Primer group for simultaneously detecting multiple potato viruses, kit and application

Abstract

The invention relates to the technical field of molecular biology, in particular to a primer group for simultaneously detecting multiple potato viruses, a kit and application. For sequencing sequences of six viruses of potato PLRV, PVM, PVA, PVS, PVX and PVY, sections with high homology are selected to design six pairs of corresponding specific primer pairs, a multiple RT-PCR reaction system is developed, the purpose of detecting the six viruses of PVA, PVM, PVS, PVX, PVY and PLRV at a time is achieved, the detection efficiency is greatly improved, the detection result is stable, the detection range is determined, and the credibility is high; the detection primers for the six viruses are high in specificity, and false positive and false negative results cannot be generated due to the reasons of the primers when the detection primers are used for multiplex RT-PCR detection; besides, the primer designed by the invention can also be used for detecting the same virus by TC-RT-PCR, so that the reagent cost is greatly reduced, and the primer has good practical application value.

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology, and particularly relates to a primer set, a kit and an application for simultaneously detecting multiple potato viruses. Background Art

[0002] There are more than 50 viruses infecting potatoes, but the six viruses that mainly affect potato production are PVY (Potato Virus Y), PLRV (Potato Leafroll Virus), PVX (Potato Virus X), PVA (Potato Virus A), PVM (Potato Virus M) and PVS (Potato Virus S). At present, the methods for detecting and identifying potato viruses can be divided into morphological observation detection, immunological methods and molecular biological methods. Morphological observation detection is to cut the surveyed potato tubers and observe whether there are abnormalities in the tubers, such as vascular bundle discoloration, tuber flesh color, etc., to judge whether the virus is infected. The accuracy of this method is extremely low. Immunological methods use experimental animals to immunize against viruses to produce antibodies that can bind to the viral coat protein to detect and identify the types of potato viruses. The prices of such detection kits are relatively high and the operations are also relatively cumbersome; most potato viruses are RNA viruses, so molecular biological detection methods need to be based on reverse transcription polymerase chain reaction (RT-PCR). Since RNA is not stable, it is necessary to use RNA as a template and reverse transcribe it into cDNA before performing PCR reaction detection. Viruses parasitize in host cells and are limited in number, and the extracted RNA is mostly contaminated with host DNA and RNA.

[0003] Conventional RT-PCR can only detect one molecular marker using a pair of primers in one experiment. Multiplex RT-PCR (mRT-PCR), on the other hand, can detect multiple molecular markers with multiple pairs of primers in one experiment, reducing the repetitive operations of detecting multiple markers and doubling the experimental detection cost. TC-RT-PCR uses the non-specific binding of plastic and protein to enrich virus particles and does not require special RNA extraction, with the advantages of simple operation, low price, and high precision. The method of "simultaneously detecting potato viruses and viroids by one multiplex PCR reaction" disclosed in Patent CN101096702 can detect PVS, PVX, PVY, and PLRV as well as the viroid PSTVd using multiplex RT-PCR, but cannot detect PVA and PVM. The Zou Ying team established a multiplex RT-PCR system for detecting 6 viruses and one viroid PSTVd. This system uses the cox I gene fragment as an internal reference, combines self-designed detection primers for PVA, PVM, and PLRV with detection primers for PVS, PVX, and PVY designed by Peiman and Xie and detection primers for PSTVd by Lv Dianqiu et al. to establish an octuplex RT-PCR system, but there are problems that the detection range is not clear and there are false detections in the detection results.

[0004] Therefore, how to provide a multiplex RT-PCR specific primer set with high detection sensitivity and capable of simultaneously detecting PLRV, PVM, PVA, PVS, PVX, and PVY, as well as a detection method, is a technical problem that those skilled in the art urgently need to solve. Summary of the Invention

[0005] In view of the above deficiencies in the background technology, the present invention provides a primer set, a kit, and an application for simultaneously detecting multiple potato viruses, which can simultaneously detect the main pathogenic viruses in six potatoes, namely PLRV, PVM, PVA, PVS, PVX, and PVY, and has the advantages of high detection efficiency, low cost, and high detection sensitivity.

[0006] To achieve the above object, on the one hand, the present invention provides a primer set for simultaneously detecting multiple potato viruses, including the following primer pairs:

[0007] Primer pair C-PVA: includes a forward primer and a reverse primer with nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively;

[0008] Primer pair C-PVM: includes a forward primer and a reverse primer with nucleotide sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4 respectively;

[0009] Primer pair C-PVS: includes a forward primer and a reverse primer with nucleotide sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6 respectively;

[0010] Primer pair C-PVX: including a forward primer and a reverse primer with nucleotide sequences shown in SEQ ID NO: 7 and SEQ ID NO: 8 respectively;

[0011] Primer pair C-PVY: including a forward primer and a reverse primer with nucleotide sequences shown in SEQ ID NO: 9 and SEQ ID NO: 10 respectively;

[0012] Primer pair C-PLRV: including a forward primer and a reverse primer with nucleotide sequences shown in SEQ ID NO: 11 and SEQ ID NO: 12 respectively;

[0013] Primer pair D-PLRV: including a forward primer and a reverse primer with nucleotide sequences shown in SEQ ID NO: 13 and SEQ ID NO: 14 respectively.

[0014] In a second aspect, the present invention provides the use of the above primer set in the preparation of potato virus detection and / or diagnostic products.

[0015] Furthermore, the use of the above primer set includes nucleic acid hybridization detection, molecular markers, preparation of gene chips, preparation of molecular probes, and preparation of detection kits.

[0016] Furthermore, the potato viruses include one or more of PLRV, PVM, PVA, PVS, PVX, and PVY.

[0017] In a third aspect, the present invention provides a kit including the above primer set.

[0018] In a fourth aspect, the present invention provides the use of the above kit in any one of the following 1)-3):

[0019] 1) Identifying or assisting in the identification of potato viruses;

[0020] 2) Preparing for identifying or assisting in the identification of whether a test sample contains potato viruses;

[0021] 3) Potato breeding.

[0022] In a fifth aspect, the present invention provides a method for detecting multiple potato viruses, using the above primer set or the above kit for detection.

[0023] Furthermore, the method for detecting multiple potato viruses is as follows: extracting the RNA of the test sample, after reverse transcription, performing triple PCR amplification using primer pair C-PVM, primer pair D-PLRV, and internal reference primers; performing quadruple PCR amplification using primer pair C-PVA, primer pair C-PVS, primer pair C-PVX, and primer pair C-PVY, and judging the presence or absence of the virus according to the band size of the PCR product;

[0024] The potato viruses include one or more of PLRV, PVM, PVA, PVS, PVX, and PVY;

[0025] In some embodiments of this embodiment, the primer pair C-PVA composed of a forward primer and a reverse primer with nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively is used for amplification, and a DNA fragment with a nucleotide sequence shown in SEQ ID NO: 15 can be amplified;

[0026] In some embodiments of this embodiment, the primer pair C-PVM composed of a forward primer and a reverse primer with nucleotide sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4 respectively is used for amplification, and a DNA fragment with a nucleotide sequence shown in SEQ ID NO: 16 can be amplified;

[0027] In some embodiments of this embodiment, the primer pair C-PVS composed of a forward primer and a reverse primer with nucleotide sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6 respectively is used for amplification, and a DNA fragment with a nucleotide sequence shown in SEQ ID NO: 17 can be amplified;

[0028] In some embodiments of this embodiment, the primer pair C-PVX composed of a forward primer and a reverse primer with nucleotide sequences shown in SEQ ID NO: 7 and SEQ ID NO: 8 respectively is used for amplification, and a DNA fragment with a nucleotide sequence shown in SEQ ID NO: 18 can be amplified;

[0029] In some embodiments of this embodiment, the primer pair C-PVY composed of a forward primer and a reverse primer with nucleotide sequences shown in SEQ ID NO: 9 and SEQ ID NO: 10 respectively is used for amplification, and a DNA fragment with a nucleotide sequence shown in SEQ ID NO: 19 can be amplified;

[0030] In some embodiments of this embodiment, the primer pair D-PLRV composed of a forward primer and a reverse primer with nucleotide sequences shown in SEQ ID NO: 13 and SEQ ID NO: 14 respectively is used for amplification, and a DNA fragment with a nucleotide sequence shown in SEQ ID NO: 21 can be amplified;

[0031] Specifically, the identification method is: the potato containing the nucleotide sequence SEQ ID NO: 15 in the PCR product contains the PVA virus;

[0032] Or, the potato containing the nucleotide sequence SEQ ID NO: 16 in the PCR product contains the PVM virus;

[0033] Or, the potato whose PCR product contains the nucleotide sequence SEQ ID NO: 17 contains PVS virus;

[0034] Or, the potato whose PCR product contains the nucleotide sequence SEQ ID NO: 18 contains PVX virus;

[0035] Or, the potato whose PCR product contains the nucleotide sequence SEQ ID NO: 19 contains PVY virus;

[0036] Or, the potato whose PCR product contains the nucleotide sequence SEQ ID NO: 20 contains PLRV virus;

[0037] Or, the potato whose PCR product contains the nucleotide sequence SEQ ID NO: 21 contains PLRV virus;

[0038] Furthermore, the methods for detecting multiple potato viruses are as follows: after the test sample is ground and coated, the reverse primer of the detection primer pair is added for reverse transcription, and then the forward primer of the detection primer pair is added for PCR amplification. The presence or absence of the virus is judged according to the band size of the PCR product; the detection primer pair is selected from any one of primer pair C-PVM, primer pair D-PLRV, primer pair C-PVA, primer pair C-PVS, primer pair C-PVX, and primer pair C-PVY.

[0039] The potato viruses include one or more of PLRV, PVM, PVA, PVS, PVX, and PVY;

[0040] In some embodiments of this embodiment, amplification is carried out using primer pair C-PVA composed of a forward primer and a reverse primer with nucleotide sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively, and a DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 15 can be amplified;

[0041] In some embodiments of this embodiment, amplification is carried out using primer pair C-PVM composed of a forward primer and a reverse primer with nucleotide sequences as shown in SEQ ID NO: 3 and SEQ ID NO: 4 respectively, and a DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 16 can be amplified;

[0042] In some embodiments of this embodiment, amplification is carried out using primer pair C-PVS composed of a forward primer and a reverse primer with nucleotide sequences as shown in SEQ ID NO: 5 and SEQ ID NO: 6 respectively, and a DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 17 can be amplified;

[0043] In some embodiments of this embodiment, a primer pair C-PVX composed of a forward primer and a reverse primer with nucleotide sequences as shown in SEQ ID NO: 7 and SEQ ID NO: 8 respectively can be used for amplification to amplify a DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 18;

[0044] In some embodiments of this embodiment, a primer pair C-PVY composed of a forward primer and a reverse primer with nucleotide sequences as shown in SEQ ID NO: 9 and SEQ ID NO: 10 respectively can be used for amplification to amplify a DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 19;

[0045] In some embodiments of this embodiment, a primer pair C-PLRV composed of a forward primer and a reverse primer with nucleotide sequences as shown in SEQ ID NO: 11 and SEQ ID NO: 12 respectively can be used for amplification to amplify a DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 20;

[0046] In some embodiments of this embodiment, a primer pair D-PLRV composed of a forward primer and a reverse primer with nucleotide sequences as shown in SEQ ID NO: 13 and SEQ ID NO: 14 respectively can be used for amplification to amplify a DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 21;

[0047] Specifically, the identification method is specifically as follows: Potatoes whose PCR products contain the nucleotide sequence SEQ ID NO: 15 contain PVA virus;

[0048] Or, potatoes whose PCR products contain the nucleotide sequence SEQ ID NO: 16 contain PVM virus;

[0049] Or, potatoes whose PCR products contain the nucleotide sequence SEQ ID NO: 17 contain PVS virus;

[0050] Or, potatoes whose PCR products contain the nucleotide sequence SEQ ID NO: 18 contain PVX virus;

[0051] Or, potatoes whose PCR products contain the nucleotide sequence SEQ ID NO: 19 contain PVY virus;

[0052] Or, potatoes whose PCR products contain the nucleotide sequence SEQ ID NO: 20 contain PLRV virus;

[0053] Or, potatoes whose PCR products contain the nucleotide sequence SEQ ID NO: 21 contain PLRV virus;

[0054] Beneficial effects: For the sequencing sequences of six viruses, namely PLRV, PVM, PVA, PVS, PVX, and PVY in potatoes, seven pairs of corresponding specific primer pairs were designed based on the highly homologous segments, and a multiplex RT-PCR reaction system was developed to achieve the purpose of detecting six viruses, namely PVA, PVM, PVS, PVX, PVY, and PLRV at one time, greatly improving the detection efficiency. Moreover, the detection results are stable, the detection range is determined, and the credibility is relatively high. The detection primers for the six viruses of the present invention have strong specificity and will not produce false positive and false negative results due to the primers themselves within the scope of use. In addition, the primers designed in the present invention can also be used for detecting the same viruses by TC-RT-PCR, greatly reducing the reagent cost and having good practical application value. Description of the Drawings

[0055] Figure 1 It is a flow chart for the design of multiplex RT-PCR primers for potato viruses and the establishment of a reaction system;

[0056] Figure 2 It is an electrophoresis detection diagram of the PCR product in Example 2 of the present invention;

[0057] Among them, 2A is the RT-PCR detection result of Z-PVA and C-PVA; 2B is the RT-PCR detection result of Z-PVM and C-PVM; 2C is the RT-PCR detection result of X-PVX and C-PVX; 2D is the RT-PCR detection result of X-PVS and C-PVS; 2E is the RT-PCR detection result of Z-PLRV and C-PLRV; 2F is the RT-PCR detection result of X-PVY and C-PVY;

[0058] Figure 3 It is the sequence alignment result of the amplification products of the control primers PVM and PVS in Example 2 of the present invention;

[0059] Among them, 3A is the sequence alignment result of PVM; 3B is the sequence alignment result of PVS;

[0060] Figure 4 It is an electrophoresis detection diagram of the PCR product in Example 3 of the present invention;

[0061] Among them, 4A is the electrophoresis detection diagram of the PCR products of D-PLRV, C-PVM, and the internal reference Actin primers (the products are the PLRV fragment of 444 bp, the PVM fragment of 317 bp, and the Actin internal reference gene fragment of 227 bp respectively); 4B is the electrophoresis detection diagram of the PCR products of C-PVX, C-PVY, C-PVA, and C-PVS primers (the products are the PVX fragment of 347 bp, the PVY fragment of 284 bp, the PVA fragment of 184 bp, and the PVS fragment of 111 bp respectively);

[0062] Figure 5 This is the peak graph of the cloning and sequencing results of the amplification products in Example 4 of the present invention;

[0063] Among them, 5A is PVA, 5B is PVM, 5C is PVS, 5D is PVX, 5E is PVY, 5F is PLRV (202bp), and 5G is PLRV (444bp);

[0064] Figure 6 This is the sequence alignment result of PLRV, PVM, PVA, PVS, PVX and PVY of the amplification products in Example 4 of the present invention; among them, 6A is PVA, 6B is PVM, 6C is PVS, 6D is PVX, 6E is PVY, 6F is PLRV (444), and 6G is PLRV (202);

[0065] Figure 7 This is the electrophoresis detection graph of the PCR products in Example 4 of the present invention;

[0066] Figure 8 This is the electrophoresis detection graph of the PCR products in Example 5 of the present invention;

[0067] Among them, 8A is the TC-RT-PCR detection result of Z-PVA and C-PVA; 8B is the TC-RT-PCR detection result of Z-PVM and C-PVM; 8C is the TC-RT-PCR detection result of X-PVX and C-PVX; 8D is the TC-RT-PCR detection result of X-PVS and C-PVS; 8E is the TC-RT-PCR detection result of Z-PLRV and C-PLRV; 8F is the TC-RT-PCR detection result of X-PVY and C-PVY. Detailed implementation manners

[0068] To enable those skilled in the art to better understand the technical solutions of the present invention, the present invention will be described in detail below in conjunction with the specific implementation manners. The experimental methods without specific conditions noted in the following examples are usually carried out according to conventional conditions or according to the conditions recommended by the manufacturer. The test materials used in the following examples are, unless otherwise specified, purchased from regular biochemical reagent stores. Unless otherwise stated, percentages and parts are calculated by weight. Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to the described content can be applied to the present invention. The preferred implementation methods and materials described herein are only for demonstration purposes.

[0069] As described above, in multiplex PCR virus detection, when detecting multiple viruses simultaneously, the amplification conditions of the designed primers need to be consistent, and the amplified fragments should have significant differences in order to present different band patterns in a gel electrophoresis. Therefore, in PCR amplification, for each additional virus detected in one test, the difficulty level of primer design and establishing amplification conditions increases by one level. Taking the detection of 6 potato viroids (PLRV, PVM, PVA, PVS, PVX, and PVY) infecting potatoes as an example, currently, no potato virus multiplex RT-PCR detection system has been found that can detect all 6 viruses in the present invention;

[0070] Considering that potato viruses are RNA viruses and their genetic material evolves rapidly; thus, if the specificity of the primers in RT-PCR is too high, it is very likely to result in the missed detection of some virus strains and obtain false negative results. In view of this, the inventor compared the sequences of 6 viruses (PLRV, PVM, PVA, PVS, PVX, and PVY) in the GeneBank database, selected regions with high homology to design primers, and developed a multiplex RT-PCR reaction system to achieve the purpose of accurately detecting 6 viruses, namely PVA, PVM, PVS, PVX, PVY, and PLRV, in one reaction. Moreover, this set of primers can also be used for TC-RT-PCR to detect the same viruses.

[0071] The technical solution of the present invention will be further described in detail below in conjunction with specific embodiments and the accompanying drawings. It should be understood that the following embodiments are only used to explain the present invention and are not used to limit the present invention. The six potato viroids that appear in the embodiments are: PVY (Potato Virus Y), PLRV (Potato Leafroll Virus), PVX (Potato Virus X), PVA (Potato Virus A), PVM (Potato Virus M), and PVS (Potato Virus S).

[0072] Example 1 Design of specific detection primers

[0073] The inventor queried the complete genomic sequences of the above 6 potato viruses in the GeneBank database and obtained a total of 18 complete genomic sequences of PVA, 201 complete genomic sequences of PVM, 102 complete genomic sequences of PVS, 569 complete genomic sequences of PVX, 135 complete genomic sequences of PVY, and 149 complete genomic sequences of PLRV; the inventor used the ClustalW method to align and analyze the complete genomic sequences of the corresponding viruses, and designed primer pairs C-PVA: C-PVA-F (nucleotide sequence as shown in SEQ ID NO: 1) / C-PVA-R (nucleotide sequence as shown in SEQ ID NO: 2) for highly homologous fragments; primer pair C-PVM: C-PVM-F (nucleotide sequence as shown in SEQ ID NO: 3) / C-PVM-R (nucleotide sequence as shown in SEQ ID NO: 4); primer pair C-PVS: C-PVS-F (nucleotide sequence as shown in SEQ ID NO: 5) / C-PVS-R (nucleotide sequence as shown in SEQ ID NO: 6); primer pair C-PVX: C-PVX-F (nucleotide sequence as shown in SEQ ID NO: 7) / C-PVX-R (nucleotide sequence as shown in SEQ ID NO: 8); primer pair C-PVY: C-PVY-F (nucleotide sequence as shown in SEQ ID NO: 9) / C-PVY-R (nucleotide sequence as shown in SEQ ID NO: 10); primer pair D-PLRV: D-PLRV-F (nucleotide sequence as shown in SEQ ID NO: 11) / D-PLRV-R (nucleotide sequence as shown in SEQ ID NO: 12); primer pair C-PLRV: C-PLRV-F (nucleotide sequence as shown in SEQ ID NO: 13) / C-PLRV-R (nucleotide sequence as shown in SEQ ID NO: 14). The primer sequences are shown in Table 1:

[0074] Table 1

[0075]

[0076]

[0077]

[0078] Example 2 Verification of Specific Primers

[0079] Cut 0.1 g of the stems and leaves of potato test-tube seedlings A1, M1, S1, X1, Y1, and R1 containing the above 6 viruses and virus-free test-tube seedling W1, respectively put them into centrifuge tubes, add 3 - 4 steel beads, and grind the materials thoroughly with a bead mill. Extract the total RNA of the materials and store it at -80°C.

[0080] Subsequently, RNA was reverse transcribed into cDNA using the Aikery Bio Kit (AG11728). Using the prepared cDNA as a template, PCR amplification was performed with the specific virus detection primers of the present invention (as shown in Table 1) and the primers reported by Zou Ying et al. as control primers (as shown in Table 2). The obtained PCR products were electrophoresed with 1.5% agarose for the amplified products;

[0081] Table 2

[0082]

[0083]

[0084] The electrophoretic detection results of the detection primers and control primers of the present invention were compared. The results are as Figure 2 shown. The control primers and the primers of the present invention (C-PVA, C-PVM, C-PVX, C-PVS, C-PLRV, C-PVY) all amplified the target bands, and the bands were clear with little difference in band brightness. There were no miscellaneous bands in the negative control and blank control. The results indicate that the primers of the present invention have strong specificity and can be used for the detection of PVA, PVM, PVS, PVX, PVY, and PLRV.

[0085] Meanwhile, when using the control primers to detect samples, it was found that there were an unusually large number of materials carrying PVM. Therefore, the detection products suspected of carrying PVM were sequenced and compared (see Figure 3 ), and it was found that the homology of this fragment with PVM was only 63.72% ( Figure 3 a), while the homology with the genomic region of PVS was 83.16% ( Figure 3 b). Therefore, it was inferred that the primers were not specific for PVS and PVM, and the detection of PVS virus was more frequent. That is, the conclusion drawn only based on the presence or absence of bands would misjudge the materials infected with PVS as being infected with PVM.

[0086] Example 3 Establishment and verification of a multiplex PCR detection system

[0087] Eighteen test materials were taken, RNA was extracted and reverse transcribed into cDNA. Using the prepared cDNA as a template, a triple RT-PCR reaction was performed with the amplification system in Table 3 to detect PLRV, PVM, and Actin (internal reference gene), and a quadruple RT-PCR reaction was performed with the amplification system in Table 4 to detect PVA, PVS, PVX, and PVY. The amplification procedure is shown in Table 5;

[0088] Table 3 Triple PCR amplification system

[0089]

[0090]

[0091] Table 4 Quadruple PCR reaction system

[0092]

[0093] Table 5 Triple and quadruple PCR reaction procedures

[0094]

[0095] The amplified products were electrophoretically detected with 1.5% agarose (see Figure 4 ). Figure 4 A is the electrophoresis map of triple amplification. It can be seen that the amplified products PLRV-1 (whose nucleotide sequence is shown in SEQ ID NO: 21), with a length of 444 bp; and the amplified product PVM (whose nucleotide sequence is shown in SEQ ID NO: 16), with a length of 317 bp, were obtained respectively.

[0096] SEQ ID NO: 16

[0097] TTGGCTGTGCTGAAGAAGGATGCAGAAACACTACGAAGGGTGTGTAGGCTGTACGCCCCGGTGACATGGAATCATATGCTGACGCACAACACGCCTCCAGCCGACTGGGCTGCCATGGGGTTCCAGTACGAGGATCGCTTCGCTGCTTTCGACTGCTTTGATTACGTTGAAAACGCTGCTGCAGTCCAACCCCTAGAGGGATTGATCAGGCGACCCACCCCAAGGGAAAAGATTGCTCACAATACGCACAAAGACATCGCGCTGCGCGGAGCAAACCGCAATCAGGTGTTCAGCTCTCTCAATGCCGAGGTCACTGG

[0098] SEQ ID NO: 21

[0099] CAATCGCCGCTCAAGAAGAACTGGAGTTCCCCGAGGACGAAGCTCAAGCGAGACATTCGTGTTTACAAAGGACAACCTCGTGGGCAACTCCCAAGGAAGTTTCACCTTCGGGCCGAGTCTATCAGACTGTCCGGCATTCAAGGATGGAATACTCAAGGCCTACCATGAGTATAAGATCACAAGCATCTTACTTCAGTTCGTCAGCGAGGCCTCTTCCACCTCCTCCGGCTCCATCGCTTATGAGTTGGACCCCCATTGCAAAGTATCATCCCTCCAGTCCTACGTCAACAAGTTCCAAATTACGAAGGGCGGCGCCAAAACTTATCAAGCGCGGATGATAAACGGGGTAGAATGGCACGATTCTTCTGAGGACCAGTGCCGGATACTGTGGAAGGGAAATGGAAAATCTTCAGATACCGCAGGATCCTTCAGAGTCACCATCAG

[0100] Figure 4 Electrophoretogram B is a quadruple amplification electrophoretogram. It can be seen that amplification products PVA (whose nucleotide sequence is as shown in SEQ ID NO: 15), with a length of 184 bp; amplification product PVS (whose nucleotide sequence is as shown in SEQ ID NO: 17), with a length of 111 bp; amplification product PVX (whose nucleotide sequence is as shown in SEQ ID NO: 18), with a length of 347 bp; amplification product PVY (whose nucleotide sequence is as shown in SEQ ID NO: 19), with a length of 284 bp;

[0101] SEQ ID NO: 15

[0102] GACTCATTCAGTACCACGCTTAAAATCAATGACATCAAAACTGACACTACCAATGCTCAAAGGTAAGAGTGTCGTTAACCTAGATCACTTGCTATCTTACAAACCAAAGCAAGTAGACTTGTCAAATGCTAGAGCCACTCACGAACAATTCCAAAACTGGTATGATGGCGTTATGGCAAGTTAAT

[0103] SEQ ID NO: 17

[0104] TCGTTCCACTTACGCTCGTAAGCGGAGGGCCCGCAGCATTGGGCGTTGCTGGCGATGTTATCGTGTCTATCCACCTATTTGTAATTCTAAGTGTGATAATAGAACATGCCG

[0105] SEQ ID NO: 18

[0106] CCGTATCAGGCACCAGAACTCAGCCTTGAGCCTCACTTCTACTTGGAGACTTCTTTCCGTACTCCAAGAAAGGTAGCTGCCCTGATAGCGAGTTGCGGGTTTGACTTTGAAACCAATTCACAAGAGGAGGGCCACTTGGAAGTGACTGGAATCTTCAAAGGGCCTCTGCTGGGTAAGGTGATCGCCATAGACTCCGAGTCCGAGGAGACTTTGTCTAGACACGGCGTGGAGTTTGTGAGGCCTTGCCAAGTGACTGGATTGGAATTCCCAGTGGTCACAATTGTTTCAGCTGCACCCATCGAGGAGATCGGCCAAGCCACCTTGTTCTACAACGCAATCACAAGGTC

[0107] SEQ ID NO: 19

[0108] AGCAAGGTAGCATCCAGTCAAACCCGAACAAAGGAAAAGATAAGGATGTGAATGCTGGCACATCTGGGACACATACTGTGCCGAGAATCAAGGCTATCACGTCCAAAATGAGAATGCCCAAAAGCAAGGGAGCAACCGTGCTAAACTTAGAACACTTGCTTGAGTATGCTCCACAACAAATTGATATTTCAAATACTCGGGCAACTCAATCACAGTTTGATACGTGGTATGAGGCAGTGCGGATGGCATACGACATAGGAGAAACTGAGATGCCAACTGTGATG

[0109] Subsequently, the target fragment was recovered, ligated to the vector, sequenced, and partial sequencing peaks are as Figure 5 shown. The sequencing results were compared with the known sequences ( Figure 6 ), Figure 6It can be seen that the gene fragments have relatively high homology with those of PVA, PVM, PVS, PLRV(202), PLRV(444), and PVY, which are 98.91%, 93.06%, 100%, 97.54%, 99%, and 99% respectively; this indicates that the detected gene fragments of the five viruses, namely PVA, PVM, PVS, PLRV, and PVY, cloned are specific and consistent with known virus species; the homology with the gene fragment of PVX also reaches 80.12%.

[0110] Meanwhile, the above experimental materials were subjected to RT-PCR detection, and the results are as Figure 7 . The RT-PCR detection results were compared with the multiplex RT-PCR detection results of the present invention, and it was found that the detection results of the two methods were consistent (see Table 6).

[0111] Table 6 Results of single and multiplex RT-PCR virus detection of 18 samples

[0112]

[0113] As shown in Table 6, the materials with the most virus species infections are No. 17 and No. 18, carrying all 6 viruses; followed by No. 16 material carrying the other 5 viruses except PVX, No. 8 material not infected with viruses, and then No. 1 and No. 7 materials both carrying only one virus, No. 1 material carrying PVS, and No. 7 carrying PVY. The number of viruses infected by other materials varies from 2 to 5 species. It shows that the multiplex PCR potato virus detection system established in the present invention is feasible.

[0114] Example 5 Establishment and verification of the TC-RT-PCR system

[0115] Take 0.1 g of the experimental material leaves, place them in a centrifuge tube, add 3 - 4 steel beads, add a little liquid nitrogen and then grind thoroughly with a bead mill, and add PBS buffer. After mixing, centrifuge at 10000 r / min at 4°C for 10 min, aspirate the supernatant to obtain the virus extract.

[0116] After that, transfer 100 μL of the virus extract to a 200 μL PCR tube, and incubate in a water bath at 37°C for 3 h (or overnight at 4°C) (i.e., tube capture). Wash the PCR tube 3 times with PBST and 2 times with ddH2O, 3 min each time. Aspirate the remaining liquid at the bottom of the tube.

[0117] According to the steps and system of the reverse transcription kit, remove DNA in the washed PCR tubes and perform reverse transcription to obtain cDNA. Using the prepared cDNA as a template, perform PCR amplification with the specific virus detection primers of the present invention (as shown in Table 1) and the primers reported by Zou Ying et al. as control primers (as shown in Table 2). Set the number of cycles to 36. After the reaction ends, electrophorese the PCR products with 1.5% agarose and observe and record the results with a gel imaging system( Figure 8 ).

[0118] As Figure 8 shown, the virus detection primers designed by the present invention have strong specificity and stable results, and can be used for TC-RT-PCR to detect the 6 viruses to be detected by the present invention; the obtained amplification product PVA (its nucleotide sequence is as shown in SEQ ID NO: 15), with a length of 184 bp; the amplification product PVM (its nucleotide sequence is as shown in SEQ ID NO: 16), with a length of 317 bp; the amplification product PVS (its nucleotide sequence is as shown in SEQ ID NO: 17), with a length of 111 bp; the amplification product PVX (its nucleotide sequence is as shown in SEQ ID NO: 18), with a length of 347 bp; the amplification product PVY (its nucleotide sequence is as shown in SEQ ID NO: 19), with a length of 284 bp; the amplification product PLRV (its nucleotide sequence is as shown in SEQ ID NO: 20), with a length of 202 bp;

[0119] SEQ ID NO: 15

[0120] GACTCATTCAGTACCACGCTTAAAATCAATGACATCAAAACTGACACTACCAATGCTCAAAGGTAAGAGTGTCGTTAACCTAGATCACTTGCTATCTTACAAACCAAAGCAAGTAGACTTGTCAAATGCTAGAGCCACTCACGAACAATTCCAAAACTGGTATGATGGCGTTATGGCAAGTTAAT

[0121] SEQ ID NO: 16

[0122] TTGGCTGTGCTGAAGAAGGATGCAGAAACACTACGAAGGGTGTGTAGGCT

[0123] GTACGCCCCGGTGACATGGAATCATATGCTGACGCACAACACGCCTCCAGC

[0124] CGACTGGGCTGCCATGGGGTTCCAGTACGAGGATCGCTTCGCTGCTTTCGA

[0125] CTGCTTTGATTACGTTGAAAACGCTGCTGCAGTCCAACCCCTAGAGGGATTG

[0126] ATCAGGCGACCCACCCCAAGGGAAAAGATTGCTCACAATACGCACAAAGA

[0127] CATCGCGCTGCGCGGAGCAAACCGCAATCAGGTGTTCAGCTCTCTCAATGC

[0128] CGAGGTCACTGG

[0129] SEQ ID NO:17

[0130] TCGTTCCACTTACGCTCGTAAGCGGAGGGCCCGCAGCATTGGGCGTTGCTG

[0131] GCGATGTTATCGTGTCTATCCACCTATTTGTAATTCTAAGTGTGATAATAGAA

[0132] CATGCCG

[0133] SEQ ID NO:18

[0134] CCGTATCAGGCACCAGAACTCAGCCTTGAGCCTCACTTCTACTTGGAGACTT

[0135] CTTTCCGTACTCCAAGAAAGGTAGCTGCCCTGATAGCGAGTTGCGGGTTTG

[0136] ACTTTGAAACCAATTCACAAGAGGAGGGCCACTTGGAAGTGACTGGAATCT

[0137] TCAAAGGGCCTCTGCTGGGTAAGGTGATCGCCATAGACTCCGAGTCCGAGG

[0138] AGACTTTGTCTAGACACGGCGTGGAGTTTGTGAGGCCTTGCCAAGTGACTG

[0139] GATTGGAATTCCCAGTGGTCACAATTGTTTCAGCTGCACCCATCGAGGAGAT

[0140] CGGCCAAGCCACCTTGTTCTACAACGCAATCACAAGGTC

[0141] SEQ ID NO: 19

[0142] AGCAAGGTAGCATCCAGTCAAACCCGAACAAAGGAAAAGATAAGGATGTGAATGCTGGCACATCTGGGACACATACTGTGCCGAGAATCAAGGCTATCACGTCCAAAATGAGAATGCCCAAAAGCAAGGGAGCAACCGTGCTAAACTTAGAACACTTGCTTGAGTATGCTCCACAACAAATTGATATTTCAAATACTCGGGCAACTCAATCACAGTTTGATACGTGGTATGAGGCAGTGCGGATGGCATACGACATAGGAGAAACTGAGATGCCAACTGTGATG

[0143] SEQ ID NO: 20

[0144] CGCCGCTCAAGAAGAACTGGAGTTCCCCGAGGACGCAGCTCAAGCGAGAC

[0145] ATTCGTGTTTACAAAGGACAACCTCGTGGGCAACTCCCAAGGAAGTTTCAC

[0146] CTCCGGGCCGAGTCTATCAGACTGTCCGGCATTCAAGGATGGAATACTCAA

[0147] GGCCTACCATGAGTATAAGATCACAAGCATCTTACTTCAGTTCGTCAGCG

[0148] In contrast, the detection primers for PVS and PVX in the control primers are only applicable to ordinary RT-PCR, and false negative results will occur when used for TC-RT-PCR.

[0149] Finally, it should be noted that the above description is only the preferred embodiment of the present invention. Those skilled in the art, under the inspiration of the present invention and without violating the purpose and claims of the present invention, can make various similar representations, and such transformations all fall within the protection scope of the present invention.

Claims

1. A primer set for simultaneously detecting multiple potato viruses, characterized in that, Comprising the primer pairs shown below: Primer pair C-PVA: Comprising a forward primer and a reverse primer with nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively; Primer pair C-PVM: Comprising a forward primer and a reverse primer with nucleotide sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4 respectively; Primer pair C-PVS: Comprising a forward primer and a reverse primer with nucleotide sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6 respectively; Primer pair C-PVX: Comprising a forward primer and a reverse primer with nucleotide sequences shown in SEQ ID NO: 7 and SEQ ID NO: 8 respectively; Primer pair C-PVY: Comprising a forward primer and a reverse primer with nucleotide sequences shown in SEQ ID NO: 9 and SEQ ID NO: 10 respectively; Primer pair C-PLRV: Comprising a forward primer and a reverse primer with nucleotide sequences shown in SEQ ID NO: 11 and SEQ ID NO: 12 respectively; Primer pair D-PLRV: Comprising a forward primer and a reverse primer with nucleotide sequences shown in SEQ ID NO: 13 and SEQ ID NO: 14 respectively.

2. Use of the primer set according to claim 1 in the preparation of potato virus detection and / or diagnostic products.

3. The application according to claim 2, characterized in that, Including for nucleic acid hybridization detection, molecular markers, preparation of gene chips, preparation of molecular probes, preparation of detection kits.

4. The application according to claim 2, characterized in that, The potato virus includes one or more of PLRV, PVM, PVA, PVS, PVX and PVY.

5. A kit, characterized in that, Including the primer set according to claim 1.

6. Use of the kit according to claim 5 in any one of the following 1)-3): 1) Identifying or assisting in identifying potato viruses; 2) Preparing for identifying or assisting in identifying whether a test sample contains potato viruses; 3) Potato breeding.

7. A method for detecting multiple potato viruses, characterized in that, Performing detection using the primer set according to claim 1 or the kit according to claim 5.

8. The method according to claim 7, wherein Extracting the RNA of the test sample, after reverse transcription, performing triple PCR amplification using primer pair C-PVM, primer pair D-PLRV and an internal reference primer, performing quadruple PCR amplification using primer pair C-PVA, primer pair C-PVS, primer pair C-PVX and primer pair C-PVY, and judging the presence or absence of the virus according to the band size of the PCR product.

9. The method according to claim 7, wherein After the test sample is ground and coated, adding the reverse primer of the detection primer pair for reverse transcription, and then adding the forward primer of the detection primer pair for PCR amplification, and judging the presence or absence of the virus according to the band size of the PCR product; The detection primer pair is selected from any one of primer pair C-PVM, primer pair D-PLRV, primer pair C-PVA, primer pair C-PVS, primer pair C-PVX and primer pair C-PVY.

10. The method according to any one of claims 7-9, characterized in that Determining whether the PCR product includes the DNA fragments shown in (a)-(g): (a) The nucleotide sequence shown in SEQ ID NO: 15; (b) The nucleotide sequence shown in SEQ ID NO: 16; (c) The nucleotide sequence shown in SEQ ID NO: 17; (d) The nucleotide sequence shown in SEQ ID NO: 18; (e) The nucleotide sequence shown in SEQ ID NO: 19; (f) The nucleotide sequence shown in SEQ ID NO: 20 (g) The nucleotide sequence shown in SEQ ID NO: 21.

Images