Application of enrofloxacin in preparation of medicine for preventing and / or treating bovine nodular dermatosis

Enrofloxacin is used to prepare drugs for preventing and treating bovine nodular skin diseases. It solves the problem of lack of effective drugs in the prior art by inhibiting viral replication, and achieves a safe and effective viral inhibitory effect.

CN120361003APending Publication Date: 2025-07-25NANJING AGRICULTURAL UNIVERSITY +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510415447.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-03
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

The prior art lacks effective drugs for the prevention and treatment of bovine nodular skin diseases, and there are side effects and risk of recombination for attenuated vaccination.

Method used

Enrofloxacin, as a monomeric compound, is used to prepare drugs for preventing and treating bovine nodular dermatosis at a concentration of 100 μM and has the effect of inhibiting the replication of bovine nodular dermatosis. The drug forms include tablets, capsules, oral liquids, granules or injections, and the carriers can include excipients, fillers, binders, etc.

Benefits of technology

Enrofloxacin dose-dependently inhibits viral replication of bovine nodular dermatosis in a safe concentration range, has significant antiviral activity, and selective indexes greater than 23.09 and 12.64, showing good safety range and therapeutic effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120361003A_ABST
    Figure CN120361003A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of veterinary drugs, particularly relates to application of enrofloxacin in preparation of drugs for preventing and / or treating bovine nodular skin diseases, and finds that enrofloxacin can inhibit bovine nodular skin disease virus proliferation and can be used for treating diseases caused by bovine nodular skin disease virus infection for the first time. The enrofloxacin can inhibit bovine nodular skin disease virus replication in a dose-dependent manner in a safe concentration range, and has remarkable antiviral activity. Therefore, the enrofloxacin has a good prospect in preparation of the anti-bovine nodular skin disease virus medicine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of veterinary drugs, and specifically relates to a new use of a class of monomeric compounds, and in particular to the use of enrofloxacin in the preparation of a drug for preventing and / or treating bovine nodular dermatosis. Background Art

[0002] Lumpy skin disease (LSD) is a subacute to acute infectious disease characterized by nodular lesions on the skin of cattle caused by the Lumpyskin disease virus (LSDV). LSDV belongs to the Poxviridae family ( Poxviridae ), Goatpoxvirus ( Capripoxvirus ). The mortality rate of cattle infected with LSDV is about 10%, and the morbidity rate is about 90%. The diseased cattle show symptoms such as fever, weight loss, decreased milk production, and nodules all over the body, which seriously restricts the economic benefits of cattle breeding. The existing technology mainly adopts a strategy and measure of combining emergency immunization with attenuated vaccines and isolation and culling to prevent and control LSD. Although the current vaccination has a good protective effect, clinical results show that attenuated vaccination has certain side effects, and more and more studies have shown that the use of live attenuated vaccines has the risk of strain recombination. There is currently no effective drug for the treatment of LSDV. In the case of defects in vaccine immunity, there is an urgent need to develop drugs that can effectively prevent or treat LSD as a technical reserve. Summary of the Invention

[0003] In response to the deficiencies of the prior art, the present invention provides the use of enrofloxacin in the preparation of a medicament for preventing and / or treating bovine nodular dermatitis, thereby hopefully providing a new antiviral drug for the prevention and treatment of LSD.

[0004] The technical solution provided by the present invention is as follows:

[0005] The present invention provides use of enrofloxacin in preparing a medicament for preventing and / or treating bovine lumpy skin disease, wherein the bovine lumpy skin disease is a disease caused by bovine lumpy skin disease virus.

[0006] Furthermore, the drug is a drug that inhibits the replication stage of bovine lumpy dermatitis virus.

[0007] Furthermore, the enrofloxacin is the sole active ingredient or one of the active ingredients of a drug for preventing and / or treating bovine nodular dermatitis.

[0008] Furthermore, the enrofloxacin is used in the drug at a concentration of 100 μM.

[0009] The present invention also provides the use of enrofloxacin in preparing medicines for resisting bovine lumpy skin disease virus.

[0010] The present invention also provides the use of enrofloxacin in preparing a drug for inhibiting the replication stage of bovine lumpy dermatitis virus.

[0011] The present invention also provides a medicine for treating bovine nodular dermatosis, wherein the medicine contains an effective amount of the above-mentioned enrofloxacin as an active ingredient.

[0012] Furthermore, the drug also includes one or more pharmaceutically acceptable carriers.

[0013] Furthermore, the pharmaceutically acceptable carrier includes: an excipient, a filler, a binder, a wetting agent, a disintegrant, a diluent and / or a surfactant.

[0014] Furthermore, the dosage form of the drug is any one or more of tablets, capsules, oral liquids, granules, pills or injections.

[0015] Beneficial effects

[0016] This study demonstrates for the first time that enrofloxacin can inhibit the proliferation of bovine lumpy skin disease virus (LSDV) and is therefore useful for treating diseases caused by BLVD. The selectivity index (SI) of enrofloxacin for LSDV in MDBK and Vero cell lines was greater than 23.09 and 12.64, respectively, indicating that enrofloxacin has a wide safety margin for inhibiting LSDV proliferation. Furthermore, within this safe concentration range, enrofloxacin exhibits dose-dependent inhibition of BLVD replication. Therefore, enrofloxacin has promising potential for the development of anti-BLVD drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 is a schematic diagram of the chemical structure of enrofloxacin;

[0018] Figure 2 This is the activity curve and cytotoxicity curve of enrofloxacin in inhibiting LSDV proliferation;

[0019] Figure 3 is the fluorescence image of different concentrations of enrofloxacin inhibiting the proliferation of rLSDV in MDBK;

[0020] Figure 4 is the fluorescence graph of different concentrations of enrofloxacin inhibiting the proliferation of rLSDV in Vero;

[0021] Figure 5 It is through TCID 50 Detect the inhibitory effect of enrofloxacin on LSDV (Note: the concentration of enrofloxacin used is 100 μM);

[0022] Figure 6 The inhibitory effect of enrofloxacin on LSDV was detected by qPCR (Note: the concentration of enrofloxacin used was 100 μM);

[0023] Figure 7 The inhibitory effect of enrofloxacin on LSDV at different MOIs was detected by Western blot (Note: the concentration of enrofloxacin was 100 μM);

[0024] Figure 8 It is a diagram of the Time of addition experimental design pattern;

[0025] Figure 9 mCherry is used to reflect the inhibitory effect of enrofloxacin on rLSDV at different stages (Note: the concentration of enrofloxacin used is 100 μM);

[0026] Figure 10 Luciferase was used to analyze the inhibitory effect of enrofloxacin on rLSDV at different stages (Note: the concentration of enrofloxacin used was 100 μM). DETAILED DESCRIPTION

[0027] The present invention provides an embodiment of the use of enrofloxacin in the preparation of a medicament for preventing and / or treating bovine nodular dermatosis. It should be noted that enrofloxacin is a monomeric compound. CAS No.: 93106-60-6; ​​Chemical Formula: C 19 H 22 FN3O3; its chemical structure is as follows Figure 1 shown.

[0028] Example 1

[0029] 1. Experimental Materials and Methods

[0030] 1.1 Experimental Materials

[0031] Enrofloxacin was purchased from MCE. RIPA protein lysis buffer was purchased from Yuanye. DNA extraction kit, CCK-8 kit, reverse transcription reagent, and SYBR Green Master Mix were purchased from YEASEN. β-Tublin mouse monoclonal antibody, HRP-labeled goat anti-rabbit secondary antibody, and HRP-labeled goat anti-mouse secondary antibody were purchased from Yazyme. Trypsin was purchased from Solebo. MDBK, Vero cell line, fetal bovine serum, and DMEM were purchased from Nanjing Senbeijia. LSDV rabbit polyclonal antibody was prepared and stored in our laboratory. The preparation method of LSDV rabbit polyclonal antibody is as follows:

[0032] LSDV virus was mixed with Freund's complete adjuvant in a ratio of 1:1 and emulsified as an immunogen.6.2 TCID 50 New Zealand white rabbits were immunized with a dose of 1.5 mg / kg subcutaneously at multiple sites; subsequent booster immunizations were conducted with the same dose of Freund's incomplete adjuvant every 14 days for a total of three immunizations; sera were collected 14 days after the third immunization and stored at -20°C.

[0033] The LSDV XJ201901 strain was isolated, identified, and deposited by the China Animal Health and Epidemiology Center. Its NCBI GeneBank accession number is OM984485. The specific method for preparing the recombinant rLSDV strain carrying the mCherry and Luciferase expression cassettes is as follows:

[0034] ORF50 and ORF51 of LSDV are two adjacent proteins. Literature reports suggest that inserting a foreign gene between the genes encoding these two proteins does not affect viral replication. Therefore, we used this region as the insertion site for the mCherry and firefly luciferase reporter genes (luciferase). First, a donor plasmid carrying mCherry and luciferase was constructed. To construct the recombinant virus, the MDBK cell line was infected with the LSDV XJ201901 strain. Six hours later, the donor plasmid was transfected into the MDBK cell line. At this point, the viral DNA is recombined by homologous recombinases within the cells based on the homologous sequences in the donor plasmid, recombining the DNA fragments corresponding to the donor plasmid into the ORF50 and ORF51 gene locations in the viral genome. The red fluorescent recombinant strain was then purified through three rounds of plaque assays, ultimately obtaining an rLSDV strain expressing both mCherry and luciferase for subsequent experiments. The donor plasmid sequence is as follows:

[0035]

[0036] 1.2 Drug CC 50 Detection

[0037] 2 × 10 4 MDBK or Vero cell suspension (100 μL / well). Pre-incubate the culture plate in an incubator for 24 hours (37°C, 5% CO2). Make a three-fold serial dilution of the drug in cell maintenance medium, resulting in eight dilutions (maximum drug concentration is 100 μM). Treat the cells with each diluted drug solution for 72 hours. An equal volume of DMSO control group was established for each concentration. Add 10 μL of CCK-8 solution to each well, avoiding the formation of bubbles. Incubate the culture plate in the incubator for 2 hours. Measure the absorbance at 450 nm using a microplate reader. Calculate cell viability using the following formula: Cell viability = [OD (drug-treated group) - OD (blank group)] / [OD (control group) - OD (blank group)] × 100%. Experimental group: OD values ​​of wells containing cells, CCK-8 solution, and drug solution. Blank group: OD values ​​of wells containing maintenance medium and CCK-8 solution but no cells. Control group: OD values ​​of wells with cells, CCK-8 solution and DMSO solution. Finally, GraphPad was used to plot the CC values ​​of drugs. 50 curve.

[0038] 1.3 Drug IC 50 Detection

[0039] 2 × 10 4 MDBK or Vero cell suspension (100 μL / well). Place the culture plate in an incubator and culture for 20 h. Make a 3-fold serial dilution of the drug in the cell maintenance medium to obtain a total of 8 dilutions (maximum drug concentration is 100 μM). Take 30 μL of the drug dilution solution and add 0.01 multiplicity of infection (MOI) (200 TCID 50 MOI = TCID at the time of exposure 50 A drug-virus mixture was prepared by adding 1 μL of rLSDV virus solution (100 μL / cell volume) to the wells. The mixture was incubated at 37°C for 30 minutes. The cell culture medium was then discarded, and 30 μL of the incubated drug-virus mixture was added and incubated at 37°C for 2 hours. The mixture was then discarded, the cells were carefully washed once with PBS, and 200 μL of the drug dilution was added to the wells. The cells were cultured for an additional 72 hours. A control group with an equal volume of DMSO and an untreated blank group were also established. Cell luminescence was recorded under a fluorescence microscope.

[0040] Then, aspirate the cell culture medium and add 100 μL of cell lysis buffer to each well. Incubate on ice for 5 minutes to fully lyse the cells. Transfer 20 μL of lysate to a black microtiter plate. Dilute the firefly luciferase substrate (50×) and the Renilla luciferase substrate (50×) to a 1× working solution using the corresponding buffer. Incubate the plates at room temperature. Add 100 μL of the firefly luciferase reaction solution to each well, shake the plate to mix thoroughly, and immediately measure the firefly luciferase activity (complete within 30 minutes). Calculate the data using the following formula: Inhibition rate (%) = 1 - (experimental group value / control group value) × 100. Where: blank group: untreated cells from the same batch as the experimental group. Experimental group: cells treated with a mixture of drug and virus. Control group: cells treated with a mixture of DMSO and virus. Experimental group value = experimental group reading - blank group reading. Control group value = control group reading - blank group reading. Finally, GraphPad was used to plot the IC of the drug. 50 curve.

[0041] 1.4 Western blot experiment

[0042] 1 × 10 5 MDBK or Vero cell suspension (500 μL / well). The culture plate was placed in an incubator and cultured for 20 h. The cell culture medium was then discarded and 200 μL of 0.01 MOI (1000 TCID 50 ) and 0.1 MOI (10,000 TCID 50Incubate the LSDV-drug maintenance solution at 37°C for 2 h. Discard the liquid, carefully wash the wells once with PBS, and add 1000 μL of the drug-containing maintenance solution to the wells. Incubate the cells for an additional 72 h. Discard the cell culture medium from the dish, wash the cells twice with pre-chilled 1× PBS, add RIPA lysis buffer, and lyse the cells on ice for 10 min. Transfer the lysate mixture to a 1.5 mL EP tube and centrifuge at 12,000 g for 10 min at 4°C. Remove 80 μL of the supernatant and add 20 μL of 5× Loading Buffer. Mix thoroughly, heat at 95°C for 5 min, and centrifuge briefly before loading the sample for analysis. Load an equal volume of the sample to be tested onto a PAGE gel and perform SDS-PAGE electrophoresis at a constant voltage of 80 V. Once bromophenol blue has migrated to the bottom of the gel, transfer the sample using a semi-dry transfer device, soaking the transfer filter paper with pre-chilled transfer buffer. Place the following filter paper, NC membrane, gel, and filter paper in the order from bottom to top, taking care to remove any bubbles. The procedure was: constant current 0.3 A, voltage limit 25 V, time 33 min. Block with 5% skim milk in TBST for 2 h at room temperature. Wash with TBST three times for 5 min each at room temperature. Incubate with rabbit anti-LSDV polyclonal antibody and mouse anti-β-tubulin monoclonal antibody at 4°C for 12 h. Wash with TBST three times for 5 min each. Incubate with the corresponding HRP-conjugated goat anti-rabbit and goat anti-mouse secondary antibodies at room temperature for 1 h. Wash with TBST three times for 5 min each. Finally, treat with ECL solution and expose in an imaging device.

[0043] 1.5 qPCR experiments

[0044] Sample preparation: 1 × 10 5 MDBK cell suspension (500 μL / well). The culture plate was placed in an incubator and cultured for 20 h. The cell culture medium was then discarded and 200 μL of 0.01 MOI (1000 TCID 50 ) LSDV and drug maintenance solution were incubated at 37°C for 2 h, then the liquid was discarded and the wells were carefully washed once with PBS. 1000 μL of drug-containing maintenance solution was added to the wells, and the cells were cultured for another 72 h.

[0045] DNA Extraction: Add 10 µL of Proteinase K to 400 µL of Lysis Buffer LB and mix to obtain DNA lysis buffer. Discard the cell culture supernatant and wash twice with PBS. Discard the PBS and add 410 µL of DNA Lysis Buffer. Let stand for 30 seconds. Pipette up and down 20 times and transfer the cell lysate to a 1.5 Eppendorf tube. Incubate at 55°C for 10 minutes, vortex to mix thoroughly, and then let stand at room temperature for 5 minutes. Remove the Eppendorf tube, cool to room temperature, and gently vortex to mix thoroughly. Add 300 µL of Deproteinization Buffer PL and 300 µL of Binding Buffer BD, sequentially, and shake vigorously to mix thoroughly. Centrifuge at 12,000 rpm for 5 minutes. Separate the layers into a blue extract layer and a clear aqueous phase. There may be a precipitate between the two layers; the DNA is in the lower aqueous phase. Carefully aspirate the lower layer for column purification. Place DNA Adsorption Column T1 in a 2 mL collection tube and set aside. Add 200 μL of Buffer AC to DNA adsorption column T1, centrifuge at 12,000 rpm for 1 minute, and discard the waste solution. Add the lower layer of the sample pretreatment solution to DNA adsorption column T1, centrifuge at 12,000 rpm for 1 minute, and discard the waste solution. Return DNA adsorption column T1 to the collection tube, add 500 μL of Wash Buffer W (add anhydrous ethanol according to the instructions before use), centrifuge at 12,000 rpm for 30 seconds, and discard the waste solution. Repeat the wash with Wash Buffer W. Return DNA adsorption column T1 to the collection tube and centrifuge the empty column at 12,000 rpm for 2 minutes at room temperature to remove any residual Wash Buffer W. Place DNA adsorption column T1 in a new 1.5 mL centrifuge tube, add 25 μL of 65°C preheated elution buffer to the center of the column, and let it stand at room temperature for 2 minutes. Then centrifuge at 12,000 rpm for 1 minute. Collect the filtrate. Add 25 µL of fresh elution buffer preheated at 65°C and repeat the elution once to obtain a total of approximately 50 µL of DNA solution. Determine the concentration of the DNA solution using a Nanodrop analyzer and store at -20°C until needed. Design primers targeting LSDV ORF72: F: AGGGTGATGGGAAGGGTGTT, R: ACTTGCCCGTATCCATCCAC. Prepare the qPCR reaction system using the amounts in Table 1 and analyze the gene abundance in the samples according to the protocol in Table 2.

[0046] Table 1: qPCR system

[0047]

[0048] Table 2: qPCR program

[0049]

[0050] 1.6 TCID 50 experiment

[0051] Sample preparation is the same as for qPCR. 50 Assay: 2 × 10 cells were seeded in a 96-well plate using growth medium. 4 Prepare an MDBK cell suspension (100 μL / well). Incubate the culture plate in an incubator for 24 hours (37°C, 5% CO2). Dilute the virus solution in a 10-fold serial dilution using maintenance medium (DMEM containing 2% FBS). Dilute each dilution in 8 replicate wells. Add 100 μL of the diluted virus solution to each well and maintain the cells for 5 days. Observe the plate under a microscope and count the number of wells with pathological changes. Calculate the TCID of the virus solution using the Reed-Muench method. 50 .

[0052] 1.7 Time of addition experiment ( Figure 8 )

[0053] The process of viral infection of host cells can be divided into the following chronological stages: the stage before virus-cell contact; the stage during which the virus binds to host receptors and adsorbs to the host cell surface; the stage during which the virus enters the cell through endocytosis and other means; and the stage during which the virus replicates after entering the cell. To determine at which stage during LSDV infection of MDBK cells does a drug exert its antiviral effect, this example treated MDBK cells or viruses with drugs during rLSDV infection of MDBK cells, and assessed the level of viral replication using the virally expressed mCherry and Luciferase proteins. Figure 8 The time of addition experiment design pattern provided in the embodiment of the present invention has the following steps:

[0054] 2 × 10 4 MDBK cell suspension (100 μL / well). Culture plates were placed in an incubator for 24 hours. Four experimental groups were set up based on the duration of drug treatment.

[0055] Group 1 (neutralization stage): To determine whether the drug has a neutralizing effect on the virus before contact with the cells, the drug was diluted into a 2× drug concentration working solution using the maintenance solution, and 50 μL of the 2× drug concentration working solution was mixed with an equal volume of 200 TCID 50 rLSDV was mixed to obtain 200 TCID 50 A 1× drug concentration working solution of rLSDV was prepared and neutralized at 37°C for 1 h. The incubated liquid was then inoculated into the cells and incubated with MDBK cells for 2 h. The liquid was discarded and the cells were washed twice with 1× PBS. After discarding the liquid, 200 μL of maintenance solution was added and the culture was continued for 72 h.

[0056] Group 2 (blocking phase): To determine whether the drug has a competitive binding effect on host cell receptors during virus adsorption to cells, the drug was diluted with maintenance solution to a 1× drug concentration working solution. 100 μL of the 1× drug concentration working solution was added to the cells and incubated at 37°C for 1 h. The liquid was discarded and the cells were washed twice with 1× PBS. After the liquid was discarded, 200 TCID 50 100 μL of rLSDV was added and incubated with MDBK cells for 2 h. The liquid was discarded and the cells were washed twice with 1× PBS. After the liquid was discarded, 200 μL of maintenance solution was added and the cells were cultured for another 72 h.

[0057] Group 3 (cytosolic stage): To determine whether the drug has the effect of preventing virus entry, the drug was diluted into a 2× drug concentration working solution using maintenance solution, and 50 μL of 2× drug concentration working solution was mixed with an equal volume of 200 TCID 50 rLSDV was mixed to obtain 200 TCID 50 100 μL of the 1× drug concentration working solution of rLSDV was inoculated into MDBK cells and incubated with the MDBK cells for 2 h. The liquid was discarded and the cells were washed twice with 1× PBS. After discarding the liquid, 200 μL of maintenance solution was added and the cells were cultured for another 72 h.

[0058] Group 4 (replication stage): To determine whether the drug has the effect of preventing viral replication after the virus enters the host cell, the drug was diluted into a 1× drug concentration working solution using the maintenance solution. After discarding the liquid, a solution containing 200 TCID 50 100 μL of rLSDV was incubated with MDBK cells for 2 h, the liquid was discarded, and the cells were washed twice with 1× PBS. After discarding the liquid, 200 μL of the working solution of the test drug at 1× drug concentration was added and the cells were incubated at 37°C for another 72 h.

[0059] DMSO was used as a control group for all four groups. At 72 hpi, samples were collected and tested to detect the Luciferase activity produced by the virus. Figure 9 and Figure 10 As shown, both the Luciferase activity detection results and the mCherry fluorescence images showed that enrofloxacin mainly exerted its inhibitory effect at the LSDV replication stage.

[0060] 2. Experimental results

[0061] 2.1 Drug CC 50 Determination

[0062] In order to evaluate the cytotoxicity of drugs in vitro, we treated MDBK and Vero cells with different concentrations of drugs, measured the cell activity by CCK-8, and drew the cytotoxicity curve of the drugs. Figure 2 As shown, the CC of enrofloxacin on MDBK cell line and Vero cell line 50 All were greater than 100 μM.

[0063] 2.2 Drug IC 50 Determination

[0064] To evaluate the antiviral activity of the drug in vitro, we treated MDBK and Vero cells with different concentrations of the drug during rLSDV infection, and marked the distribution of the virus in the cells with the mCherry protein expressed by the virus. The curve of the drug's inhibition of LSDV replication in the two cell types was drawn by detecting the activity of Luciferase expressed by the virus. Figure 2 As shown, the IC of enrofloxacin in MDBK cell line 50 The IC of enrofloxacin in Vero cell line is 4.33 μM. 50 is 7.91 μM.

[0065] The Selectivity Index (SI) is an important indicator for evaluating the efficacy and safety of drugs. SI is defined as the CC 50 With IC 50 The ratio of SI = CC 50 / IC 50 SI can help us understand at what concentration a drug can effectively inhibit pathogens while having minimal toxicity to host cells. Generally, a selectivity index greater than 1.00 indicates efficacy, and a larger selectivity index indicates a wider safety range for the drug. 50 With IC 50 The ratio calculation results showed that the selection index of enrofloxacin in MDBK cell line was greater than 23.09, and the selection index of enrofloxacin in Vero cell line was greater than 12.64; this indicates that enrofloxacin has a large safety range in inhibiting LSDV proliferation.

[0066] like Figure 3 、 Figure 4 As shown, the higher the concentration of enrofloxacin used in MDBK and Vero, the lower the protein expression level of mCherry of rLSDV, which indicates that the effect of enrofloxacin in inhibiting the proliferation of rLSDV in MDBK and Vero is dose-dependent with the drug concentration.

[0067] 2.3 TCID 50 Verify drug effectiveness

[0068] To evaluate the antiviral activity of the drug in vitro, we treated MDBK cells with 100 μM enrofloxacin during infection of MDBK cells with LSDV XJ wild-type virus. The TCID 50 The inhibitory effect of the drug on LSDV was evaluated. Figure 5 As shown, the TCID of virus in the two cell lines after enrofloxacin treatment 50 The content was significantly reduced (analyzed by independent sample t test, P <0.01).

[0069] 2.4 qPCR verification of drug efficacy

[0070] To evaluate the antiviral activity of the drug in vitro, we treated MDBK and Vero cells with 100 μM of the drug during infection with the wild-type LSDVXJ virus. The inhibitory effect of the drug on LSDV was evaluated by measuring the relative content of the LSDV gene in the cell samples. Figure 6 As shown in Figure 2, after enrofloxacin treatment of the two cell lines, the relative expression of the viral ORF72 gene in the cells was significantly reduced (analyzed by the independent sample t test, P <0.01).

[0071] 2.5 Western Blot Analysis of Drug Efficacy

[0072] To evaluate the antiviral activity of the drug in vitro, we infected MDBK and Vero cells with 0.01 MOI and 0.1 MOI of LSDV, treated the cells with 100 μM enrofloxacin, and collected whole cell lysates at 72 hpi for Western blot. Figure 7 As shown in the figure, enrofloxacin has a good inhibitory effect on LSDV infection of MDBK and Vero cell lines at different MOIs.

[0073] 2.6 Time of addition experiment

[0074] To determine at which stage of LSDV infection in MDBK cells the drug exerts its antiviral effect, we treated MDBK cells with 100 μM of the drug during rLSDV infection and evaluated the viral replication level by expressing mCherry and Luciferase proteins. Figure 9 and Figure 10 As shown in Figure 2, enrofloxacin significantly inhibited LSDV replication mainly in the replication phase (analyzed by independent sample t-test, P <0.01).

Claims

1. Use of enrofloxacin in the preparation of a medicament for preventing and / or treating lumpy skin disease in cattle, characterized in that, The bovine nodular dermatitis is a disease caused by the bovine nodular dermatitis virus.

2. The application according to claim 1, characterized in that The drug is a drug that inhibits the replication stage of the bovine nodular dermatitis virus.

3. The application according to claim 1, characterized in that, The enrofloxacin is the sole active ingredient or one of the active ingredients of the drug for the prevention and / or treatment of bovine nodular dermatitis.

4. The application according to claim 1, characterized in that The use concentration of the enrofloxacin in the drug is 100 μM.

5. Application of enrofloxacin in the preparation of a drug for inhibiting the gene replication stage of the bovine nodular dermatitis virus.

6. Application of enrofloxacin in the preparation of a drug against the bovine nodular dermatitis virus.

7. A drug for treating bovine nodular dermatitis, characterized in that, The drug uses the enrofloxacin described in claim 1 in an effective amount as the active ingredient.

8. The drug for treating lumpy skin disease of cattle according to claim 7, characterized in that, The drug further comprises one or more pharmaceutically acceptable carriers.

9. The drug for treating lumpy skin disease of cattle according to claim 7, characterized in that, The pharmaceutically acceptable carriers include: excipients, fillers, binders, wetting agents, disintegrants, diluents, and / or surfactants.

10. The drug for treating lumpy skin disease of cattle according to any one of claims 7-9, characterized in that, The dosage form of the drug is any one or more of tablets, capsules, oral liquids, granules, pills, or injections.

Citation Information

Patent Citations

  • Medicinal composition for treating cow mastitis and preparation method and application thereof

    CN103977006A

  • Application of salvianolic acid A in preparation of anti-bovine nodular skin disease virus drugs

    CN118286196A

  • Application of enrofloxacin in the preparation of antibacterial agents for drug-resistant bacteria and in the preparation of drugs for treating tuberculosis

    CN119732954A

  • veterinary BIOLOGICAL PRODUCT, METHOD OF ITS PRODUCTION (OPTIONS) AND METHOD FOR TREATMENT OF LODULAR DERMATITIS OF CATTLE (OPTIONS)

    EA201600661A1