5 'UTR for enhancing mRNA expression and application thereof

Abstract

The invention provides a 5 'UTR (untranslated region) for enhancing mRNA (messenger ribonucleic acid) expression and application thereof. The invention firstly provides a nucleic acid molecule, wherein the nucleic acid molecule is selected from one or more of nucleic acid molecules as shown in any one of SEQ ID NO: 1-9. The invention also provides a nucleic acid construct, a recombinant vector, a host cell, mRNA and a transfected mRNA cell prepared by using any sequence of SEQ ID NO.1-9 as the 5 'UTR, and related applications. The nucleic acid molecule as the 5' UTR can improve the expression level of mRNA, and has excellent prospects in nucleic acid treatment drugs or mRNA vaccines.

Description

Technical Field

[0001] The present invention relates to the field of nucleic acid technology, and specifically, to a 5' UTR for enhancing mRNA expression and its application. Background Art

[0002] As an emerging vaccine technology, mRNA vaccines have the advantages of good immunogenicity, no need for adjuvants, and a relatively short R & D cycle compared with traditional vaccines. The mRNA vaccines produced and sold by Moderna (mRNA-1273) and Pfizer (BNT162b2) have been proven to be one of the most effective vaccines against the novel coronavirus, greatly promoting the rapid development of nucleic acid drugs represented by mRNA. In fact, the application scope of mRNA therapy is not limited to infectious disease vaccines, but also includes cancer immunotherapy, regenerative medicine, protein replacement therapy, etc. At present, for the R & D of most mRNA vaccines, the main obstacle is to achieve the rapid development and optimization of vaccines.

[0003] mRNA therapy generally uses a typical linear mRNA sequence as the vector for exerting efficacy, which usually consists of five parts; from 5' to 3' are 5' cap, 5' untranslated region (5' Untranslated Region, 5'UTR), coding sequence (Coding DNA Sequence, CDS), 3' untranslated region (3' Untranslated Region, 3'UTR), and polyadenylate tail (Poly(A)). For a long time, researchers have been constantly developing and optimizing methods around the core issues such as optimizing the expression efficiency, stability, immunogenicity, and targeting of mRNA expressing proteins in eukaryotic cells and / or in vivo, such as chemical modification, introduction of enhancers, codon optimization, UTR sequence screening, Poly(A) sequence screening, and so on.

[0004] At present, it has been reported that some endogenous genes such as HSP70 mRNA 5'UTR, α-globin 5'UTR, CYBA 5'UTR, etc. can improve the translation efficiency of mRNA.

[0005] Since the translation efficiency of mRNA in cells depends to a large extent on the 5'UTR, therefore, selecting a 5'UTR sequence that can enhance the mRNA expression level is the key to improving the yield of target proteins and reducing the unit dose of mRNA administration, and also becomes one of the prerequisites for the R & D of mRNA drug platforms. Providing a 5'UTR sequence for highly efficient mRNA expression is of great significance for the application of mRNA therapy. Summary of the Invention

[0006] The object of the present invention is to provide a 5'UTR sequence that enhances the mRNA expression level and is applied to mRNA drugs. The 5'UTR nucleotide sequence of the present invention is more efficient than the 5'UTR of human α-globin mRNA known in the art.

[0007] On the one hand, the present invention provides a nucleic acid molecule, and the nucleic acid molecule is selected from one or more of the nucleic acid molecules shown in any of SEQ ID NO: 1-9.

[0008] According to a specific embodiment of the present invention, preferably, the nucleic acid molecule is DNA.

[0009] On the other hand, the present invention provides a nucleic acid construct, and the sequence of the nucleic acid construct includes, in sequence from 5'-3': the sequence of the above nucleic acid molecule and the target protein expression gene sequence;

[0010] Preferably, the sequence of the nucleic acid construct further includes one or more of the following sequences:

[0011] Promoter;

[0012] Kozak sequence;

[0013] 3'UTR;

[0014] Poly(A).

[0015] Preferably, the target protein expression gene is selected from the Luc gene, the GFP gene, the IL-7 gene, or a gene expressing an antigen from RSV or SARS-CoV-2.

[0016] In the present invention, the above-mentioned elements can be prepared by conventional methods and then ligated by conventional methods to form the nucleic acid construct of the present invention. If necessary, a digestion reaction can be optionally carried out before the ligation reaction.

[0017] On the other hand, the present invention provides a recombinant vector into which the nucleotide sequence of the above nucleic acid construct is inserted. The vector can be a cloning vector or an expression vector.

[0018] According to a specific embodiment of the present invention, preferably, the promoter can be a T7 promoter.

[0019] On the other hand, the present invention provides a host cell containing the above recombinant vector. Preferably, the host cell is DH5α, BL21, TOP10 or JM109.

[0020] On the other hand, the present invention provides an mRNA which is obtained by constructing a DNA molecule with the above nucleic acid molecule as the 5'UTR and performing in vitro transcription;

[0021] Preferably, the mRNA is unmodified or modified mRNA.

[0022] The modification may be selected from one or more of the following modifications:

[0023] 5' cap structure;

[0024] Poly(A);

[0025] Pseudouridine;

[0026] N1-methyl-pseudouridine;

[0027] N6-methyladenosine;

[0028] 5-methylcytidine.

[0029] On the other hand, the present invention provides a cell transfected with the above mRNA. Preferably, the cell is a 293T cell, an A375 cell, a Hela cell or a THP-1 cell.

[0030] In some specific embodiments of the present invention, the cell is a 293T cell. Compared with the α-globin 5' UTR sequence, the nucleic acid molecules shown in SEQ ID NO.8, SEQ ID NO.7, SEQ ID NO.6, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.1, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.9 provided by the present invention as the insertion of the 5' UTR sequence can make the expression level of Luc luciferase in 293T cells 1.21 - 3.81 times that when the α-globin 5' UTR sequence is inserted.

[0031] In some specific embodiments of the present invention, the cell is an A375 cell. Compared with the α-globin 5' UTR sequence, the nucleic acid molecules shown in SEQ ID NO.8, SEQ ID NO.7, SEQ ID NO.6, SEQ ID NO.3, SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.1, SEQ ID NO.9 provided by the present invention as the insertion of the 5' UTR sequence can make the expression level of Luc luciferase in A375 cells 2.22 - 10.10 times that when the α-globin 5' UTR sequence is inserted.

[0032] In some specific embodiments of the present invention, the cell is a Hela cell. Compared with the α-globin 5'UTR sequence, the nucleic acid molecules shown in SEQ ID NO.8, SEQ ID NO.2, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.4, SEQ ID NO.3, SEQ ID NO.1 provided by the present invention as the insertion of the 5'UTR sequence can make the expression level of Luc luciferase in Hela cells 1.44 - 3.35 times that when the α-globin 5'UTR sequence is inserted.

[0033] In some specific embodiments of the present invention, the cell is a THP-1 cell. Compared with the α-globin 5'UTR sequence, the nucleic acid molecules shown in SEQ ID NO.8, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.1, SEQ ID NO.9 provided by the present invention as the insertion of the 5'UTR sequence can make the expression level of Luc luciferase in THP-1 cells 1.57 - 12.29 times that when the α-globin 5'UTR sequence is inserted.

[0034] In some specific embodiments of the present invention, the cell is a 293T cell. Compared with the α-globin 5'UTR sequence, the nucleic acid molecules shown in SEQ ID NO.9, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.2 provided by the present invention as the insertion of the 5'UTR sequence can make the expression level of IL-7 in 293T cells 1.56 - 2.51 times that when the α-globin 5'UTR sequence is inserted.

[0035] In some specific embodiments of the present invention, the cell is an A375 cell. Compared with the α-globin 5'UTR sequence, the nucleic acid molecules shown in SEQ ID NO.9, SEQ ID NO.8, SEQ ID NO.2 provided by the present invention as the insertion of the 5'UTR sequence can make the expression level of IL-7 in A375 cells 1.48 - 3.00 times that when the α-globin 5'UTR sequence is inserted.

[0036] In some specific embodiments of the present invention, the cell is a Hela cell. Compared with the α-globin 5'UTR sequence, the nucleic acid molecules shown in SEQ ID NO.9, SEQ ID NO.2, SEQ ID NO.5, SEQ ID NO.7, and SEQ ID NO.8 provided by the present invention as the insertion of the 5'UTR sequence can make the expression level of IL-7 in Hela cells 1.29 - 3.50 times that of the expression level when the α-globin 5'UTR sequence is inserted.

[0037] In some specific embodiments of the present invention, the cell is a THP-1 cell. Compared with the α-globin 5'UTR sequence, the nucleic acid molecules shown in SEQ ID NO.9, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.5, SEQ ID NO.2, and SEQ ID NO.6 provided by the present invention as the insertion of the 5'UTR sequence can make the expression level of IL-7 in THP-1 cells 1.20 - 1.76 times that of the expression level when the α-globin 5'UTR sequence is inserted.

[0038] On the other hand, the present invention provides a pharmaceutical composition comprising: the above-mentioned mRNA and a pharmaceutically acceptable excipient.

[0039] On the other hand, the present invention provides the application of the above-mentioned nucleic acid molecule as a 5'UTR, the above-mentioned nucleic acid construct, the above-mentioned recombinant vector, or the above-mentioned host cell in the preparation of mRNA, wherein the mRNA is preferably the above-mentioned mRNA.

[0040] On the other hand, the present invention provides the application of the above-mentioned nucleic acid molecule as a 5'UTR, the above-mentioned nucleic acid construct, the above-mentioned recombinant vector, the above-mentioned host cell, or the above-mentioned mRNA in the preparation of a preparation for enhancing the expression intensity of a target protein, prolonging the expression time of a target protein, and / or enhancing the expression of a target protein.

[0041] On the other hand, the present invention provides the application of the above-mentioned nucleic acid molecule as a 5'UTR, the above-mentioned nucleic acid construct, the above-mentioned recombinant vector, the above-mentioned host cell, or the above-mentioned mRNA in the preparation of a drug for treating immune system diseases or respiratory diseases. Preferably, the drug is a vaccine.

[0042] Term Definition

[0043] In the present invention, unless otherwise specified, the term "nucleic acid molecule" refers to a nucleotide sequence composed of polynucleotides containing purine and pyrimidine bases, where the nucleotides represent the primary structure of the nucleic acid molecule. Here, the term "nucleic acid molecule" includes cDNA, genomic DNA, RNA, synthetic DNA, and hybrid polymers containing two or more of these molecules. In addition, the term "nucleic acid molecule" includes both sense and antisense strands.

[0044] The term "nucleic acid construct" refers to a single-stranded or double-stranded nucleic acid molecule that is isolated from a naturally occurring gene or modified to contain nucleic acid fragments in a manner not found in nature.

[0045] The nucleic acid molecule provided by the present invention has an excellent function of promoting mRNA expression. Compared with the commonly used α-globin 5' UTR sequence, the insertion of the 5' UTR sequence provided by the present invention can increase the expression level of the target protein. The 5' UTR fragment provided by the present invention can play a translation-promoting function in a variety of genes and various types of host cells, showing broad-spectrum action, and demonstrating the application prospect in the preparation of RNA therapeutic drugs or mRNA vaccines. The 5' UTR can be used as an enhancer for the expression of RNA molecules in RNA therapeutic drugs or mRNA vaccines. Brief Description of the Drawings

[0046] Figure 1 It is the map of the vector template in Example 1.

[0047] Figure 2 It is the schematic diagram of the vector structure containing the target mRNA sequence in Examples 1 and 2.

[0048] Figure 3 Showing the relative expression levels of different UTR Luc mRNAs in 293T cells in Example 1.

[0049] Figure 4 Showing the relative expression levels of different UTR Luc mRNAs in A375 cells in Example 1.

[0050] Figure 5 Showing the relative expression levels of different UTR Luc mRNAs in Hela cells in Example 1.

[0051] Figure 6 Showing the relative expression levels of different UTR Luc mRNAs in THP-1 cells in Example 1.

[0052] Figure 7 Showing the relative expression levels of different UTR IL-7 mRNAs in 293T cells in Example 2.

[0053] Figure 8 The relative expression levels of different UTR IL-7 mRNAs in Example 2 in A375 cells are shown.

[0054] Figure 9 The relative expression levels of different UTR IL-7 mRNAs in Example 2 in Hela cells are shown.

[0055] Figure 10 The relative expression levels of different UTR IL-7 mRNAs in Example 2 in THP-1 cells are shown. DETAILED DESCRIPTION

[0056] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention. If no specific conditions are specified in the embodiments, the conditions are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0057] Table 1 Sequences and names involved in Examples 1 and 2

[0058]

[0059]

[0060] Example 1

[0061] In this example, the Luc luciferase gene was used as a reporter gene to explore the regulatory effects of different 5'UTRs (corresponding to SEQ ID NOs: 1-10) including the control group α-globin 5'UTR on the expression of Luc-mRNA in 293T cells, A375 cells, Hela cells, and THP-1 cells. See Table 1 for the specific sequence, and the specific process is as follows:

[0062] 1. Vector Construction

[0063] Primers were designed, each with a different target 5'UTR sequence. The sequence information of each primer is shown in Table 2. The sequences were sent to Sangon Biotechnology for primer synthesis. Figure 1 The vector shown is used as a template, and the sequences on the vector template other than the 5'UTR are reversely amplified by PCR. The PCR reaction system is configured as shown in Table 3:

[0064] Table 2 Primer sequence information

[0065]

[0066] Table 3 PCR reaction system

[0067] Reagent Volume (μL) Forward primer 0.3 Reverse primer 0.3 PCR mix 5 DNA template 0.1 Nuclease-free water Up to 10

[0068] After the samples were mixed evenly, they were placed in a PCR instrument for PCR reaction. The process was as follows: 95°C for 3 min, (95°C for 20 s, 55°C for 20 s, 72°C for 30 s) × 22 cycles, 72°C for 5 min. Then, the PCR products were detected by agarose gel electrophoresis to confirm that the band sizes were correct. The DNA template of the PCR products was digested: 8.8 μL of the PCR products were taken, 1 μL of cutsmart buffer and 0.2 μL of Dpn I (NEB) were added. After the samples were mixed evenly, they were incubated at 37°C for 30 min and 75°C for 20 min. Then, the samples were digested with enzymes: 4 μL of the samples after template digestion were taken, 0.5 μL of buffer4 and 0.5 μL of T5 exonuclease (NEB) were added. After the samples were mixed evenly, they were left standing on an ice-water mixture for 5 min. Subsequently, a transformation experiment was carried out: 50 μL of DH5α competent cells (TransGen Biotech) were added to the enzyme digestion products. After ice-bathing for 30 min, they were heat-shocked at 42°C for 45 s. After adding 700 μL of LB medium, they were shaken and cultured at 37°C at 220 rpm for 1 h. Then, they were spread on a kana-resistant plate and cultured overnight at 37°C. Monoclonal colonies were selected for large-scale culture and plasmid extraction. The correct plasmid was screened by sanger sequencing. The 5' end of the correctly cloned plasmid Luc reporter gene was the 5' UTR sequence (corresponding to SEQ ID NO: 1-10).

[0069] 2. Template Preparation

[0070] Using the plasmid successfully constructed in step 1 as a template, a PCR reaction was configured. The system is shown in Table 4:

[0071] Table 4 Reaction System

[0072] Reagent Volume (μL) Forward primer 3 Reverse primer 3 PCR mix 50 DNA template 1 Nuclease-free water Up to 100

[0073] After the samples were mixed evenly, they were placed in a PCR instrument for PCR reaction. The process was as follows: 95°C for 3 min, (95°C for 20 s, 55°C for 20 s, 72°C for 30 s) × 22 cycles, 72°C for 5 min. Then, the PCR products were detected by agarose gel electrophoresis to confirm that the band sizes were correct. A linear DNA with T7 promoter, the 5' UTR, Luc gene, 3' UTR and polyA sequence from the 5' end to the 3' end was obtained. OMEGA E.Z.N.A. Gel Extraction Kit was used for gel purification. Nanodrop was used for quantitative detection, and its purity was determined to be qualified by agarose gel electrophoresis.

[0074] Among them, the Forward primer sequence in Table 4 is TTGGACCCTCGTACAGAAGCTAATACG (SEQ ID NO.34), and the Reverse primer sequence is TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTTCCTACTCAGGCTTTATTCAAAGACCA (SEQ ID NO.35).

[0075] 3. mRNA Preparation

[0076] Configure the IVT system as shown in Table 5:

[0077] Table 5 IVT System

[0078] Reagent Volume (μL) ATP 7.5 T7 RNA Ploymerase 20 Inorganic Pyrophosphatase 2 Rnase inhibitor 5 CTP 7.5 GTP 7.5 N1-Me-Pseudo UTP 7.5 CAG Trimer 7.5 Buffer(10×) 10 Linear DNA template 5(≥200 ng / μL) Nuclease-free water up to 100

[0079] Place the above system in a 37 °C metal bath and react for 4 h. Add 10 μL of DNase I and react at 37 °C for 30 min to remove DNA in the system. Use the MEGAclear TM Transcription Clean-Up Kit from Thermo Fisher for RNA purification. Perform agarose gel electrophoresis detection and quantify with nanodrop. The schematic diagram of the vector structure containing the target mRNA sequence is as Figure 2 shown, where the reporter gene is the luciferase gene.

[0080] 4. Cell Experiments

[0081] 4.1 Cell Resuscitation

[0082] Prepare complete medium (89% DMEM + 10% FBS + 1% Penicillin-Streptomycin Solution, total volume 500 mL). Take out 293T, A375, Hela, and THP-1 cells and thaw them in a 37 °C water bath. Use a pipette to aspirate the thawed cell suspension into a 15 mL centrifuge tube, add complete medium to a total volume of 10 mL, and centrifuge at 1000 rpm for 5 min to remove the supernatant. Resuspend with an appropriate amount of complete medium and add it to a cell culture flask for cultivation.

[0083] 4.2 Cell Transfection

[0084] Take out the cells in the logarithmic growth phase from the CO2 incubator, rinse them once with 10 mL of PBS, add 2 mL of Trypsin-EDTA for digestion, and add 4 mL of complete medium to terminate the digestion. Transfer the digested cells into a 15 mL centrifuge tube; centrifuge at 1000 rpm for 5 min to remove the supernatant, and add 5 mL of complete medium to resuspend the cells. Take the cell suspension for cell counting, and dilute the cell density to 7×10 4 / mL, inoculate into a 96-well plate, and culture overnight. Prepare the transfection complex: 0.1 μg of mRNA + 12.5 μL of mRNA buffer, vortex and mix well; add 0.2 μL of jetMESSENGER transfection reagent, gently pipette 10 times, and let stand for 15 min. Aspirate the transfection mixture and add it dropwise to the 96-well plate. After 24 h of transfection, lyse the cells for Luc detection.

[0085] 4.3 Luc Detection

[0086] Let the Bright-Lite Luciferase Assay Buffer thaw at room temperature, and mix it with the Bright-Lite Luciferase Assay Substrate. Take out the above-mentioned cell culture plate to be tested and equilibrate it to room temperature. Add the Bright-LiteTM detection reagent with the same volume as the cell culture to be tested. Let it stand at room temperature for at least 2 min to fully lyse the cells for Luc detection.

[0087] The results show that, as Figure 3 shown, in 293T cells, compared with the control sequence α-globin 5’UTR (SEQ ID NO.10), among the 9 tested 5’UTR experimental sequences, the insertion of 7 5’UTR sequences increased the expression level of the Luc luciferase reporter gene by more than 1-fold, which were: UTR5_1 (SEQ ID NO.1) increased by 1.14-fold; UTR5_2 (SEQ ID NO.2) increased by 1.45-fold; UTR5_3 (SEQ ID NO.3) increased by 1.25-fold; UTR5_4 (SEQ ID NO.4) increased by 1.10-fold; UTR5_6 (SEQ ID NO.6) increased by 1.55-fold; UTR5_7 (SEQ ID NO.7) increased by 1.92-fold; UTR5_8 (SEQ ID NO.8) increased by 2.81-fold. There were 2 5’UTR sequences numbered UTR5_5 (SEQ ID NO.5) and UTR5_9 (SEQ ID NO.9), and their insertions increased the expression level of the Luc luciferase reporter gene by 0.96-fold and 0.21-fold, respectively.

[0088] As Figure 4As shown, in A375 cells, compared with the control sequence α-globin 5’UTR (SEQ ID NO.10), among the 9 tested 5’UTR experimental sequences, the insertion of the 5’UTR sequences all increased the expression level of the Luc luciferase reporter gene by more than 1 fold, respectively: UTR5_1 (SEQ ID NO.1) increased by 1.71 fold; UTR5_2 (SEQ ID NO.2) increased by 3.02 fold; UTR5_3 (SEQ ID NO.3) increased by 3.33 fold; UTR5_4 (SEQ ID NO.4) increased by 2.51 fold; UTR5_5 (SEQ IDNO.5) increased by 1.81 fold; UTR5_6 (SEQ ID NO.6) increased by 4.26 fold; UTR5_7 (SEQ ID NO.7) increased by 5.05 fold; UTR5_8 (SEQ ID NO.8) increased by 9.10 fold; UTR5_9 (SEQ ID NO.9) increased by 1.22 fold.

[0089] As Figure 5 shown, in Hela cells, compared with the control sequence α-globin 5’UTR (SEQ ID NO.10), among the 9 tested 5’UTR experimental sequences, the insertion of 6 5’UTR sequences increased the expression level of the Luc luciferase reporter gene by more than 1 fold, respectively: UTR5_2 (SEQ ID NO.2) increased by 1.43 fold; UTR5_4 (SEQ ID NO.4) increased by 1.06 fold; UTR5_5 (SEQ ID NO.5) increased by 1.41 fold; UTR5_6 (SEQ ID NO.6) increased by 1.39 fold; UTR5_7 (SEQ IDNO.7) increased by 1.30 fold; UTR5_8 (SEQ ID NO.8) increased by 2.35 fold. The insertion of 2 5’UTR sequences numbered UTR5_1 (SEQ ID NO.1) and UTR5_3 (SEQ ID NO.3) increased the expression level of the Luc luciferase reporter gene by 0.44 fold and 0.86 fold, respectively.

[0090] As Figure 6As shown, in THP-1 cells, compared with the control sequence α-globin 5’UTR (SEQ ID NO.10), among the 9 tested 5’UTR experimental sequences, the insertion of 7 5’UTR sequences increased the expression level of the Luc luciferase reporter gene by more than 1-fold, namely: UTR5_2 (SEQ ID NO.2) increased by 3.21-fold; UTR5_3 (SEQ ID NO.3) increased by 2.05-fold; UTR5_4 (SEQ ID NO.4) increased by 2.35-fold; UTR5_5 (SEQ ID NO.5) increased by 1.58-fold; UTR5_6 (SEQ ID NO.6) increased by 5.17-fold; UTR5_7 (SEQ ID NO.7) increased by 5.00-fold; UTR5_8 (SEQ ID NO.8) increased by 11.29-fold. There are 2 5’UTR sequences numbered UTR5_1 (SEQ ID NO.1) and UTR5_9 (SEQ ID NO.9), and their insertions increased the expression level of the Luc luciferase reporter gene by 0.68-fold and 0.57-fold, respectively.

[0091] In summary, the insertion of the 5’UTR sequence provided by the present invention increased the expression level of Luc luciferase in 293T, A375, Hela, and THP-1 cells by 2.81, 9.10, 2.35, and 11.29-fold, respectively. Among the 9 experimental 5’UTR sequences, most sequences significantly promoted the expression of the Luc luciferase reporter gene in the four cell types, showing the excellent effect of the 5’UTR. Among them, there are 3 sequences numbered UTR5_6 (SEQ ID NO.6), UTR5_7 (SEQ ID NO.7), and UTR5_8 (SEQ ID NO.8), which are all superior sequences with better performance in all four cell types, reflecting the robustness of the effect of the 5’UTR in promoting gene expression in different cell types.

[0092] Example 2

[0093] In this example, the IL-7 (interleukin-7) gene was used as the target gene to explore the regulatory effects of different 5’UTRs (corresponding to SEQ ID NO: 1-10) including the control group α-globin 5’UTR on the expression level of IL-7-mRNA in 293T cells, A375 cells, Hela cells, and THP-1 cells. The specific sequences are shown in Table 1, and the specific process is as follows:

[0094] Carry out 1. vector construction, 2. template preparation, and 3. mRNA preparation in sequence according to the steps described in Example 1. The schematic diagram of the vector structure containing the target mRNA sequence is as Figure 2 shown, where the reporter gene is IL-7.

[0095] 4. Cell Experiments

[0096] 4.1 Cell Resuscitation

[0097] Prepare complete medium (89% DMEM + 10% FBS + 1% Penicillin - Streptomycin Solution, total volume 500 mL). Take out 293T, A375, Hela, and THP - 1 cells and thaw them in a 37°C water bath. Use a pipette to aspirate the thawed cell suspension into a 15 - mL centrifuge tube, add complete medium to a total volume of 10 mL, centrifuge at 1000 rpm for 5 min, and discard the supernatant. Resuspend with an appropriate amount of complete medium and transfer it to a cell culture flask for culture.

[0098] 4.2 Cell Transfection

[0099] Take out the cells in the logarithmic growth phase from the CO2 incubator, wash them once with 10 mL of PBS, add 2 mL of Trypsin - EDTA for digestion, and then add 4 mL of complete medium to terminate the digestion. Transfer the digested 293T, A375, and Hela cells into a 15 - mL centrifuge tube, and transfer THP - 1 cells into a 50 - mL centrifuge tube; centrifuge at 1000 rpm for 5 min to discard the supernatant, and resuspend the cells with 5 mL of complete medium. Take a cell suspension for cell counting, dilute the cell density to 200,000 cells / well, inoculate into a 24 - well plate, and culture overnight. Prepare the transfection complex: 0.5 μg of mRNA + 50 μL of mRNA buffer per well, vortex and mix well; add 1 μL of jetMESSENGER transfection reagent, gently pipette 10 times, and let stand for 15 min. Use a pipette tip to aspirate the above transfection mixture and gently drop it into the well plate. After dropping, gently shake the well plate horizontally to mix; detect ELISA 24 h after transfection.

[0100] 4.3 ELISA Detection

[0101] Human IL - 7 Elisa Detection (specific experimental steps can refer to the reagent kit instructions)

[0102] Equilibrate the reagents to room temperature, prepare the washing solution and the standard & specimen universal diluent. Dilute the specimens with the diluent according to the experimental design, add them to the enzyme - linked immunosorbent assay (ELISA) plate, and incubate in the dark for 120 minutes. Immerse the ELISA plate in the washing solution, discard the liquid, and then add the biotinylated antibody working solution, incubate in the dark for 60 minutes. Immerse the ELISA plate in the washing solution, discard the liquid, and then add the enzyme conjugate working solution, incubate in the dark for 30 minutes. Immerse the ELISA plate in the washing solution, discard the liquid, and then add the chromogenic substrate (TMB), incubate in the dark for 8 minutes. Terminate the reaction with the reaction termination solution and measure the absorbance of OD 450 and OD 630 absorbance values.

[0103] The results showed that, as Figure 7 shown, in 293T cells, compared with the control sequence α-globin 5’UTR (SEQ ID NO.10), among the 9 tested 5’UTR experimental sequences, the insertion of 4 5’UTR sequences increased the expression level of the IL-7 gene by more than 0.5-fold, namely: UTR5_2 (SEQ ID NO.2) increased by 0.56-fold; UTR5_5 (SEQ ID NO.5) increased by 0.84-fold; UTR5_7 (SEQ ID NO.7) increased by 0.71-fold; UTR5_9 (SEQ ID NO.9) increased by 1.51-fold.

[0104] As Figure 8 shown, in A375 cells, compared with the control sequence α-globin 5’UTR (SEQ ID NO.10), among the 9 tested 5’UTR experimental sequences, the insertion of 2 5’UTR sequences increased the expression level of the IL-7 gene by more than 0.5-fold, namely: UTR5_8 (SEQ ID NO.8) increased by 0.52-fold; UTR5_9 (SEQ ID NO.9) increased by 2.00-fold. There was 1 5’UTR sequence numbered UTR5_2 (SEQ ID NO.2), and its insertion increased the expression level of the IL-7 gene by 0.48-fold.

[0105] As Figure 9 shown, in Hela cells, compared with the control sequence α-globin 5’UTR (SEQ ID NO.10), among the 9 tested 5’UTR experimental sequences, the insertion of 3 5’UTR sequences increased the expression level of the IL-7 gene by more than 0.5-fold, namely: UTR5_2 (SEQ ID NO.2) increased by 0.84-fold; UTR5_5 (SEQ ID NO.5) increased by 0.73-fold; UTR5_9 (SEQ ID NO.9) increased by 2.50-fold. There were 2 5’UTR sequences numbered UTR5_7 (SEQ ID NO.7) and UTR5_8 (SEQ ID NO.8), and their insertions increased the expression level of the IL-7 gene by 0.35-fold and 0.29-fold, respectively.

[0106] As Figure 10As shown, in THP-1 cells, compared with the control sequence α-globin 5’UTR (SEQ ID NO.10), among the 9 tested 5’UTR experimental sequences, the insertion of 2 5’UTR sequences increased the expression level of the IL-7 gene by more than 0.5 times, namely: UTR5_7 (SEQ ID NO.7) increased by 0.76 times; UTR5_9 (SEQ ID NO.9) increased by 0.83 times. There are 4 5’UTR sequences with numbers: UTR5_2 (SEQ ID NO.2), UTR5_5 (SEQ ID NO.5), UTR5_6 (SEQ ID NO.6) and UTR5_8 (SEQ ID NO.8), and their insertions increased the expression level of the IL-7 gene by 0.26 times, 0.30 times, 0.20 times and 0.46 times respectively.

[0107] In summary, the insertion of the 5’UTR sequence provided by the present invention increased the expression level of IL-7 in 293T, A375, Hela, and THP-1 cells by 1.51, 2.00, 2.50, and 0.83 times respectively at most. Among the 9 experimental 5’UTR sequences, some sequences significantly promoted the expression of the IL-7 gene in four cell types, showing the excellent effects of the 5’UTR. Among them, there is 1 sequence with the number: UTR5_9 (SEQ ID NO.9), which is the best-performing dominant sequence in all four cell types, reflecting the robustness of the 5’UTR in promoting gene expression in different cell types and showing the potential in the preparation of IL-7 cytokine therapeutic drugs or related mRNA vaccines.

Claims

1. A nucleic acid molecule, which is selected from one or more of the nucleic acid molecules shown in any of SEQ ID NO: 1-9.

2. A nucleic acid construct, the sequence of which sequentially includes, from 5'-3': The sequence of the nucleic acid molecule according to claim 1 and the target protein expression gene sequence; Preferably, the sequence of the nucleic acid construct further includes one or more of the following sequences: Promoter; Kozak sequence; 3' UTR; Poly(A); Preferably, the target protein expression gene is selected from the Luc gene, the GFP gene, the IL-7 gene, or a gene expressing an antigen from RSV or SARS-CoV-2.

3. A recombinant vector into which the nucleotide sequence of the nucleic acid construct according to claim 2 is inserted.

4. A host cell containing the recombinant vector according to claim 3.

5. An mRNA, which is obtained by constructing a DNA molecule with the nucleic acid molecule according to claim 1 as the 5' UTR and subjecting it to in vitro transcription; Preferably, the mRNA is unmodified or modified mRNA; the modification is selected from one or more of the following modifications: 5' cap structure; Poly(A); Pseudouridine; N1-methyl-pseudouridine; N6-methyladenosine; 5-methylcytidine.

6. A cell transfected with the mRNA according to claim 5, preferably, the cell is a 293T cell, an A375 cell, a Hela cell or a THP-1 cell.

7. A pharmaceutical composition comprising: the mRNA according to claim 5 and a pharmaceutically acceptable excipient.

8. Use of the nucleic acid molecule according to claim 1 as a 5' UTR, the nucleic acid construct according to claim 2, the recombinant vector according to claim 3 or the host cell according to claim 4 in the preparation of mRNA, wherein, The mRNA is preferably the mRNA according to claim 5.

9. Use of the nucleic acid molecule according to claim 1 as the 5' UTR, the nucleic acid construct according to claim 2, the recombinant vector according to claim 3, the host cell according to claim 4, or the mRNA according to claim 5 in the preparation of a preparation for enhancing the expression intensity of the target protein, prolonging the expression time of the target protein, and / or enhancing the expression of the target protein.

10. Use of the nucleic acid molecule according to claim 1 as the 5' UTR, the nucleic acid construct according to claim 2, the recombinant vector according to claim 3, the host cell according to claim 4, or the mRNA according to claim 5 in the preparation of a drug for treating immune system diseases or respiratory diseases, preferably, the drug is a vaccine.

Images