Method and primer combination for identifying shiitake Shenxiang 1513 variety by using polynucleotide polymorphism labeling method
Through polynucleotide polymorphism labeling method and multiple PCR amplification combined with Illumina sequencing, the rapid and accurate identification of 1513 varieties of shiitake mushrooms was solved, and an efficient and economical identification method was achieved, which was suitable for ordinary laboratories.
Patent Information
- Application Number
- CN202510523671.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-24
- Publication Date
- 2025-07-25
AI Technical Summary
It is difficult to quickly and accurately identify 1513 varieties of shiitake mushrooms in ordinary laboratories in the prior art, and the traditional molecular marking methods are limited by experimental conditions, and the results are inconsistent and cannot be widely used.
The polynucleotide polymorphism (MNP) labeling method was used to multiple PCR amplify and sequence the shiitake species using 7 specific primer combinations, and genotype identification was performed in combination with an Illumina sequencer to provide digitized and standardized identification results.
The rapid and accurate identification of 1513 varieties of shiitake mushrooms has been achieved, reducing the cost of primer synthesis and sequencing, providing high versatility and identification specificity, and avoiding the inconsistent results caused by fluctuations in experimental conditions.
Smart Images

Figure CN120366499A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular identification of Lentinula edodes strains, and particularly relates to a method and primer combination for identifying the Lentinula edodes Shenxiang 1513 variety using a polynucleotide polymorphism marker method. Background Art
[0002] The annual output of Lentinula edodes has always ranked first among edible fungi. Edible fungi have the characteristic of asexual reproduction. Variety DUS (distinctness, uniformity, and stability) testing and molecular marker identification are currently two ways to provide variety identity information. However, the phenotypic testing period of DUS testing is long and it is easily affected by environmental and human subjective factors. Molecular marker identification is applied to variety identification due to its higher accuracy, stronger polymorphism, and greater speed.
[0003] Although traditional molecular markers can also identify strains, since they are not based on sequencing, the gel electrophoresis bands each time are restricted by experimental conditions and the results are inconsistent, and it is necessary to rely on the simultaneous comparison of control strains. In contrast, the MNP marker method based on sequencing can provide digital and standardized identification results by directly detecting polymorphic sites in the DNA sequence, avoiding the problem of result interpretation caused by fluctuations in experimental conditions.
[0004] Lentinula edodes Shenxiang 1513 is a single-spore hybrid variety, which has been promoted and applied due to its high yield and high flowering rate. However, the phenomenon of multiple names for the same species and the same name for different species that have emerged have also troubled producers. Existing technologies have developed MNP markers for Lentinula edodes, but the existing identification methods require the establishment of a large-scale variety database and the simultaneous amplification of hundreds of marker sites. For ordinary laboratories, not only a large number of primers need to be synthesized, but there is also no database for comparison. For the identification of a single variety, this method cannot be popularized and used currently. Summary of the Invention
[0005] The purpose of this part is to outline some aspects of the embodiments of the present invention and briefly introduce some preferred embodiments.
[0006] The Lentinula edodes Shenxiang 1513 variety of the present invention was deposited at the Guangdong Provincial Culture Collection of Microorganisms on December 9, 2021. The address is: 5th Floor, Building 59, 100th Yard, Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences. The deposit number is: GDMCC No: 62098.
[0007] The object of the present invention is to provide a primer combination of polynucleotide polymorphisms (MNPs) for identifying the Lentinula edodes variety 'Shenxiang 1513' in response to the need for rapid and accurate identification of existing Lentinula edodes varieties. The primer combination includes 7 MNP marker sites: SEQ ID NO: 1-14.
[0008] The above MNP primer combination for identifying the Lentinula edodes variety 'Shenxiang 1513' is as follows: The primers of SEQ ID NO: 1-2 are: forward primer (5'→3') CACGTCCTTTAGCCCAATTGTTG; reverse primer (5'→3') CAGTACAAGGGAAATAATGACCTGC.
[0009] The above MNP primer combination for identifying the Lentinula edodes variety 'Shenxiang 1513' is as follows: The primers of SEQ ID NO: 3-4 are: forward primer (5'→3') AAGAAACAAACATACCTGTGCGATT; reverse primer (5'→3') CTTTTGGCTCATCTTCCTAGCTGTT.
[0010] The above MNP primer combination for identifying the Lentinula edodes variety 'Shenxiang 1513' is as follows: The primers of SEQ ID NO: 5-6 are: forward primer (5'→3') GCTCTTCTGATACCCTCTTGTTGTT; reverse primer (5'→3') ATCCCTGATAGAACCCTCAAAATGT.
[0011] The above MNP primer combination for identifying the Lentinula edodes variety 'Shenxiang 1513' is as follows: The primers of SEQ ID NO: 7-8 are: forward primer (5'→3') TTTTGTTGGTCGTGGGTATATTGTC; reverse primer (5'→3') GAAGTACGTTATTCAATCCGTGACC.
[0012] The above MNP primer combination for identifying the Lentinula edodes variety 'Shenxiang 1513' is as follows: The primers of SEQ ID NO: 9-10 are: forward primer (5'→3') CCCAACCTCATCAAATTTGATCCTC; reverse primer (5'→3') TCATTTTCTTTGGACAACACGATGT.
[0013] The MNP primer combination for identifying the Lentinula edodes variety 'Shenxiang 1513' is as follows: The primers of SEQ ID NO: 11-12 are: forward primer (5'→3') TGAATTTCTCTTCGCTTTCCATGTG; reverse primer (5'→3') TGTATATACCTCGGCTGTCTCTTTC.
[0014] The MNP primer combination for identifying the Lentinula edodes variety 'Shenxiang 1513' is as follows: The primers of SEQ ID NO: 13-14 are: forward primer (5'→3') TTGAGTTGCAAGGGTTGGTCAA; reverse primer (5'→3') AGAATAATACTGTTGTTGATCGCGG.
[0015] The present invention also provides a method for identifying polynucleotide polymorphism markers of the Lentinula edodes variety 'Shenxiang 1513', which is: performing molecular identification on the Lentinula edodes strains with the MNP primer combination.
[0016] As a preferred embodiment of the MNP identification method for identifying the Lentinula edodes variety 'Shenxiang 1513' of the present invention, the molecular identification method comprises the following steps:
[0017] Extracting the mycelial DNA of the Lentinula edodes strains;
[0018] Performing multiplex PCR amplification on the mycelial DNA with an equal mixture of the MNP primer combination;
[0019] After purifying the amplification product, adding adapters (barcode primers). If multiple test strains are identified simultaneously, different adapters need to be ligated to facilitate sequencing identification;
[0020] Performing sequencing using an Illumina sequencer, and identifying the MNP marker genotypes of the test strains according to the sequencing results.
[0021] As a preferred embodiment of the MNP identification method for identifying the Lentinula edodes variety 'Shenxiang 1513' of the present invention: For the multiplex PCR amplification, the PCR system is: a 30 μL system, 1 μL of DNA, 10 μL of 3×PCR mix, 4 μL of primer mixture, and 15 μL of ddH2O.
[0022] As a preferred embodiment of the MNP identification method for identifying the Lentinula edodes variety 'Shenxiang 1513' of the present invention: For the multiplex PCR amplification, the reaction procedure is: 95°C for 3 min, 95°C for 20 s, 60°C for 4 min, extension at 72°C for 4 min, 15 cycles; 72°C for 5 min.
[0023] As a preferred embodiment of the MNP identification method for identifying the Lentinula edodes variety 'Shenxiang 1513' of the present invention: the MNP marker genotypes of the test strain are identified according to the sequencing results. When the MNP genotypes of the test Lentinula edodes strain are GT012 / GT020 / GT007 / GT003 / GT005 / GT004 / GT009, it is identified as the 'Shenxiang 1513' variety.
[0024] As a preferred embodiment of the MNP identification method for identifying the Lentinula edodes variety 'Shenxiang 1513' of the present invention: when the genotype of at least one of the 7 MNP markers is different from that of the 'Shenxiang 1513' variety, it is identified as a different variety.
[0025] Advantages of the present invention: The present invention provides an MNP primer combination and an identification method for identifying the Lentinula edodes variety 'Shenxiang 1513'. Compared with other molecular markers and fruiting tests, MNP is based on multiplex amplification and sequencing technologies, and can perform sequence analysis on multiple samples at one time. The sequencing results can be stored for a long time, have universality, and have a short detection period and high accuracy. Compared with the existing MNP identification technologies, the present invention saves a large amount of primer synthesis costs, sequencing costs, and analysis costs, reduces the number of identification primers from more than 500 pairs in the existing technology to 7 pairs, and provides the specific MNP genotype sequences of these 7 pairs of primers, and can also perform targeted identification without a control strain. The MNP genotype map of the Lentinula edodes variety 'Shenxiang 1513' in the present invention is a characteristic identifier of this variety and has specificity for identifying this variety. Description of the Drawings
[0026] To more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Among them:
[0027] Figure 1 The MNP genotypes amplified by 7 pairs of primer combinations for 'Shenxiang 1513';
[0028] Figure 2 The MNP allele genotype map of the primer MNP1 of the present invention in 277 Lentinula edodes strains;
[0029] Figure 3 The MNP allele genotype map of the primer MNP2 of the present invention in 277 Lentinula edodes strains;
[0030] Figure 4 The MNP allele genotype map of the primer MNP3 of the present invention in 277 Lentinula edodes strains;
[0031] Figure 5 The MNP allele genotype map of the primer MNP4 of the present invention in 277 Lentinula edodes strains;
[0032] Figure 6 MNP allele genotype map of primer MNP5 of the present invention in 277 Lentinula edodes strains;
[0033] Figure 7 MNP allele genotype map of primer MNP6 of the present invention in 277 Lentinula edodes strains;
[0034] Figure 8 MNP allele genotype map of primer MNP7 of the present invention in 277 Lentinula edodes strains. Detailed implementation manners
[0035] To make the above objects, features and advantages of the present invention more obvious and understandable, the following detailed description of the specific implementation manners of the present invention will be given in conjunction with specific embodiments.
[0036] The present invention provides an MNP primer combination for identifying the Lentinula edodes variety 'Shenxiang 1513'. The primer combination includes 7 MNP marker loci: SEQ ID NO: 1-14. The MNP genotype map amplified by the primer combination has specificity for identifying the Lentinula edodes variety 'Shenxiang 1513'. The detailed information of the primer combination is shown in Table 1.
[0037] Table 1 List of MNP marker primer information
[0038]
[0039]
[0040] The present invention also provides an MNP identification method for identifying the Lentinula edodes variety 'Shenxiang 1513', that is, using 7 pairs of MNP marker primers developed from the continuous nucleotide variations of the Lentinula edodes genome to perform MNP genotype identification on the Lentinula edodes strain to be tested. Taking the genotype of the 'Shenxiang 1513' strain as a control for comparison, if the genotype of the strain to be tested is consistent with the control, it is the Lentinula edodes variety 'Shenxiang 1513'.
[0041] Through the MNP marker genotype identification of 277 existing Lentinula edodes strains collected, the present invention determined the number of allele genotypes identified by 7 pairs of MNP marker primer sets in 277 Lentinula edodes strains and the number of continuous variable nucleotide sites and numbered them. The Lentinula edodes variety 'Shenxiang 1513' can be effectively identified through the number combination of different MNP allele loci (see Table 2).
[0042] Table 2 MNP marker allele genotype and amplified product information (reference genome: GCA_001562095.1)
[0043]
[0044]
[0045] The present invention provides an embodiment: a method for MNP identification of the Lentinula edodes variety 'Shenxiang 1513', including:
[0046] (1) Mycelium culture: The culture medium is potato dextrose agar solid medium (PDA), the culture temperature is 25 °C, and the culture time is 12 d;
[0047] (2) Genomic DNA extraction: The genomic DNA of the mycelium of the strain to be tested is extracted by the CTAB method. The ratio of the absorbance value at 260 nm to that at 230 nm of the extracted DNA is greater than 2.0, and the absorbance ratio at 260 nm to that at 280 nm is between 1.7 and 1.9. The DNA concentration is measured, and the sample DNA concentration is adjusted to about 50 ng / μL;
[0048] (3) Multiplex PCR amplification: The 7 groups of MNP identification primers shown in Table 1 are mixed in equal amounts, and the MNP marker sites of the Lentinula edodes strain to be tested are amplified by multiplex PCR to obtain a multiplex PCR amplification product.
[0049] The PCR amplification system is: the total volume is 30 μL, including: 4 μL primer group, 1 μL DNA of the sample to be tested, 10 μL GenoPlexs 3×T Master Mix, 15 μL ddH2O.
[0050] The PCR amplification reaction procedure: 95 °C for 3 min; (95 °C for 20 s, 60 °C for 4 min) × 15 cycles; 72 °C for 4 min; stored at 10 °C. The multiplex PCR amplification product is purified by magnetic beads.
[0051] (4) Adding sequencing adapters: The total volume of the PCR system is 30 μL. Add 10 μL GenoPlexs 3×T Master Mix, 2 μL barcode P7 primer, 2 μL barcode P7 primer, and 16 μL ddH2O to the purified multiplex PCR amplification product.
[0052] The PCR amplification reaction procedure: 95 °C for 3 min; (95 °C for 15 s, 58 °C for 15 s, 70 °C for 30 s) × 7 cycles; 72 °C for 5 min; stored at 10 °C. The product is purified to obtain a sequencing library.
[0053] (5) Sequencing: The library is sequenced using an Illumina Next Seq550 sequencer to obtain the sequencing data of the sample to be tested.
[0054] (6) Genotype identification: Use the fastp software to filter sequencing adapters; use the BWA software to align with the GCA_001562095.1 genome, use the samtools tool to sort the sam file and convert it into a bam file; use bcftools for variant detection; use the R package geneHapR for MNP genotype identification.
[0055] (7) Result determination: The genotypes of the 7 pairs of MNP primer sets are as Figure 1 shown. If the genotype is consistent with that of the Lentinula edodes variety 'Shenxiang 1513', it is determined that the strain to be tested is the Lentinula edodes variety 'Shenxiang 1513'.
[0056] Compare the genotypes of 277 existing Lentinula edodes varieties with those of the Lentinula edodes variety 'Shenxiang 1513'. No 100% similarity was found in all 7 pairs of primers, and there are significant genetic differences from most varieties. The variety 'Shenxiang 18', which has the highest similarity, is one of the parents of 'Shenxiang 1513', and 3 pairs of genotypes are consistent among the 7 pairs of primers. The results show that the map composed of the MNP marker combination sites is the specific map of the Lentinula edodes variety 'Shenxiang 1513', and the Lentinula edodes variety 'Shenxiang 1513' can be effectively identified through this marker combination. The comparison results of the genotypes of some strains are shown in Table 3.
[0057] Table 3 Comparison of genotypes between the Lentinula edodes variety 'Shenxiang 1513' and other Lentinula edodes strains
[0058]
[0059]
[0060]
[0061]
[0062]
Claims
1. A primer combination of a polynucleotide polymorphism marker method for identifying the Shenxiang 1513 variety of Lentinula edodes, characterized in that: The Lentinula edodes strain Shenxiang 1513 was deposited at the Guangdong Microbial Culture Collection Center on December 9, 2021, with the deposit number GDMCC No: 62098; the primer combination consists of 7 pairs of polynucleotide polymorphism marker primers, and the 7 pairs of polynucleotide polymorphism marker primers are MNP1 to 7 respectively, and their nucleic acid sequences are as follows: MNP1 forward primer: 5′-CACGTCCTTTAGCCCAATTGTTG-3′, reverse primer: 5′-CAGTACAAGGGAAATAATGACCTGC-3′; MNP2 forward primer: 5′-AAGAAACAAACATACCTGTGCGATT-3′, reverse primer: 5′-CTTTTGGCTCATCTTCCTAGCTGTT-3′; MNP3 forward primer: 5′-GCTCTTCTGATACCCTCTTGTTGTT-3′, reverse primer: 5′-ATCCCTGATAGAACCCTCAAAATGT-3′; MNP4 forward primer: 5′-TTTTGTTGGTCGTGGGTATATTGTC-3′, reverse primer: 5′-GAAGTACGTTATTCAATCCGTGACC-3′; MNP5 forward primer: 5′-CCCAACCTCATCAAATTTGATCCTC-3′, reverse primer: 5′-TCATTTTCTTTGGACAACACGATGT-3′; MNP6 forward primer: 5′-TGAATTTCTCTTCGCTTTCCATGTG-3′, reverse primer: 5′-TGTATATACCTCGGCTGTCTCTTTC-3′; MNP7 forward primer: 5′-TTGAGTTGCAAGGGTTGGTCAA-3′, reverse primer: 5′-AGAATAATACTGTTGTTGATCGCGG-3′.
2. A method for identifying the Shenxiang 1513 variety of Lentinula edodes using a polynucleotide polymorphism marker method, characterized in that: The 7 pairs of polynucleotide polymorphism marker primers are used for PCR amplification of the test strain, and the PCR amplification products are sequenced.
3. The method for identifying the strain Shenxiang 1513 of Lentinula edodes using the polynucleotide polymorphism marker according to claim 2, characterized in that: The scaffold number corresponding to the PCR amplification product of primer MNP1 is LSDU01000018.
1. In its PCR amplification product, the base at position 1075769 is T / G, the base at position 1075799 is G, the base at position 1075828 is A, the base at position 1075832 is G / A, the base at position 1075836 is G, the base at position 1075851 is T, and the base at position 1075865 is A.
4. The method for identifying the Lentinula edodes variety Shenxiang 1513 by the polynucleotide polymorphism marker method according to claim 2, characterized in that: The scaffold number corresponding to the PCR amplification product of primer MNP2 is LSDU01000022.
1. In its PCR amplification product, the base at position 560817 is T / A, the base at position 560823 is T / A, the base at position 560907 is C, the base at position 560918 is C, the base at position 560935 is A, the base at position 560937 is T, the base at position 560940 is C, the base at position 560948 is T, the base at position 560949 is G, the base at position 560956 is C, the base at position 560959 is A, and the base at position 560987 is T / C.
5. The method for identifying the strain Shenxiang 1513 of Lentinula edodes using the polynucleotide polymorphism marker method according to claim 2, characterized in that: The scaffold number corresponding to the PCR amplification product of primer MNP3 is LSDU01000025.
1. In its PCR amplification product, the base at position 1035885 is G, the base at position 1035886 is G, the base at position 1035905 is A, the base at position 1035925 is G, the base at position 1035949 is G, the base at position 1035950 is C, the base at position 1036012 is A, and the base at position 1036018 is G.
6. The method for identifying the Lentinula edodes variety Shenxiang 1513 using the polynucleotide polymorphism marker method according to claim 2, characterized in that: The scaffold number corresponding to the PCR amplification product of primer MNP4 is LSDU01000026.
1. In its PCR amplification product, the base at position 2493310 is G / A, the base at position 2493325 is T, the base at position 2493367 is C, and the base at position 2493400 is A.
7. The method for identifying the strain Shenxiang 1513 of Lentinula edodes using the polynucleotide polymorphism marker method according to claim 2, characterized in that: The scaffold number corresponding to the PCR amplification product of primer MNP5 is LSDU01000027.
1. In its PCR amplification product, the base at position 520260 is C, the base at position 520261 is C, the base at position 520309 is A, the base at position 520323 is C, the base at position 520324 is G / A, and the base at position 520350 is T.
8. The method for identifying the Shenxiang 1513 variety of Lentinula edodes using the polynucleotide polymorphism marker method according to claim 2, characterized in that: The scaffold number corresponding to the PCR amplification product of primer MNP6 is LSDU01000029.
1. In its PCR amplification product, the base at position 565306 is G, the base at position 565342 is C, the base at position 565364 is C / T, the base at position 565385 is A, the base at position 565390 is G, the base at position 565394 is G, the base at position 565412 is G, the base at position 565413 is A, and the base at position 565453 is T.
9. The method for identifying the Shenxiang 1513 variety of Lentinula edodes using the polynucleotide polymorphism marker method according to claim 2, characterized in that: The scaffold number corresponding to the PCR amplification product of primer MNP7 is LSDU01000030.
1. In its PCR amplification product, the base at position 705568 is G, the base at position 705574 is A, the base at position 705592 is G, the base at position 705595 is G, the base at position 705625 is C, the base at position 705683 is G, the base at position 705697 is G, and the base at position 705724 is G.