Bergenia bifunctional glycosyl transferase BpUGT1 gene and application thereof in preparation of arbutin and gastrodin

Abstract

The invention relates to a bergenia bifunctional glycosyl transferase BpUGT1 gene and application thereof in preparation of arbutin and gastrodin, and belongs to the technical field of biology. The nucleotide sequence of the bergenia bifunctional glycosyl transferase BpUGT1 gene is as shown in SEQ ID NO.1, and the total length of the sequence is 1431bp; the amino acid sequence of the encoded protein is as shown in SEQ ID NO.2, and 476 amino acid residues are encoded. The bergenia bifunctional glycosyl transferase BpUGT1 gene can be used as a biosynthesis regulation gene of gastrodin and arbutin, is applied to preparation of gastrodin and arbutin, and is remarkable in application prospect and easy to popularize and apply.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a bergenin bifunctional glycosyltransferase BpUGT1 gene and its application in the preparation of arbutin and gastrodin. Background Art

[0002] Bergenia ( Bergenia purpurascens ) is a perennial medicinal plant of the genus Bergenia in the Saxifragaceae family, mainly distributed in high-altitude (2200 - 4800 m) regions such as Yunnan, Guizhou, and Sichuan in China. Its dried rhizome, as a traditional Chinese medicine, has the effects of astringing diarrhea, stopping bleeding and relieving cough, and activating meridians and collaterals, and is widely used clinically in the treatment of respiratory diseases, digestive system diseases and trauma diseases. Modern pharmacological research reveals that its chemical constituents are mainly phenolic compounds, including the characteristic components bergenin, arbutin, gallic acid, catechin, etc., among which arbutin is particularly prominent as a key active ingredient.

[0003] Arbutin, as a natural hydroquinone glycoside compound, its whitening mechanism lies in reversibly inhibiting the activity of tyrosinase, blocking the melanin production pathway through competitive binding, and at the same time having multiple biological activities such as antioxidant, anti-inflammatory and antibacterial, and has become the preferred safe whitening agent in the global cosmetics industry. In the medical field, this compound also shows various potential application values.

[0004] At present, the commercial production of arbutin mainly relies on plant extraction and chemical synthesis methods: the former is limited by the endangered wild resources of bergenia (long growth cycle, narrow distribution area) and low extraction efficiency; the latter relies on the petroleum-based raw material hydroquinone, and there are problems of highly toxic by-products and environmental pollution. Although synthetic biology strategies have achieved the heterologous synthesis of arbutin in engineering bacteria such as Escherichia coli, the catalytic efficiency of the key rate-limiting enzyme - glycosyltransferase is low (currently mainly using arbutin synthase from Rauvolfia serpentina), which severely restricts the yield improvement.

[0005] Gastrodin, as the core active ingredient of the traditional precious Chinese medicine Gastrodia elata, has significant pharmacological effects such as sedation, nerve protection and anti-convulsion, and is widely used clinically in the treatment of central nervous system diseases. The acquisition of this 4-hydroxymethylphenyl glucoside has long relied on the extraction of Gastrodia elata tubers, facing industrialization bottlenecks such as a long raw material cultivation cycle (3 - 5 years) and low content of active ingredients. Although chemical synthesis methods can avoid the limitations of plant sources, they have defects such as difficult chiral control and high process energy consumption.

[0006] The key step in the biosynthesis of phenolic glycosides lies in the glycosylation reaction catalyzed by glycosyltransferase (UGT). At present, it is known that the UGT family has significant substrate broadness and catalytic diversity characteristics, but efficient UGT resources specific to hydroquinone / hydroxybenzyl alcohol are still extremely scarce. Although previous studies have confirmed that there may be related glycosylation enzyme systems in Bergenia purpurascens, their specific gene information, enzymatic properties, and bifunctional catalytic potential have not been clarified, severely restricting the construction of metabolic engineering transformation and in vitro enzyme catalytic systems. Summary of the Invention

[0007] To solve the above problems, the present invention provides a bifunctional glycosyltransferase from Bergenia purpurascens BpUGT1 gene and its application in the preparation of arbutin and gastrodin, which can be used as a biosynthetic regulatory gene for arbutin and gastrodin.

[0008] To achieve the above object, the technical solution of the present invention is as follows: The first aspect of the present invention provides a bifunctional glycosyltransferase from Bergenia purpurascens BpUGT1 In the second aspect of the present invention, there is provided a protein encoded by the above bergenin bifunctional glycosyltransferase BpUGT1 gene, and the amino acid sequence of the protein is as follows SEQ ID NO.2, encoding 476 amino acid residues.

[0009] MEMENQPPPPHIVIIPSPGMGHLIPLSEFAKRLVHHHNFSITFIVPTDGPPSKAQKSVLKQLPERISHVFLPPVNFDDLPETSMIETRISLMVTRSLSSLHDAMRPLAENSNLVALVVDLFGVDAFLVAREMNISPYVFYPSTAMNLSLFLYLPTLDKAVSCEYRDLTEPVQIPGCIPIHGRDLLDPVQDRKDEAYKWVLHNANMYRSAEGIMVNSFIDLEPGAIKALQEIEPGKPPIYPIGPLINMDPSSGVDGSECLKWLDDQPHGSVLFVSFGSGGTLSSEQLNELALGLDMSEQRFLWVVRSPNDQAANATYFSAQSISDPLSFLPKGFLEKTKGKGLVVPNWAPQAQILSHGSTGGFLTHCGWNSTLESVVNGIPLITWPLYAEQKMNAVMLTQDIKVALRPKSSENGGLVEREEIARVVRGLMEGEEGKNLRFRMKELKDAAADVLSENGSSSKALAELAHKWKNHQKST; (SEQ ID NO.2) In the third aspect of the present invention, there is provided a recombinant plasmid containing the above bergenin bifunctional glycosyltransferase BpUGT1 gene.

[0010] Preferably, the recombinant plasmid is obtained by homologous recombination of the above bergenin bifunctional glycosyltransferase BpUGT1 gene with the pET28a vector, and is named pET28a- BpUGT1 .

[0011] In the fourth aspect of the present invention, there is provided a genetically engineered bacterium containing the above recombinant plasmid, or, the genome of the genetically engineered bacterium integrates an exogenous above bergenin bifunctional glycosyltransferase BpUGT1 gene.

[0012] Preferably, the genetically engineered bacterium is Escherichia coli BL21 (DE3) strain.

[0013] The fifth aspect of the present invention provides an application of the above bergenin bifunctional glycosyltransferase BpUGT1 gene in the preparation of gastrodin.

[0014] Preferably, using 4-hydroxybenzyl alcohol and the glycosyl donor UDP-Glc as raw materials, under the catalysis of the bergenin glycosyltransferase encoded by the above bergenin bifunctional glycosyltransferase BpUGT1 gene, glycosylation occurs at the p-hydroxy position of 4-hydroxybenzyl alcohol to produce gastrodin; The sixth aspect of the present invention provides an application of the above bergenin bifunctional glycosyltransferase BpUGT1 gene in the preparation of arbutin.

[0015] Preferably, using hydroquinone and the glycosyl donor UDP-Glc as raw materials, under the catalysis of the bergenin glycosyltransferase encoded by the above bergenin bifunctional glycosyltransferase BpUGT1 gene, glycosylation occurs at the hydroxyl group of hydroquinone to produce arbutin.

[0016] In the present invention, the target protein is obtained by in vitro expression through a recombinant plasmid, and after further catalyzing the substrates 4-hydroxybenzyl alcohol and hydroquinone respectively, gastrodin and arbutin are directly produced.

[0017] The bergenin glycosyltransferase BpUGT1 gene of the present invention was identified by transcriptome sequencing and bioinformatics techniques from bergenin plants after a large number of experiments; RNA was extracted from the young and tender parts of bergenin and reverse transcribed into cDNA for PCR amplification. The amplification primers for the bergenin glycosyltransferase BpUGT1 gene are as follows: F: ATGGAAATGGAAAACCAACCACC; (SEQ ID NO.3) R: TTAAGTGCTCTTTTGATG; (SEQ ID NO.4) In addition, when homologous recombination is carried out with the vector pET28a, BpUGT1 the gene needs to be amplified and recovered using primers with homologous arms. The primers with homologous arms are as follows: F: gtggacagcaaatgggtcgcggatccATGGAAATGGAAAACCAACCACC; (SEQ ID NO.5) R: tgtcgacggagctcgaattcggatccTTAAGTGCTCTTTTGATG. (SEQ ID NO.6) Glycosyltransferase isolated and identified from Bergenia purpurascens BpUGT1 gene, which can be used as an important marker gene for molecular assisted breeding of Bergenia purpurascens, and can also be used as an important candidate gene for the production of arbutin and gastrodin in the construction of yeast chassis cells.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) The present invention provides a bifunctional glycosyltransferase BpUGT1 gene of Bergenia purpurascens, which can be used as a biosynthesis regulatory gene for gastrodin and arbutin, and is applied to the preparation of gastrodin and arbutin.

[0019] (2) With the rapid development of bioinformatics technology, the excavation of key enzyme genes in the biosynthesis pathways of gastrodin and arbutin has been greatly promoted. The biosynthesis regulatory gene of gastrodin and arbutin in the present invention, namely the bifunctional glycosyltransferase BpUGT1 gene of Bergenia purpurascens, is identified and successfully verified for the first time, opening up a new method for the biosynthesis of gastrodin. The present invention obtains the target product by means of in vitro enzymatic catalysis of heterologously expressed proteins in Escherichia coli, and adopts in vitro biosynthesis for directional production, which has the advantages of few by-products.

[0020] (3) The present invention also provides a recombinant plasmid, a genetically engineered bacterium and a recombinant protein containing the glycosyltransferase BpUGT1 gene, laying a foundation for the large-scale synthesis of gastrodin and arbutin by bioengineering methods, and further for the research on the construction of cell factories producing gastrodin and arbutin.

[0021] (4) By in vitro biosynthesis of gastrodin and arbutin, the controllability is strong, the demand for raw material planting can be reduced, the production product is single, which is convenient for the separation and purification of gastrodin and arbutin in the later stage, and can also reduce problems such as difficulties in chemical synthesis and complex synthesis pathways. The bifunctional glycosyltransferase BpUGT1 gene of Bergenia purpurascens, as a key gene for the biosynthesis of gastrodin and arbutin, can also be used for the breeding research of plants rich in gastrodin and arbutin such as Mirabilis jalapa. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Schematic diagram of the deduced synthesis pathway for gastrodin; Figure 2 Schematic diagram of the deduced synthesis pathway for arbutin; Figure 3 Schematic diagram of the construction of recombinant expression plasmid pET28a-BpUGT1; Figure 4 ForBpUGT1 Electrophoresis detection results after recombination (M: DNA Marker); Figure 5 For BpUGT1 SDS-PAGE protein electrophoresis map; where M is the protein molecular weight standard; Figure 6 For the glycosylation of hydroquinone by HPLC detection of glycosyltransferase BpUGT1 The glycosylation of hydroquinone. The abscissa is time, unit min; the ordinate is the response value, unit mAU; where, CK: control group (hydroquinone + UDP-Glc + inactivated bergenin glycosyltransferase BpUGT1 ) enzyme inactivation enzyme activity reaction results; standard: hydroquinone standard + arbutin standard; BpUGT1: experimental group (hydroquinone + UDP-Glc + bergenin glycosyltransferase BpUGT1 ) enzyme activity reaction results; Figure 7 For the glycosylation of p-hydroxymandel alcohol by HPLC detection of glycosyltransferase BpUGT1 The glycosylation of p-hydroxymandel alcohol. The abscissa is time, unit min, and the ordinate is the response value, unit mAU; where, CK: control group (p-hydroxymandel alcohol + UDP-Glc + inactivated bergenin glycosyltransferase BpUGT1 ) enzyme inactivation enzyme activity reaction results; standard: p-hydroxymandel alcohol standard + gastrodin standard; BpUGT1 : experimental group (p-hydroxymandel alcohol + UDP-Glc + bergenin glycosyltransferase BpUGT1 ) enzyme activity reaction results; Figure 8 For the fragment ion map of standard arbutin (theoretical molecular weight 271) (LC / MS / MS) (Figure A) and the fragment ion map of the reaction product arbutin (theoretical molecular weight 271) (LC / MS / MS) (Figure B).

[0023] Figure 9 For the fragment ion map of standard gastrodin (theoretical molecular weight 331) (LC / MS / MS) (Figure A) and the fragment ion map of the reaction product gastrodin (theoretical molecular weight 331) (LC / MS / MS) (Figure B). Detailed implementation mode

[0024] The present invention will be further described in detail below with reference to the embodiments.

[0025] Those skilled in the art will understand that the following embodiments are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention. For those without specific techniques or conditions noted in the embodiments, the techniques or conditions described in the literature in this field or according to the product specifications are followed. For materials or equipment without the manufacturer noted, they are all conventional products that can be obtained by purchase. Example 1

[0026] Based on the basic functional annotation information of Bergenia Unigene, UGT candidate genes were screened in the sequencing annotation results. At the same time, glycosyltransferases (UGTs) identified in plants were used for local BLAST analysis of sequences, and then the screening results were sorted out and analyzed. Finally, 1 glycosyltransferase (UGT) gene was found. After a series of work such as cDNA preparation, amplification and recovery of candidate genes, homologous recombination, protein expression, in vitro enzyme activity reaction, and HPLC and LC / MS detection, the target candidate genes that can catalyze the formation of arbutin from hydroquinone and gastrodin from p-hydroxybenzyl alcohol were finally identified. BpUGT1 ( Figure 1 、 Figure 2 ). The operating steps at each stage of gastrodin and arbutin synthesis are as follows: (1) Preparation of cDNA template Take fresh rhizome samples of Bergenia, quickly freeze them in liquid nitrogen after slicing, and perform RNA extraction. The RNA extraction uses the HiPure Plant RNA Mini Kit of Magen (Guangzhou Meiji Biotechnology Co., Ltd.). Extract RNA according to the operating steps of the kit. After passing the detection, use the TAKARA reverse transcription kit to reverse transcribe RNA into cDNA and store it at -20 °C for standby.

[0027] (2) Gene amplification and recovery Use SnapGene software to design specific primers for candidate genes and entrust the Kunming branch of Beijing Tsingke Biotechnology Co., Ltd. to synthesize them. Use 2×Phanta Max Master Mix polymerase to amplify the target gene. The reaction system and reaction program are as follows. The reaction system is 25 ul of 2×Phanta Max Master Mix, 1 ul each of the forward and reverse primers of the candidate gene, 1 ul of cDNA from various tissues of Bletilla striata, and 22 ul of ddH2O. The PCR reaction program is: Pre-denature at 95 °C for 3 min; Denature at 95 °C for 15 s, Anneal at 58 °C for 15 s, Extend at 72 °C for 1 min for 35 cycles; Final extension at 72 °C for 5 min; Incubate at 10 °C.

[0028] Recover the target fragment using 1% agarose gel and the Tiangen agarose gel DNA recovery kit. After recovery, measure its concentration on a NanoReady ultra-micro ultraviolet-visible spectrophotometer, and finally store it in a -20 °C refrigerator for later use. Obtain the bifunctional glycosyltransferase gene fragment of Bergenia purpurascens. BpUGT1 The nucleic acid sequence of the gene fragment is shown in SEQ ID NO.1 after sequencing, and the amino acid sequence of the protein is shown in SEQ ID NO.2.

[0029] Glycosyltransferase BpUGT1 The amplification primers for the gene are as follows: F: ATGGAAATGGAAAACCAACCACC; (SEQ ID NO.3) R: TTAAGTGCTCTTTTGATG; (SEQ ID NO.4) In addition, when performing homologous recombination with the vector pET28a, BpUGT1 the gene needs to be amplified and recovered using primers with homologous arms. The primers with homologous arms are as follows: F: gtggacagcaaatgggtcgcggatccATGGAAATGGAAAACCAACCACC; (SEQ ID NO.5) R: tgtcgacggagctcgaattcggatccTTAAGTGCTCTTTTGATG. (SEQ ID NO.6) (3) Construction and identification of the gene recombinant vector The schematic diagram of homologous recombination is shown in Figure 3 . First, linearize the vector pET28a. During homologous recombination, assemble according to the operation instructions of the homologous recombination enzyme. Then, calculate the dosage of each component based on the concentration of the inserted fragment and the vector, and according to the recombination instructions; finally, add each component to the PCR reaction tube on ice. After assembly, detect the result and send it to the company for sequencing. The electrophoresis detection result after assembly is shown in Figure 4 , indicating successful assembly.

[0030] (4) SDS-PAGE protein electrophoresis After small-scale protein expression experiments, it was determined that BpUGT1 the protein induction conditions are: 16 °C, 0.5 mM IPTG, 160 r / min, induce for 12 h; then perform large-scale shaking, collect bacteria, break the cell wall, obtain the protein supernatant after high-speed centrifugation, pass the supernatant through a Ni-NTA column at 4 °C, collect the filtrate under 250 mM imidazole, and then detect it by SDS-PAGE protein electrophoresis. The detection result is shown inFigure 5 It indicates that the supernatant protein of the target gene has been obtained.

[0031] (5) Enzyme activity reaction The enzyme activity reaction was carried out in a 2.0 mL centrifuge tube and prepared according to the components in Table 1. Then, the components were added in the order shown in the table, and after mixing, the reaction solution was briefly centrifuged to collect it at the bottom of the centrifuge tube. The centrifuge tube was placed in a metal bath and reacted at 32 °C for 2 h. After completion, the reaction was terminated with 100 μL of methanol, and finally the product was detected.

[0032] Table 1 Component ratio of the UGT enzyme activity reaction system

[0033] (6) Product detection The HPLC detection conditions are as follows: The instrument used for HPLC detection was an Agilent 1290 ultra-high performance liquid chromatograph. The liquid chromatography column was an Agilent ZORBAX SB-C18 column (250 mm × 4.6 mm, 5.0 μm). The mobile phase for determining the product was 0.1% v / v formic acid aqueous solution (A) - acetonitrile (B). The gradient elution program was as follows: 0 - 8 min, 1% - 5% B; 8 - 13 min, 5% - 10% B; 13 - 20 min, 10% - 20% B; 20 - 25 min, 20% - 45% B; 25 - 35 min, 45% - 90% B; 35 - 40 min, 90% - 90% B. Elution time: 40 min; injection volume: 10 μL; flow rate: 0.6 ml / min; detection wavelength for gastrodin was 220 nm, detection wavelength for arbutin was 270 nm, column temperature was 30 °C, injection volume was 10 μL. The detection results are shown in Figure 6 , Figure 7 , indicating the production of gastrodin and arbutin respectively.

[0034] The LC-MS detection conditions are as follows: Detection was carried out using an Agilent 1290 UPLC / 6540 Q-Tof liquid chromatography-mass spectrometry (LC / MS). Mass spectrometry conditions: The ion source was operated in negative ion mode, with a voltage of 3500 V; fragmentation voltage: 135 V; cone voltage: 60 V; RF voltage: 750 V, and the scanning range was 100 - 1000 m / z. Chromatographic conditions: The column used was an Agilent ZORBAX SB-C18 column (250 mm × 4.6 mm, 5.0 μm), with a flow rate of 0.6 mL / min. The mobile phase was 0.01% formic acid (A) and acetonitrile (B), and gradient elution was performed as follows: 0 - 8 min, 1% - 5% B; 8 - 13 min, 5% - 10% B; 13 - 20 min, 10% - 20% B; 20 - 25 min, 20% - 45% B; 25 - 35 min, 45% - 90% B; 35 - 38 min, 90% - 90% B; 38 - 45 min, 90% - 100% B. Elution time: 45 min; injection volume: 10 μL; flow rate: 0.6 mL / min. The detection results are shown in Figure 8 —9. As can be seen from the results, the fragment ion map of the reaction product arbutin ( Figure 8 B) is consistent with the fragment ion map of the standard arbutin ( Figure 8 A), further confirming the formation of the product arbutin; the fragment ion map of the reaction product gastrodin ( Figure 9 B) is consistent with the fragment ion map of the standard gastrodin ( Figure 9 A), further confirming that the product formed is gastrodin.

[0035] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited by the above embodiments. What is described in the above embodiments and the specification only illustrates the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention will have various changes and improvements, and these changes and improvements all fall within the scope of the present invention claimed. The scope of protection claimed by the present invention is defined by the appended claims and their equivalents.

Claims

1. A bergenin bifunctional glycosyltransferase BpUGT1 gene, characterized in that The bergenin bifunctional glycosyltransferase BpUGT1 The nucleic acid sequence of the gene is shown in SEQ ID NO.

1.

2. The bergenin bifunctional glycosyltransferase according to claim 1 BpUGT1 The protein encoded by the gene, characterized in that The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

3. A recombinant plasmid containing the bergenin bifunctional glycosyltransferase gene recited in claim 1. BpUGT1 ​ 4. The recombinant plasmid containing the bergenin bifunctional glycosyltransferase BpUGT1 gene according to claim 3, characterized in that The bergenin bifunctional glycosyltransferase BpUGT1 gene was obtained by homologous recombination with the pET28a vector to obtain pET28a - BpUGT1 the recombinant plasmid.

5. A genetically engineered bacterium, characterized in that, Containing the recombinant plasmid described in claim 3 or 4, or, an exogenous bergenin bifunctional glycosyltransferase described in claim 1 is integrated into the genome of the genetically engineered bacterium BpUGT1 gene.

6. The genetically engineered bacterium according to claim 5, characterized in that, The genetically engineered bacterium is Escherichia coli BL21(DE3) strain.

7. Use of the bergenin bifunctional glycosyltransferase gene according to claim 1 in the preparation of gastrodin. BpUGT1 ​ 8. Use of the bergenin bifunctional glycosyltransferase BpUGT1 gene according to claim 7 in the preparation of gastrodin, characterized in that Using p-hydroxybenzyl alcohol as a substrate and UDP-Glc as a glycosyl donor, under the catalysis of the bergenin glycosyltransferase encoded by the bergenin bifunctional glycosyltransferase gene described above BpUGT1 glycosylation occurs at the p-hydroxy position of p-hydroxybenzyl alcohol to produce gastrodin.

9. The bergenin bifunctional glycosyltransferase according to claim 1 BpUGT1 for use in the preparation of arbutin.

10. Use of the bergenin bifunctional glycosyltransferase BpUGT1 gene in the preparation of gastrodin, characterized in that Using hydroquinone as a substrate and UDP-Glc as a glycosyl donor, glycosylation occurs at the hydroxyl group of hydroquinone under the catalysis of the bergenin glycosyltransferase encoded by the above-mentioned bergenin bifunctional glycosyltransferase BpUGT1 gene to produce arbutin.

Images