Electrochemical biosensing system for detecting BVDV based on CRISPR-Cas13a and application of electrochemical biosensing system

Abstract

The invention discloses an electrochemical biosensing system for detecting BVDV (bovine viral diarrhea virus) based on CRISPR-Cas13a (clustered regularly interspaced short palindromic repeats). The electrochemical biosensing system comprises an electrochemical biosensor and a CRISPR-Cas13a system, the electrochemical biosensor comprises a working electrode, and the surface of the working electrode is modified with an MB-RNA probe; one end of the MB-RNA probe is modified with sulfydryl, the other end of the MB-RNA probe is modified with signal molecules, and the MB-RNA probe is connected with the working electrode through an Au-S bond; the CRISPR-Cas13a system comprises a crRNA (Complementary Ribonucleic Acid) group and Cas13a; and the crRNA group comprises at least one of BVDV (bovine viral diarrhea virus)-crRNA 2, BVDV-crRNA 7, BVDV-crRNA 8, BVDV-crRNA 11, BVDV-crRNA 12 and BVDV-crRNA 14. The electrochemical biosensing system disclosed by the invention has extremely high clinical sensitivity and clinical specificity on the BVDV virus.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular, to an electrochemical biosensing system for detecting BVDV based on CRISPR-Cas13a and its application. Background Art

[0002] Bovine Viral Diarrhea Virus (BVDV) is an enveloped single-stranded RNA virus belonging to the genus Pestivirus of the family Flaviviridae. Its genome length is about 12.5 kb and it replicates in various cells of cattle, mainly affecting the immune system and digestive system of cattle. BVDV infection can cause Bovine Viral Diarrhea (BVD), with diverse clinical manifestations including acute diarrhea, fever, oral ulcers, respiratory symptoms, reproductive disorders (such as abortion, stillbirth), and immunosuppression. Immunosuppression can lead to secondary infections, increasing the complexity and severity of the disease. BVDV infection poses a great threat to cattle herds, especially Persistently Infected (PI) cattle, which are the main sources of virus transmission. PI cattle are usually infected with non-cytopathic BVDV strains in the early stage of pregnancy (the first 120 days), resulting in fetal immune tolerance and lifelong virus carriage. PI cattle have a high incidence and mortality rate, and have a long-term impact on the health and production performance of cattle herds. BVDV poses a serious threat to the global cattle industry, not only causing direct economic losses (such as decreased production performance, reproductive problems, death, etc.), but also indirectly affecting food safety and international trade.

[0003] Currently, methods such as virus isolation, electron microscopy, immunofluorescence (IFA), loop-mediated isothermal amplification (LAMP), antigen enzyme-linked immunosorbent assay (ELISA), reverse transcription polymerase chain reaction (RT-PCR), quantitative PCR (qPCR), and high-throughput sequencing are usually used to detect whether cattle are infected with BVDV. These techniques are labor-intensive and time-consuming, have false positives, rely on professional technical personnel and laboratory platforms, require expensive instruments, and are not suitable for on-site timely and rapid detection.

[0004] Therefore, there is an urgent need to establish a rapid, accurate, convenient, low-cost, highly sensitive, and highly specific detection technology to achieve the purpose of quickly controlling the prevalence of BVDV and preventing its further spread.

[0005] CRISPR / Cas13a (Clustered Regularly Interspaced Short Palindromic Repeat) is a branch of the CRISPR / Cas system. The CRISPR-Cas system is an acquired immune system in bacteria used to combat foreign DNA, plasmids, and phages that invade bacteria. The CRISPR-Cas system consists of two parts: the CRISPR locus and the Cas genes. Among them, the CRISPR locus is mainly composed of a leader sequence, repeat sequences, and spacer sequences. Approximately dozens of proteins, including Cas9, Cas12a, and Cas13a, are encoded by the Cas genes and are associated with CRISPR. Based on Cas proteins with different functions, this system has developed gene editing technologies, gene therapy technologies, molecular biology detection technologies, etc. The CRISPR / Cas13a technology guides the Cas13a protein to cleave substrate RNA or ssRNA by designing and synthesizing a crRNA sequence of about 20 bp that is complementary to the target sequence, and at the same time triggers the cleavage function of this system on any RNA around the reaction environment. If a reporter RNA that fluoresces when cleaved is added to this reaction system, fluorescence can be generated after the substrate RNA contacts and reacts with CRISPR / Cas13a. By collecting the fluorescence signal with a fluorescence quantitative instrument, the detection of substrate RNA can be achieved, or only by observing the reaction product with a blue light transilluminator, the detection result can be determined. This detection can not only be used to detect some RNA fragments including microRNA, but also complete the nucleic acid molecule detection of pathogens such as viruses and bacteria after combination with technologies such as RT-RAA (Recombinase Polymerase Amplification Technology).

[0006] As a miniature device that combines biosensing and electrochemical analysis technologies, electrochemical biosensors have the advantages of fast response, simple operation, good selectivity, and high sensitivity. Combining the CRISPR / Cas system with electrochemical biosensors (CRISPR / Cas integrated electrochemical biosensors, E-CRISPR) can enhance sensitivity and specificity, and achieve rapid and accurate detection by shortening the detection time at low concentrations. Summary of the Invention

[0007] The present invention provides an electrochemical biosensing system for detecting BVDV based on CRISPR-Cas13a and its application. This electrochemical biosensing system has extremely high clinical sensitivity and clinical specificity for BVDV virus.

[0008] The technical solution of the present invention is as follows:

[0009] A crRNA set of CRISPR-Cas13a for detecting BVDV, comprising at least one of BVDV-crRNA 2, BVDV-crRNA7, BVDV-crRNA 8, BVDV-crRNA 11, BVDV-crRNA 12, and BVDV-crRNA 14;

[0010] The nucleotide sequence of BVDV-crRNA 2 is shown in SEQ ID NO.35, the nucleotide sequence of BVDV-crRNA 7 is shown in SEQ ID NO.40, the nucleotide sequence of BVDV-crRNA 8 is shown in SEQ ID NO.41, the nucleotide sequence of BVDV-crRNA 11 is shown in SEQ ID NO.44, the nucleotide sequence of BVDV-crRNA 12 is shown in SEQ ID NO.45, and the nucleotide sequence of BVDV-crRNA 14 is shown in SEQ ID NO.47.

[0011] The nucleotide sequence of BVDV-crRNA 2 is: GAUUUAGACUACCCCAAAAAC GAAGGGGACUAAAACCCCAAUGUGUAUACGAGUAUUUUUAUC;

[0012] The nucleotide sequence of BVDV-crRNA 7 is: GAUUUAGACUACCCCAAAAAC GAAGGGGACUAAAACCUUUAGCGUCGAUUGUGGGUGGAUUGC;

[0013] The nucleotide sequence of BVDV-crRNA 8 is: GAUUUAGACUACCCCAAAAAC GAAGGGGACUAAAACAGAUGCCAAAUCGGUAGGAACGUUGCG;

[0014] The nucleotide sequence of BVDV-crRNA 11 is: GAUUUAGACUACCCCAAAAA CGAAGGGGACUAAAACCGUCCACGUGGCAUCUCGAGACCUUCA;

[0015] The nucleotide sequence of BVDV-crRNA 12 is: GAUUUAGACUACCCCAAAAA CGAAGGGGACUAAAACCAAUUCCAUGUGCCAUGUACAGCAGAG;

[0016] The nucleotide sequence of BVDV-crRNA 14 is: GAUUUAGACUACCCCAAAAA CGAAGGGGACUAAAACAGCAGUUGAUCAAACUGUUUUCGUCCG.

[0017] An electrochemical biosensing system for detecting BVDV based on CRISPR-Cas13a, comprising an electrochemical biosensor and a CRISPR-Cas13a system;

[0018] The electrochemical biosensor described above includes a working electrode, and the surface of the working electrode is modified with an MB-RNA probe; one end of the MB-RNA probe is modified with a thiol group and the other end is modified with a signal molecule, and the MB-RNA probe is connected to the working electrode through an Au-S bond;

[0019] The CRISPR-Cas13a system includes the above-mentioned crRNA group and Cas13a.

[0020] Bind Cas13a with crRNA to form a Cas13a-crRNA complex. After mixing the sample to be tested with the Cas13a-crRNA complex, drop it onto the surface of the working electrode of the electrochemical sensor for reaction. Determine whether the sample to be tested contains BVDV virus by the change rate ΔI(%) of the SWV current peak value of the electrode before and after the reaction. Compared with before the reaction, in the reaction system containing BVDV virus, the SWV current peak value of the electrode after electrochemical detection becomes significantly smaller, while in the reaction system without BVDV virus (negative), the SWV current peak value of the electrode after electrochemical detection has no obvious change.

[0021] Preferably, the Cas13a is LwaCas13a.

[0022] Preferably, the nucleotide sequence of the MB-RNA probe is as shown in SEQ ID NO.49. The nucleotide sequence of the MB-RNA probe is AAUGGCAAAUGGCA.

[0023] The substrate of the working electrode is a screen-printed gold electrode (SPGEs).

[0024] The preparation method of the working electrode includes: incubating and modifying the MB-RNA probe on the surface of the substrate of the working electrode, and incubating and blocking the remaining sites with 6-mercapto-1-hexanol (MCH).

[0025] Further, the preparation method of the working electrode includes: pouring the solution of the MB-RNA probe reduced by TCEP-HCl onto the surface of the substrate of the working electrode, incubating at 37 °C for 1-2 h, and then dropping 6-mercapto-1-hexanol onto the surface of the working electrode and culturing at 37 °C for 10-30 min to block the unbound sites on the surface of the working electrode.

[0026] Preferably, the electrochemical biosensor system further includes a counter electrode and a reference electrode; the counter electrode is made of gold, and the reference electrode is silver-silver chloride.

[0027] The present invention also provides the application of the electrochemical biosensing system in the preparation of products for detecting BVDV.

[0028] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0029] In the present invention, the MB-RNA probe is modified onto the working electrode and coupled with a highly specific Cas13a enzyme cleavage system to construct an electrochemical biosensor based on CRISPR-Cas13a for detecting BVDV RNA, which has extremely high clinical sensitivity and clinical specificity; the whole detection is completed within 35-60 min, solving the problems of high detection cost, long detection time, insufficient sensitivity, etc., and is suitable for the point-of-care testing of BVDV. Description of the Drawings

[0030] Figure 1 It is the schematic diagram of the electrochemical biosensor for detecting BVDV based on the CRISPR-Cas13a system of the present invention;

[0031] Figure 2 It is the design and screening results of crRNA: (A) the sequence sites specifically recognized by crRNA; (B) single crRNA, (C) the screening results of 2 crRNAs and (D) the screening results of 3 crRNA combinations;

[0032] Figure 3 It is the experimental result of the detection limit of the electrochemical detection of BVDV based on the CRISPR-Cas13a system: (A) the SWV curves with the target RNA concentration ranging from 10 2 to 10 8 fg / mL, (B) the linear relationship between the current change (ΔI) and the logarithm of the target RNA concentration;

[0033] Figure 4 It is the experimental result of the specificity of the electrochemical detection of BVDV based on the CRISPR-Cas13a system;

[0034] Figure 5Experimental results of electrochemical detection of BVDV actual samples based on the CRISPR-Cas13a system: (A) Current response values (%) of positive and negative samples and RT-qPCR Ct values, (B) Comparison results of electrochemical detection of positive and negative samples. Detailed implementation manners

[0035] The present invention will be further described in detail below in conjunction with the accompanying drawings and embodiments. It should be noted that the following embodiments are intended to facilitate the understanding of the present invention and do not limit it in any way.

[0036] The present invention generally and / or specifically describes the materials and test methods used in the experiments. Although many materials and operation methods used to achieve the purpose of the present invention are well known in the art, the present invention still describes them in as much detail as possible here.

[0037] For the instruments, reagents, materials, etc. involved in the following embodiments, unless otherwise specified, they are all conventional instruments, reagents, materials, etc. existing in the prior art and can be obtained through regular commercial channels. For the experimental methods, detection methods, etc. involved in the following embodiments, unless otherwise specified, they are all conventional experimental methods, detection methods, etc. existing in the prior art.

[0038] The sources of the raw materials involved in the following embodiments are shown in Table 1:

[0039] Table 1 Names and manufacturers of raw materials

[0040] Raw material name Manufacturer TCEP-HCl Sigma,646547 6-Mercapto-1-hexanol MCH Sigma-Aldrich,451088 Screen-printed gold electrode Changsha Sanjun Biotechnology (Hunan) Co., Ltd. DEPC water Sangon Biotech (Shanghai) Co., Ltd.

[0041] The Cas13a protein in the following embodiments is the LwaCas13a protein.

[0042] The MB-RNA probe (SH-ssRNA-MB) used in the present invention was synthesized by Sangon Biotech (Shanghai) Co., Ltd.; primers, crRNA, and target RNA were synthesized by General Biosystems (Anhui) Co., Ltd.

[0043] All electrochemical signals were measured by a CHI 630E electrochemical workstation (Chenhua, Shanghai, China). The screen-printed gold electrode was purchased from Changsha Sanjun Biotechnology Co., Ltd. (Hunan, China). The electrode system includes an Ag / AgCl electrode, a gold electrode, and a gold electrode as the reference electrode, auxiliary electrode, and working electrode, respectively.

[0044] The principle of the electrochemical biosensor for detecting BVDV based on the CRISPR-Cas13a system is as Figure 1 shown.

[0045] The experimental steps are as follows:

[0046] I. Cleaning of Electrochemical Biosensor

[0047] The screen-printed gold electrodes (SPGEs) were ultrasonically treated in deionized water for 5 min to remove surface impurities and then dried at room temperature. Electrochemical cleaning and electro-activation were carried out by cyclic voltammetry (CV) in PBS buffer. After the CV curve was stable, the SPGEs were rinsed with deionized water and dried at room temperature.

[0048] II. Modification of MB-RNA Probe

[0049] First, the 5 μM MB-RNA probe was reduced with 10 mM TCEP-HCl in a metal bath at 37 °C in the dark for 60 min. Then, 10 μL of the 2.5 μM MB-RNA probe solution was cast on the working electrode and incubated in an electroculture incubator at 37 °C for 2 h to immobilize the MB-RNA probe on the surface of SPGEs through Au-S bonds. Subsequently, it was rinsed with 10 mM Tris buffer and dried at room temperature.

[0050] 20 μL of 2 mM MCH (6-mercapto-1-hexanol) was dropped on the working electrode area and incubated at 37 °C for 30 min to fill the unbound sites on the surface of the working electrode and reduce the false positive signals caused by non-specific binding during the detection process. Finally, it was rinsed with water and dried at room temperature.

[0051] III. Preparation of RNA Standard and crRNA of BVDV

[0052] The sequence of the BVDV 5’-UTR gene (GenBank: AF091605.1) was synthesized into the pUC-57 plasmid. Using the pUC-57-BVDV plasmid (commissioned from Anhui General Synthesis) as a template, a T7 promoter was added to the 5’ end of the upstream primer during primer design. The primers were designed as follows:

[0053] BVDV-F: TAATACGACTCACTATAGGGGTATACGAGAGTTAGATAAAA ATACTCGTATACACATTGG (SEQ ID No.2);

[0054] BVDV-R: CTTCAGGTAGATTCCACTCACCGG (SEQ ID No.3).

[0055] The PCR amplification reagents were prepared according to Table 2 below.

[0056] Table 2 PCR Amplification System

[0057] Reagent Sample loading volume BVDV-F (10 μM) 1 μL BVDV-R (10 μM) 1 μL pUC-57-BVDV (100 ng / μL) 1 μL Fast PCR Master Mix (Takara) 10 μL <![CDATA[ddH2O]]> To a total volume of 20 μL

[0058] The amplified PCR products were purified and recovered, and T7 transcription was performed using the T7 High Yield RNA Transcription Kit (Nanjing Novoprotein). The transcription products were purified using an RNA purification kit (Tiangen) to obtain the RNA standard of BVDV (the sequence is shown in SEQ ID No.1).

[0059] GTATACGAGAGTTAGATAAAAATACTCGTATACACATTGGGCAATTAAAAGTAATAATTAGGCCTAGGGAACGAATCCTCCTCCGCGAAGGCCGAAAAGAGGCTAGCCATGCCCTTAGTAGGACTAGCATAGCGAGGGGGGTAGCAACAGTGGTGAGTTCGTTGGATGGCTTAAGCCCTGAGTACAGGGTAGTCGTCAGTGGTTCGACGCCTTAACATGAAGGTCTCGAGATGCCACGTGGACGAGGGCACGCCCAAAGCACATCTTAGCCCGAGCGGGGGTCGCTCGGACGAAAACAGTTTGATCAACTGCTACGAATACAGCCTGATAGGGTGCTGCAGAGGCCCACTGTATTGCTACTAAAAATCTCTGCTGTACATGGCACATGGAATTGATTACAAATGAACTCTTATACAAAACATACAAACAAAAACCCGTCGGGGTGGAGGAACCTGTTTACGACCAGGCAGGCAATCCTTTATTCGGTGAAAGGGGAGCAATCCACCCACAATCGACGCTAAAGCTCCCACACAAGAGAGGGGAACGCAACGTTCCTACCGATTTGGCATCTTTACCAAAAAGAGGTGACTGTAGGTCGGGTAACAGCAAAGGACCGGTGAGTGGAATCTACCTGAAG(SEQ ID No.1).

[0060] IV. Preparation and screening of BVDV-crRNA

[0061] 1. Preparation of BVDV-crRNA

[0062] Using the BVDV 5'-UTR gene sequence as a target, 15 crRNAs were designed. Double-stranded DNA was formed by annealing the upstream and downstream primers (Table 3), and the annealing program was as follows: 99°C for 10 min; 85°C for 5 min; 80°C for 5 min; 75°C for 5 min; 70°C for 5 min. The double-stranded DNA was purified and recovered using a 5-minute DNA rapid purification kit (TransGen Biotech, Beijing). Then, T7 transcription was performed using the T7 High Yield RNA Transcription Kit (Vazyme, Nanjing), and the transcription product was purified using an RNA purification kit (Tiangen) to obtain BVDV-crRNA (Table 4).

[0063] Table 3 Upstream and downstream primer sequences of BVDV-crRNA

[0064]

[0065]

[0066] Table 4 BVDV-crRNA sequences

[0067]

[0068]

[0069] 2. Screening of BVDV-crRNA

[0070] Fifteen crRNAs were screened using a fluorescence detection system. First, the CRISPR-Cas13a isothermal detection reagent was prepared, and the reaction system was as shown in Table 5 below (total volume 20 μL). The BVDV-Probe sequence was FAM- r U r U r U r U r U-BHQ1.

[0071] Table 5 CRISPR-Cas13a fluorescence detection system

[0072] Reagent composition Total volume 20 μL LwaCas13a (0.1 mg / mL) 1 RNase Inhibitor (40 U / μL) 0.5 crRNA (60 ng / μL) 1 BVDV-Probe (10 μM) 0.5 10×Buffer 2 <![CDATA[ddH2O]]> 12.5 Template 1 Total 20

[0073] The prepared reaction tubes were centrifuged and placed in an ABI Step One instrument, and the program was set as follows: pre-denaturation at 37°C for 1 s; denaturation at 37°C for 45 s, annealing and extension at 37°C for 15 s (fluorescence signal collection), for a total of 40 cycles. In the experimental results, the fluorescence values at 30 min were taken to compare the effects of each crRNA. The screening results are as Figure 2As shown, the results show that crRNA 2, crRNA 7, crRNA 8, crRNA 11, crRNA 12, crRNA 14 or their combinations have good effects, and the optimal one is the crRNA 2+8+14 combination, and its crRNA sequence is shown in Table 4.

[0074] V. Construction and Application of an Electrochemical Detection System for BVDV Based on the CRISPR-Cas13a System

[0075] Detection of BVDV was achieved by trans-cleaving the MB-RNA probe at the interface of the electrochemical sensor through the CRISPR / Cas13a system. The sequence of the MB-RNA probe was: SH-AAUGGCAAAUGG CA-MB (SEQ ID No. 49) (Reference: Bioelectrochemistry, 2023, 150: 108364.).

[0076] 1. Construction of an Electrochemical Biosensor Driven by CRISPR-Cas13a

[0077] Prepare the CRISPR-Cas13a cleavage reaction system according to Table 6.

[0078] Table 6 CRISPR-Cas13a Cleavage Reaction System for MB-RNA Probe

[0079] Reagent composition Total volume 20 μL LwaCas13a (0.1 mg / mL) 1 RNase Inhibitor (40 U / μL) 0.5 crRNA (60 ng / μL) 1 10×Buffer 2 <![CDATA[ddH2O]]> 12.5 Template 1 Total 20

[0080] Add 20 μL of the reaction system to the working electrode and incubate at 37 °C for 40 min.

[0081] Electrochemical SWV parameter settings: initial potential is -0.6 V, termination potential is -0.1 V, potential increment is 0.004 V, amplitude is 0.05 V, frequency is 50 Hz, static time is 2 s, and current range is 10E-5 A.

[0082] Take 40 μL of 10 mM Tris buffer (pH 8.0) containing 100 mM NaCl as the electrolyte and drop it on the SPGEs. Record the current values of the electrode sheet loaded with the MB probe before and after adding the CRISPR system. Calculate the change rate ΔI% value through the SWV peak current. After electrochemical detection in the reaction system containing the BVDV template, the characteristic peak current of MB is significantly smaller than that before the reaction, while in the reaction system without the BVDV template (negative), there is no obvious change in the characteristic peak current of MB after electrochemical detection.

[0083] 2. Sensitivity and Specificity of an Electrochemical Biosensor Driven by CRISPR-Cas13a

[0084] Dilute the BVDV template successively to 108 , 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 At the fg / mL concentration gradient, templates with different concentrations were added to the reaction system of Cas13a, dropped on the marked working electrode, and incubated at 37 °C for 30 minutes. After rinsing with ultrapure water and air-drying at room temperature, its SWV electrochemical signal was measured in 10 mM Tris buffer (pH 8.0) containing 100 mM NaCl. The experimental results are as Figure 3 shown in (A) below. The change in the electrochemical peak value of the SWV response is positively correlated with the template concentration. As the template concentration increases, the electrochemical peak value of SWV decreases more significantly. The linear regression equation, linear range, correlation coefficient, and detection limit are as Figure 3 shown in (B) below, where the linear regression equation is: Y = 8.3869X + 5.5796, R 2 = 0.9975; Y is the current response rate ΔI (%), X is the logarithm of the BVDV template concentration (fg / mL), and the lowest detection concentration reaches 3.5 fg / mL (about 10.9 copies / μL).

[0085] Furthermore, to exclude the non-specific effects of this method when detecting BVDV, experiments were conducted using Bovine parainfluenza virus type 3 (BPIV-3), Bovine respiratory syncytial virus (BRSV), Bluetongue virus (BTV), Foot-and-mouth disease virus (FMDV), etc. as targets. The results showed that only in the experiment with the addition of BVDV RNA samples, the value of ΔI (%) changed significantly, while the values of ΔI (%) of the remaining negative samples did not change. The results are shown in Figure 4 .

[0086] 3. To further ensure the accuracy of the scheme, a practical sample verification experiment was also conducted

[0087] Twenty-two blood samples were used to extract nucleic acids, and RT-qPCR and the method combining CRISPR with an electrochemical biosensor were used for detection respectively. The method combining CRISPR with an electrochemical biosensor obtained detection results consistent with those of methods such as RT-qPCR within 35 minutes (as Figure 5 ). However, the RT-qPCR method is relatively time-consuming, expensive in instruments, and cannot achieve on-site rapid detection.

[0088] The above-described embodiments have elaborated in detail the technical solutions and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not used to limit the present invention. Any modifications, supplements, equivalent replacements, etc. made within the principle scope of the present invention shall be included within the protection scope of the present invention.

Claims

1. A set of crRNAs of CRISPR-Cas13a for detecting BVDV, characterized in that, Comprising at least one of BVDV-crRNA 2, BVDV-crRNA 7, BVDV-crRNA 8, BVDV-crRNA 11, BVDV-crRNA 12, and BVDV-crRNA 14; The nucleotide sequence of BVDV-crRNA 2 is as shown in SEQ ID NO.35, the nucleotide sequence of BVDV-crRNA 7 is as shown in SEQ ID NO.40, the nucleotide sequence of BVDV-crRNA 8 is as shown in SEQ ID NO.41, the nucleotide sequence of BVDV-crRNA 11 is as shown in SEQ ID NO.44, the nucleotide sequence of BVDV-crRNA 12 is as shown in SEQ ID NO.45, and the nucleotide sequence of BVDV-crRNA 14 is as shown in SEQ ID NO.

47.

2. An electrochemical biosensing system for detecting BVDV based on CRISPR-Cas13a, characterized in that, Comprising an electrochemical biosensor and a CRISPR-Cas13a system; The electrochemical biosensor comprises a working electrode, and the surface of the working electrode is modified with an MB-RNA probe; one end of the MB-RNA probe is modified with a thiol group and the other end is modified with a signal molecule, and the MB-RNA probe is connected to the working electrode through an Au-S bond; The CRISPR-Cas13a system comprises the crRNA group as described in claim 1 and Cas13a.

3. The electrochemical biosensing system for detecting BVDV based on CRISPR-Cas13a according to claim 2, wherein The Cas13a is LwaCas13a.

4. The electrochemical biosensing system for detecting BVDV based on CRISPR-Cas13a according to claim 2, wherein The nucleotide sequence of the MB-RNA probe is as shown in SEQ ID NO.

49.

5. The electrochemical biosensing system for detecting BVDV based on CRISPR-Cas13a according to claim 2, wherein The preparation method of the working electrode comprises: incubating and modifying the MB-RNA probe on the surface of the substrate of the working electrode, and incubating and blocking the remaining sites with 6-mercapto-1-hexanol.

6. The electrochemical biosensing system for detecting BVDV based on CRISPR-Cas13a according to claim 5, wherein, The preparation method of the working electrode comprises: pouring the solution of the MB-RNA probe reduced by TCEP-HCl onto the surface of the substrate of the working electrode, incubating at 37 °C for 1-2 h, and then dropping 6-mercapto-1-hexanol on the surface of the working electrode and culturing at 37 °C for 10-30 min to block the unbound sites on the surface of the working electrode.

7. The electrochemical biosensing system for detecting BVDV based on CRISPR-Cas13a according to claim 5, wherein The substrate of the working electrode is a screen-printed gold electrode.

8. The electrochemical biosensing system for detecting BVDV based on CRISPR-Cas13a according to claim 8, characterized in that, The electrochemical biosensor system further comprises a counter electrode and a reference electrode; the counter electrode is gold, and the reference electrode is silver-silver chloride.

9. Use of an electrochemical biosensing system according to any one of claims 1-8 in the preparation of a product for detecting BVDV.

Images