Application of morusin in preparation of tetracycline antibiotic synergist, pharmaceutical composition, preparation and application

By combining santhin with tetracycline antibiotics, a specific proportion of drug composition is formed, which solves the problem of infection of tetracycline antibiotic-resistant bacteria, and achieves effective antibacterial effect and dosage optimization for drug-resistant bacteria.

CN120392736APending Publication Date: 2025-08-01SHANDONG JIANZHU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510903921.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-01
Publication Date
2025-08-01

AI Technical Summary

Technical Problem

The prior art has failed to effectively deal with tetracycline antibiotic-resistant bacteria infection, resulting in an increased risk of treatment failure, and it is urgent to develop more targeted synergists.

Method used

Sangxin and tetracycline antibiotics are used to combine the tetracycline antibiotics. By adding sangxin to the tetracycline antibiotic preparation, a specific proportion of the pharmaceutical composition is formed, which significantly reduces the minimum inhibitory concentration of drug-resistant bacteria and enhances the antibacterial effect.

Benefits of technology

It significantly reduces the minimum inhibitory concentration of tetracycline antibiotics against drug-resistant bacteria, expands the clinical application scope of tetracycline antibiotics, reduces the need for use doses, and improves the therapeutic effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
  • Figure SMS_4
    Figure SMS_4
Patent Text Reader

Abstract

The invention discloses application of morusin in preparation of a tetracycline antibiotic synergist, a pharmaceutical composition, a preparation and application, and belongs to the field of medicines. The morusin can be used as an inhibitor of tetracycline antibiotic drug-resistant protein, and is used for being combined with tetracycline antibiotics to treat drug-resistant bacterium infection. By adding morusin into various preparations of the tetracycline antibiotics, the minimum inhibitory concentration of drug-resistant bacteria can be obviously reduced, and the bacteriostatic effect of the tetracycline antibiotics on the drug-resistant bacteria can be enhanced, so that the clinical application of the tetracycline antibiotics is expanded, and the benefit is also expanded. Aiming at an experimental subject having generated tetracycline antibiotic resistance, compared with single use of the tetracycline antibiotic, the combined use of morusin and tetracycline antibiotic has the advantages that MICs are from gt; the content of morusin is reduced from 128 mg / L to 4 mg / L, and a better antibacterial effect can still be achieved even if a relatively low dosage of tetracycline antibiotics is used, so that morusin can be used as a tetracycline antibiotic synergist.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of medicine, and specifically relates to the application of sanggenin in the preparation of a synergist for tetracycline antibiotics, a pharmaceutical composition, a preparation and an application. Background Art

[0002] Disclosing the information of this background art section is only intended to increase the understanding of the overall background of the present invention, and is not necessarily regarded as an admission or an implication in any form that this information constitutes the prior art already known to those of ordinary skill in the art.

[0003] The increasingly severe bacterial resistance has severely weakened the clinical efficacy of traditional effective drugs such as tetracycline antibiotics, resulting in a significant increase in the minimum inhibitory concentration (MIC) and an increased risk of treatment failure. In order to overcome drug resistance, finding synergists that can enhance the activity of existing antibiotics has become an important strategy. In the prior art, flavonoids (such as quercetin, baicalein, etc.) have been reported to be used as synergists for certain antibiotics due to their natural sources and biological activities, and play a synergistic antibacterial role through mechanisms such as inhibiting efflux pumps or disrupting biofilms.

[0004] However, the above prior art mainly focuses on the treatment of non-drug-resistant bacterial infections and does not involve the treatment of drug-resistant bacterial infections. Therefore, it is urgent to develop more effective and more targeted new tetracycline antibiotic synergists to address the problem of stubborn drug-resistant bacterial infections. Summary of the Invention

[0005] In order to solve the deficiencies of the prior art, the purpose of the present invention is to provide the application of sanggenin in the preparation of a synergist for tetracycline antibiotics, a pharmaceutical composition, a preparation and an application. The present invention provides the application of sanggenin as a synergist for tetracycline antibiotics. The combination of sanggenin and tetracycline antibiotics can effectively kill tetracycline antibiotic-resistant bacteria and is expected to be applied to the clinical treatment of tetracycline antibiotic-resistant bacterial infections.

[0006] In order to achieve the above purpose, the technical solution of the present invention is as follows: In the first aspect of the present invention, there is provided the application of sanggenin in the preparation of a synergist for tetracycline antibiotics.

[0007] The structure of the sanggenin is as follows: 。

[0008] Mulberroside is a natural flavonoid compound extracted from mulberry leaves, with activities such as antioxidant, anti-inflammatory, and metabolic regulation. The research of this invention finds that mulberroside can be used as a synergist for tetracycline antibiotics and is used in combination with tetracycline antibiotics to treat infections caused by tetracycline-resistant bacteria. Adding mulberroside to various preparations of tetracycline antibiotics can significantly reduce the minimum inhibitory concentration of resistant bacteria and enhance the antibacterial effect of tetracycline antibiotics against resistant bacteria.

[0009] In some embodiments of this invention, the mass ratio of mulberroside to tetracycline antibiotics is 1:(0.1 - 26).

[0010] Preferably, the mass ratio of mulberroside to tetracycline antibiotics is 1:(0.1 - 25.6).

[0011] It can be understood that to achieve the bactericidal effect, it is more important to meet the absolute mass. For example, when the mass ratio of mulberroside to tetracycline antibiotics is 1:0.8 and the concentration of tetracycline antibiotics reaches above 2 mg / L, the concentration of mulberroside should reach above 2.5 mg / L.

[0012] It can be understood that this range is the optimal synergistic interval. At this ratio, mulberroside can maximize the reversal of drug resistance and significantly reduce the MIC value of tetracycline antibiotics against resistant bacteria. And this ratio also reflects the critical effective concentration required for mulberroside to overcome specific drug resistance mechanisms. When the mass ratio of mulberroside to tetracycline antibiotics is lower than 1:0.1 (i.e., mulberroside is in excess), it may produce non-specific cytotoxicity or interfere with antibiotic activity; when it is higher than 1:25.6 (i.e., mulberroside is insufficient), mulberroside cannot effectively block the drug resistance pathway.

[0013] In some embodiments of this invention, the tetracycline antibiotics are tetracycline, chlortetracycline, minocycline, or doxycycline.

[0014] This invention verifies through experimental data that when mulberroside is used in combination with these four specific antibiotics, there is a significant synergistic effect and can significantly reduce their MIC values under a defined ratio.

[0015] In some embodiments of this invention, the tetracycline antibiotic is doxycycline.

[0016] It can be understood that when mulberroside is used in combination with doxycycline, the synergistic effect is more significant and the MIC value is lower.

[0017] The second aspect of this invention provides a pharmaceutical composition, comprising mulberroside and tetracycline antibiotics; The mass ratio of mulberroside to tetracycline antibiotics is 1:(0.1 - 26).

[0018] When sanggenin is used in combination with tetracycline antibiotics, it has a synergistic effect and can effectively kill tetracycline-resistant bacteria. In the pharmaceutical composition of the present invention, sanggenin and tetracycline antibiotics are used in combination. Taking doxycycline as an example for experiments, it is found that sanggenin reduces the dosage of doxycycline, lowers the MICs, and expands the clinical application of doxycycline. It can be understood that in the pharmaceutical composition, sanggenin and tetracycline antibiotics are active ingredients.

[0019] In some embodiments of the present invention, the tetracycline antibiotics are tetracycline, chlortetracycline, minocycline or doxycycline. The present invention verifies through experimental data that when sanggenin is combined with these four specific antibiotics, there is a significant synergistic effect and can significantly reduce their MIC values at a defined ratio.

[0020] In some embodiments of the present invention, the tetracycline antibiotic is doxycycline. When sanggenin is combined with doxycycline, the synergistic effect is more significant and the MIC value is lower.

[0021] In the third aspect of the present invention, there is provided a pharmaceutical preparation, comprising the above-mentioned pharmaceutical composition and pharmaceutically acceptable excipients.

[0022] In some embodiments of the present invention, the pharmaceutically acceptable excipients include, but are not limited to, carriers, excipients.

[0023] In some embodiments of the present invention, the carrier includes, but is not limited to, at least one of aluminum oxide, aluminum stearate, polyvinylpyrrolidone, polyethylene glycol, sodium carboxymethylcellulose, polyacrylate, beeswax and lanolin.

[0024] In some embodiments of the present invention, the excipient includes, but is not limited to, at least one of binder, filler, lubricant, disintegrant and wetting agent. The binder includes, but is not limited to, at least one of syrup, gum arabic and sorbitol. The filler includes, but is not limited to, at least one of lactose, corn starch and glycine. The lubricant includes, but is not limited to, at least one of magnesium stearate, talc and silica. The wetting agent includes, but is not limited to, sodium lauryl sulfate.

[0025] In some embodiments of the present invention, the dosage form of the pharmaceutical preparation is an oral preparation, an injection preparation or a topical preparation.

[0026] In some embodiments of the present invention, the oral preparation is tablets, capsules, granules, dripping pills, concentrated pills or liquid preparations; The injection preparation is a liquid injection, a powder for injection or a tablet for injection; The topical preparation is a topical solvent, ointment, patch, topical powder or inhalant.

[0027] The present invention also provides a method for preparing the above-mentioned pharmaceutical preparation, which includes: mixing the above-mentioned pharmaceutical composition and pharmaceutically acceptable excipients in proportion, and preparing the pharmaceutical preparation according to the requirements of different dosage forms.

[0028] The fourth aspect of the present invention provides an application of the above-mentioned pharmaceutical composition or the above-mentioned pharmaceutical preparation in the preparation of a drug for treating bacterial infections.

[0029] In some embodiments of the present invention, the bacterium is a tetracycline-resistant bacterium, and further preferably Enterobacter roggenkampii ( Enterobacter roggenkampii ).

[0030] The beneficial effects of the present invention are as follows: The present invention provides an application of moracin in the preparation of a tetracycline antibiotic synergist. Moracin can be used as an inhibitor of tetracycline-resistant proteins and is used in combination with tetracycline antibiotics to treat drug-resistant bacterial infections. Adding moracin to various preparations of tetracycline antibiotics can significantly reduce the minimum inhibitory concentration of drug-resistant bacteria and enhance the antibacterial effect of tetracycline antibiotics against drug-resistant bacteria. This not only expands the clinical application of tetracycline antibiotics but also increases the benefits, which is more in line with the current level of the pharmaceutical industry and the status of pharmaceutical investment from the principle of pharmaceutical economics. Experimental results confirm that for experimental subjects that have developed resistance to tetracycline antibiotics, when moracin and tetracycline antibiotics are used in combination, the MICs are reduced from >128 mg / L to 4 mg / L compared with using tetracycline antibiotics alone. Even when using a lower dose of tetracycline antibiotics, a better antibacterial effect can still be achieved, indicating that moracin can be used as a tetracycline antibiotic synergist. Detailed implementation manners

[0031] The present invention discloses the application of moracin in the preparation of a tetracycline antibiotic synergist, a pharmaceutical composition, a preparation and an application. Those skilled in the art can draw on the content of this article and appropriately modify the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and those related can obviously make changes or appropriate modifications and combinations to the methods and applications in this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention. The present invention is further described below in conjunction with embodiments: Example 1 The application of moracin in the preparation of a tetracycline antibiotic synergist, that is, when tetracycline antibiotics and moracin are used in combination, they have a synergistic antibacterial effect on multi-drug resistant bacteria.

[0032] The multi-drug resistant bacterial strain in this example Enterobacter roggenkampiiPOL1 was isolated and preserved in the laboratory. Enterobacter roggenkampii The genomic sequence information of POL1 is stored in the NCBI database, and the genomic accession numbers are: CP086405 - CP086407.

[0033] Doxycycline hydrochloride, CAS: 10592 - 13 - 9, purity ≥95%, was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.

[0034] Tetracycline, CAS: 60 - 54 - 8, purity ≥96%, was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.

[0035] Chlortetracycline, CAS: 57 - 62 - 5, purity ≥98%, was purchased from Shanghai Macklin Biochemical Co., Ltd.

[0036] Minocycline, CAS number: 10118 - 90 - 8, purity ≥98%, was purchased from Shanghai Macklin Biochemical Co., Ltd.

[0037] Sanggenin, CAS: 62596 - 29 - 6, purity ≥98%, was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.

[0038] Stock solutions of doxycycline hydrochloride, tetracycline, chlortetracycline, and minocycline were prepared at 64 mg / mL with sterile water and filtered through a 0.22 μm filter membrane to sterilize.

[0039] Sanggenin was prepared as a 5 mg / mL stock solution with dimethyl sulfoxide (DMSO) and filtered through a 0.22 μm filter membrane to sterilize.

[0040] According to the CLSI regulations, the minimum inhibitory concentrations (MICs) of doxycycline, tetracycline, chlortetracycline, minocycline, and sanggenin against the drug - resistant bacterium POL1 were determined by the microbroth dilution method.

[0041] 5 mg / L of sanggenin was added to the multidrug - resistant bacterium POL1, and antibiotics with gradient concentrations of 2 - 128 mg / L were added simultaneously. The growth of POL1 bacteria was detected using a microplate reader to obtain the minimum inhibitory concentrations (MICs) of the combination of doxycycline, tetracycline, chlortetracycline, minocycline, and sanggenin against the drug - resistant bacterium POL1.

[0042] Table 1 MICs (mg / L) of the multidrug - resistant bacterium POL1

[0043] As shown in Table 1, the MICs of the POL1 strain against doxycycline, tetracycline, chlortetracycline, minocycline, and sanggenin were all >128 mg / L, indicating that the POL1 strain was resistant to doxycycline, tetracycline, chlortetracycline, minocycline, and sanggenin.

[0044] When 5 mg / L moracin was added, the MICs of POL1 strain against the combination of doxycycline, tetracycline, chlortetracycline, minocycline and moracin were significantly reduced, indicating that the combination of tetracycline antibiotics and moracin had a synergistic antibacterial effect on drug-resistant bacteria.

[0045] As can be seen from Example 1, when tetracycline antibiotics and moracin were used in combination, the combination of minocycline and moracin had the best effect, followed by the combination of doxycycline and moracin, and the effects of the two combinations were not much different. Since minocycline is more expensive than doxycycline, for cost considerations, the combination of doxycycline and moracin was used in the following experiments.

[0046] Example 2 Moracin inhibits the drug-resistant function of doxycycline-resistant genes.

[0047] Through previous studies, it was confirmed that one of the doxycycline-resistant genes in POL1 was LMJ44_RS08130. The doxycycline-resistant gene in the above POL1 strain was amplified by overlapping PCR and ligated downstream of the Escherichia coli promoter. After the recombinant vector was verified by sequencing, it was transformed into Escherichia coli DH5α strain to obtain a heterologous expression recombinant strain C8130.

[0048] Primers: F: aatattgaaaaaggaagagtatgtcccgcgtatcacaggc (SEQ ID NO.1); R: ctacgcgccaggctcgagca (SEQ ID NO.2).

[0049] MIC detection showed that the MIC value of doxycycline for strain C8130 was 64 mg / L (Table 2), while the MIC value of doxycycline for the starting strain DH5α was <2 mg / L, and the MIC value for moracin was >128 mg / L. When 2.5 mg / L - 10 mg / L moracin was added, the MIC value of doxycycline for strain C8130 decreased significantly, reaching as low as <2 mg / L, showing sensitivity to doxycycline.

[0050] Table 2 MICs of doxycycline and moracin (mg / L)

[0051] Example 3 Effect of the combination of doxycycline and moracin on acute peritonitis in mice.

[0052] An acute peritonitis model in mice was established by intraperitoneal injection of strain C8130. In the drug administration group, doxycycline (0.1 mg) or doxycycline + moracin (0.1 mg + 0.2 mg) was injected twice a day. In the non-drug administration group, an equal volume of normal saline was injected. Then, peritoneal fluid was collected at 24 hours, 48 hours, and 72 hours for bacterial culture, identification, and counting. At the same time, blood was collected from the tail vein to count the total number of peripheral blood leukocytes, and the anti-infective treatment effect of combined use of doxycycline and moracin was observed.

[0053] Table 3 Bacterial and peripheral blood leukocyte counts in peritoneal fluid of mice in each group at 72 hours

[0054] The results showed that the combined administration group of doxycycline and moracin had cleared the bacterial infection at 72 hours, no bacteria were detected in the peritoneal fluid, and the total number of peripheral blood leukocytes was within the normal range (Table 3). The group administered with doxycycline alone or the non-drug administration group still showed symptoms of peritonitis at 72 hours, and some experimental mice died.

[0055] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Use of moracin in the preparation of a synergist for tetracycline antibiotics.

2. The application according to claim 1, characterized in that, The mass ratio of moracin to tetracycline antibiotics is 1:(0.1 - 26).

3. The application according to claim 1, characterized in that, The tetracycline antibiotics are tetracycline, chlortetracycline, minocycline or doxycycline.

4. The application according to claim 1, wherein The tetracycline antibiotic is doxycycline.

5. A pharmaceutical composition, characterized in that, It includes moracin and tetracycline antibiotics; The mass ratio of moracin to tetracycline antibiotics is 1:(0.1 - 26).

6. The pharmaceutical composition according to claim 5, characterized in that, The tetracycline antibiotics are tetracycline, chlortetracycline, minocycline or doxycycline; Preferably, the tetracycline antibiotic is doxycycline.

7. A pharmaceutical preparation, characterized in that, It includes the pharmaceutical composition according to claim 5 or 6 and a pharmaceutically acceptable excipient.

8. The pharmaceutical preparation according to claim 7, characterized in that, The pharmaceutically acceptable excipient includes a carrier, an excipient; Preferably, the carrier includes at least one of aluminum oxide, aluminum stearate, polyvinylpyrrolidone, polyethylene glycol, sodium carboxymethylcellulose, polyacrylate, beeswax and lanolin; Preferably, the excipient includes at least one of a binder, a filler, a lubricant, a disintegrant, a humectant.

9. The pharmaceutical preparation according to claim 7, characterized in that, The dosage form of the pharmaceutical preparation is an oral preparation, an injection preparation or a topical preparation; Preferably, the oral preparation is a tablet, a capsule, a granule, a dropping pill, a concentrated pill or a liquid; The injection preparation is a liquid injection, a powder for injection or a tablet for injection; The topical preparation is a topical solvent, an ointment, a patch, a topical powder or an inhalant.

10. Use of the pharmaceutical composition according to claim 5 or 6 or the pharmaceutical preparation according to any one of claims 7 - 9 in the preparation of a drug for treating bacterial infections; Preferably, the bacterium is a tetracycline antibiotic-resistant bacterium, and more preferably Enterobacter roggenkampii( Enterobacter roggenkampii ).