

[0179] Table 6 Results of determination of metabolite content

[0180]

[0181] Lactobacillus mucosae HY757 was cultured in MRS broth for 24 h. After detection, the content of D-lactic acid was 4.52 g / L, the content of L-lactic acid was 4.13 g / L, and the total acid production was 8.65 g / L, which was higher than that of Lactobacillus delbrueckii subsp. bulgaricus DJS (5.48 g / L). These organic acids are antibacterial substances, which can compete with pathogenic bacteria for nutrients and adhesion sites, and improve the mucosal immunity and anti-infection ability of the host.

[0182] 1.2.4 Application function analysis

[0183] (1) Antibacterial experiment

[0184] Two strains of the same species and the positive drug DJS were selected, and the antibacterial performance of the screened Lactobacillus mucosae HY757 was detected.

[0185] Table 7 Results of antibacterial experiment

[0186]

[0187]

[0188] As shown in the above table, except that the antibacterial rates of EC and SA were basically the same as those of other control groups, the antibacterial effects of Lactobacillus mucosae HY757 against the other 4 pathogenic bacteria were better than those of the control group of the same species and the positive control group. Especially for the antibacterial effects against GV, PB and CA, it had better effects compared with each control group.

[0189] (2) Results of co-culture antibacterial experiment

[0190] ① Results of co-culture antibacterial experiment of Lactobacillus and CA

[0191] After co-culturing Lactobacillus mucosae with CA for 20 h, the viable count of CA was detected.

[0192] Table 8 Results of co-culture antibacterial experiment of Lactobacillus and CA

[0193]

[0194] As shown in the above table, after co-culturing Lactobacillus mucosae with CA for 20 h, the antibacterial rate reached 89.2%, indicating that this strain had a good inhibitory effect on the growth of CA.

[0195] ② Co-culture antibacterial experiment of Lactobacillus and GV

[0196] After co-culturing Lactobacillus mucosae with GV for 27 h, the viable count of GV was detected.

[0197] Table 9 Co-culture antibacterial experiment of Lactobacillus and GV

[0198]

[0199] As shown in the above table, after 27 hours of co - culture of Lactobacillus mucosae and GV, the antibacterial rate reached 97%, indicating that this strain has a strong inhibitory effect on the growth of GV.

[0200] (3) Results of biofilm clearance experiment

[0201] ① Results of Lactobacillus on GV biofilm clearance experiment

[0202] The effect of Lactobacillus mucosae on the formation of GV biofilm was investigated.

[0203] Table 10 Results of Lactobacillus on GV biofilm clearance experiment

[0204]

[0205] As shown in the above table, the supernatant of Lactobacillus mucosae has a strong inhibitory effect on the formation of GV biofilm, reaching 91.5%.

[0206] ② Results of Lactobacillus on CA biofilm clearance experiment

[0207] The effect of Lactobacillus mucosae on the formation and clearance of pre - formed CA biofilm was investigated.

[0208] Table 11 Results of Lactobacillus on CA biofilm clearance experiment

[0209]

[0210] As shown in the above table, compared with the inhibition of biofilm formation ability, Lactobacillus mucosae has a stronger effect on clearing pre - formed CA biofilm.

[0211] (4) Cell adhesion experiment

[0212] The number of single - cell adhesions of Lactobacillus mucosae HY757 to Hela cells was 12.31 CFU, indicating that this strain has good adhesion or colonization characteristics to vaginal epidermal cells.

[0213] (5) Efficacy test of VVC animal model

[0214] The model group (M), experimental group (HY757), and positive control group (metronidazole - clotrimazole suppository) were used to establish a VVC model. After successful modeling, from D3 - D7, the experimental group was given Lactobacillus mucosae HY757 (5×10 9 CFU / mL, 20 μL) vaginally every day, the positive control group was given metronidazole - clotrimazole suppository (30 mg), and the model group was given an equal volume of normal saline (20 μL). Finally, the content of Candida albicans in the vaginal lavage fluid was detected. The experimental results are as Figure 6 shown.

[0215] The experimental results showed that, compared with the model group, the content of pathogenic bacteria in the vaginal lavage fluid of the HY757 group was extremely significantly reduced after treatment. Although there was no significant difference compared with the positive control group, the number of pathogenic bacteria in the HY757 group was slightly lower than that in the metronidazole suppository group, indicating that this strain had a good therapeutic effect on VVC in mice.

Claims

1. A gene for a molecular marker of Lactobacillus mucosae for fermentation, which has a nucleotide sequence selected from one of the following: (1) The nucleotide sequence shown in SEQ ID NO: 24; (2) A nucleotide sequence having at least 97%, 98%, 99% or higher homology with the nucleotide sequence shown in SEQ ID NO: 24; (3) A nucleotide sequence having one or more, such as 1, 2, 3, 4, 5 or more nucleotide substitutions, deletions or insertions in the nucleotide sequence shown in SEQ ID NO: 24; Preferably, the gene sequence of the molecular marker for Lactobacillus mucosae for fermentation has the nucleotide sequence shown in SEQ ID NO: 24, or its nucleotide sequence is as shown in SEQ ID NO:

24.

2. A Lactobacillus mucosae for fermentation, which contains the gene for the molecular marker according to claim 1.

3. A primer set for identifying the Lactobacillus mucosae for fermentation according to claim 2, which contains a forward primer and a reverse primer, wherein: The nucleotide sequence of the forward primer is as shown in SEQ ID NO: 1; The nucleotide sequence of the reverse primer is as shown in SEQ ID NO:

2.

4. A method for identifying Lactobacillus mucosae according to claim 2, comprising: The genomic DNA of the strain to be identified is amplified using the primer set according to claim 3, and then the amplification product is detected.

5. The method according to claim 4, the method comprising the following steps: Extract a genomic DNA sample from the strain to be identified, perform PCR amplification on the genomic DNA sample using the primer set according to claim 3, and then compare the amplification product with the gene for the molecular marker according to claim 1. If the amplification product contains the gene for the molecular marker according to claim 1, the strain to be identified is the Lactobacillus mucosae for fermentation according to claim 2; Preferably, if the amplification product contains the nucleotide sequence shown in SEQ ID NO: 24, the strain to be identified is the Lactobacillus mucosae for fermentation according to claim 2.

6. Use of the gene for the molecular marker according to claim 1 for identifying the Lactobacillus mucosae for fermentation according to claim 2.

7. A Lactobacillus mucosae for fermentation, which contains a nucleotide sequence selected from one of the following: (1) The nucleotide sequence shown in SEQ ID NO: 23; (2) A nucleotide sequence having at least 99.8%, 99.9% or higher homology with the nucleotide sequence shown in SEQ ID NO: 23; (3) A nucleotide sequence having one or more, such as 1, 2, 3, 4, 5 or more nucleotide substitutions, deletions or insertions in the nucleotide sequence shown in SEQ ID NO: 23; Preferably, the gene sequence of the Lactobacillus mucosae for fermentation contains the nucleotide sequence shown in SEQ ID NO: 23; Preferably, the 16S rDNA gene sequence of the Lactobacillus mucosae for fermentation is as shown in SEQ ID NO:

23.

8. The fermented Lactobacillus mucosae according to claim 1 or 7, wherein, The Lactobacillus mucosae for fermentation is Lactobacillus mucosae with the preservation number of CGMCC No. 26501.

9. A microbial preparation for preventing and / or treating vaginal infections and related diseases, which comprises the fermented Lactobacillus mucosae according to claim 1 or 7.

10. The microbial agent according to claim 9, wherein, The fermented Lactobacillus mucosae is the only probiotic active ingredient in the microbial preparation.

11. The microbial agent according to claim 9 or 10, wherein The total viable count of Lactobacillus mucosae in the microbial preparation is not less than 1×10 5 CFU / g, preferably 1×10 5 to 1×10 10 CFU / g.

12. The microbial agent according to any one of claims 9 to 11, wherein, The microbial preparation further comprises a pharmaceutically acceptable excipient.

13. A combined drug for preventing and / or treating vaginal infections and related diseases, the combined drug comprising the fermented Lactobacillus mucosae according to claim 1 or 7 or the microbial preparation according to any one of claims 9 to 12, and other antibacterial drugs.

14. Use of the fermented Lactobacillus mucosae according to claim 1 or 7 or the microbial preparation according to any one of claims 9 to 12 in the preparation of a drug for preventing and / or treating vaginal infections and related diseases; Preferably, the vaginal infections and related diseases are bacterial vaginosis and / or vulvovaginal candidiasis.

15. The use according to claim 14, wherein The pathogenic bacteria of the bacterial vaginosis are selected from one or more of Gardnerella vaginalis, Escherichia coli, Staphylococcus aureus, Atopobium vaginae and Prevotella bivia.

Citation Information

Cited By

  • Probiotic composition for preventing and / or treating vaginal infection and related diseases and application thereof

    CN122326422A

  • Probiotic composition for preventing and / or treating vaginal infection and related diseases and application thereof

    CN122326423A