Traditional Chinese medicine armadillidiam vulgare miRNA for inhibiting tumors, precursor sequence and application

Abstract

The invention belongs to the technical field of biomedicine, and particularly relates to a traditional Chinese medicine armadillidiam vulgare miRNA for inhibiting tumors, a precursor sequence and application, the sequence of the miRNA is SEQ ID NO.1, and the sequence of the SEQ ID NO.1 is TAATACTGTCAGGTAAAGATGTC; the compound has a good effect of inhibiting tumors, especially liver cancer.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and in particular relates to a traditional Chinese medicine pill bug miRNA for inhibiting tumors, a precursor sequence and an application thereof. Background Art

[0002] Armadillidium vulgare Latreille, also known as woodlice, is the dried body of the scutellaria beetle, a member of the family Carabidae. Its medicinal use was first documented in the Shennong Bencao Jing (Shen Nong's Classic of Materia Medica), and it boasts benefits such as dissolving blood stasis, eliminating symptoms, detoxifying, and alleviating pain. Woodlice are a common insect medicinal herb in ancient my country and among the common people. They are abundant and have a long history of medicinal use, and are effective in treating a variety of pain and inflammatory conditions. Woodlice are a key ingredient in Zhang Zhongjing's Biejia Jianwan (Tiejia Jianwan) recipe. Studies have shown that Biejia Jianwan can exert anti-liver cancer effects by reversing epithelial-mesenchymal transition, regulating tumor cell biological behavior, and improving the tumor microenvironment. Woodlice are used in the Biejia Jianwan recipe to dissolve blood stasis, dissipate nodules, and resolve depression. They are used to treat severe blood stasis symptoms such as lumps and masses, amenorrhea, and dysmenorrhea. They are also used in the treatment of primary liver cancer and liver metastases, softening and dispersing nodules and loosening the cancer's roots. Medicinal insects are an important component of cancer treatments and exhibit excellent anticancer activity. Insect-based medicines like woodlice can penetrate the meridians to eliminate pathogens, alleviate the local microenvironment, and even guide other drugs directly to the affected area, thereby fully exerting their therapeutic effects. Studies have found that woodlice ethanol reflux extract has an inhibitory effect on various cancer cells, including liver and breast cancer.

[0003] CN118516361A discloses a Chinese medicine pill bug microRNA and its application, which activates the cell apoptosis pathway by regulating the expression of Bcl-2 family proteins (such as Bcl-2, Bax), thereby inhibiting the proliferation, migration and invasion of liver cancer cells. CN119745909A discloses the application of a liver cancer cell iron death inducer miR-11085-5p in the preparation of a drug for treating liver cancer, which effectively induces liver cancer cells to undergo iron death by precisely regulating the key signaling pathway of intracellular AMPKα / Nrf2, significantly inhibiting its proliferation activity. Currently, miRNA mainly inhibits tumors by regulating tumor cell pathways. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a traditional Chinese medicine, pillbug miRNA, precursor sequence and application for inhibiting tumors, which has a good effect of inhibiting tumors, especially liver cancer.

[0005] An embodiment of the present invention provides a traditional Chinese medicine pill bug miRNA for inhibiting tumors. The sequence of the miRNA is SEQ ID NO.1, and the sequence of SEQ ID NO.1 is TAATACTGTCAGGTAAAGATGTC.

[0006] An embodiment of the present invention provides a precursor sequence having a stem-loop structure, comprising the traditional Chinese medicine pill bug miRNA for inhibiting tumors.

[0007] An embodiment of the present invention provides a use of the aforementioned traditional Chinese medicine armillary dander miRNA or the aforementioned precursor sequence for inhibiting tumors. The aforementioned traditional Chinese medicine armillary dander miRNA or the precursor sequence for inhibiting tumors is used to prepare an anti-tumor drug.

[0008] Preferably, the tumor is liver cancer.

[0009] The present invention has the beneficial effect of systematically studying the inhibitory effects of avu-miR-8 on the proliferation, migration, and invasion of liver cancer cells (HepG2 and MHCC97H) through a series of in vitro experiments. This is the first time that the role of avu-miR-8 in liver cancer cells has been discovered, and it has been demonstrated that it exerts anti-liver cancer effects by targeting specific genes (such as YAP1 and ZEB1). This study reveals the potential of miRNA in liver cancer treatment and provides a theoretical basis for future miRNA treatment strategies. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 Schematic diagram of the stable stem-loop structure of the miRNA precursor formed by the avu-miR-8 sequence of the present invention.

[0011] Figure 2 Schematic diagram of the stable stem-loop structure of the miRNA precursor formed by the dpu-bantam sequence of the present invention.

[0012] Figure 3 is the cell proliferation inhibition rate of different sequences in different tumor cells. Figure 3 A is HepG2 cells, Figure 3 B is MHCC97H cells. Note: * indicates P < 0.05, ** indicates P < 0.01.

[0013] Figure 4 is the cell migration rate of different sequences in different tumor cells. Figure 4 A is the migration photos of different sequences in HepG2 cells and the migration rate calculation results. Figure 4 B shows the migration photos and migration rate calculation results of different sequences in MHCC97H cells. Note: * indicates P < 0.05, ** indicates P < 0.01.

[0014] Figure 5 The figure shows the effect of different sequences on liver cancer cell invasion observed through Transwell invasion assay. Figure 5 A shows the microscopic photos and invasion rates of different sequences on HepG2 cells. Figure 5B shows the microscopic photos and invasion rates of different sequences on MHCC97H cells. Note: * indicates P < 0.05, ** indicates P < 0.01.

[0015] Figure 6 The luciferase activity test results after different sequences and different target genes are combined. Figure 6 A is a schematic diagram of the binding of avu-miR-8 and YAP1 target genes; Figure 6 B is the relative luciferase activity after binding of avu-miR-8 and YAP1 target gene; Figure 6 C is a schematic diagram of the binding of avu-miR-8 and ZEB1 target genes; Figure 6 D is the relative luciferase activity after binding of avu-miR-8 to the ZEB1 target gene. Note: * indicates P < 0.05, ** indicates P < 0.01. DETAILED DESCRIPTION

[0016] Example 1 Mining pillbug miRNA based on small RNA sequencing

[0017] 1. Materials and Methods

[0018] 1.1 Reagents and Materials

[0019] Woodlice were purchased from Changsha Xingyuanchuntang Traditional Chinese Medicine Industry Co., Ltd. (batch number 20230305, specification: 10 g). Trizol reagent is a single-phase mixture of guanidine thiocyanate and phenol that can effectively dissolve RNA.

[0020] 1.2 Experimental methods

[0021] 1.2.1 Extraction of total RNA from pillbugs:

[0022] (1) Sample preparation: Grind the pillbug slices with liquid nitrogen. After complete grinding, weigh 100 mg using an electronic balance, add 1 ml of Trizol lysis buffer, homogenize using a homogenizer, and place at 15-30°C for 5 minutes to completely separate the nucleic acid-protein complex.

[0023] (2) Phase separation: Add 200 μl of chloroform, cover the tube, and shake vigorously for 15 seconds to obtain a mixture. Place it at room temperature for 3 minutes and centrifuge it. The mixture is then separated into a red lower layer (i.e., phenol-chloroform phase), an intermediate phase, and an upper colorless aqueous phase (RNA is present in this colorless aqueous phase).

[0024] (3) RNA precipitation: Transfer the aqueous phase containing the RNA to a new tube and add isopropanol (0.5 ml of isopropanol per 1 ml of Trizol reagent used for initial homogenization). Incubate the sample at room temperature (15-25°C) for 10 minutes and centrifuge at 12,000 × g (≈13,000 rpm) for 10 minutes at 4°C. The RNA precipitate, which is usually invisible before centrifugation, will form a gelatinous precipitate at the bottom or side of the tube after centrifugation.

[0025] (4) RNA cleaning: discard the supernatant, wash the RNA pellet with 75% ethanol (use at least 1 ml of 75% ethanol (anhydrous ethanol and RNase-free ddH2O) per ml of Trizol reagent used for initial homogenization), vortex to mix, and centrifuge at 12,000 × g (≈13,000 rpm) at 4°C for 5 min.

[0026] (5) RNA re-dissolution: discard the supernatant, air-dry at room temperature for 10 min, add 40 μl of enzyme-free water to dissolve the RNA, and incubate in a metal bath at 60°C for 10 min.

[0027] (6) Use a microplate reader to determine the concentration and purity of the extracted RNA: The extracted RNA (concentration greater than 100 ng / ul, 260 / 280 ratio between 1.8 and 2.0) was used for subsequent experiments and stored at -80°C to prevent degradation.

[0028] 1.2.2 Sequencing of total RNA from pillbugs:

[0029] (1) Library construction

[0030] The specific method is to use the TruSeq Small RNA Library Prep Kit to construct a library. Taking advantage of the special structure of the 3' and 5' ends of small RNA (an intact phosphate group at the 5' end and a hydroxyl group at the 3' end), 3 μg of total RNA is used as the starting sample. 3' adapters are first added to both ends of the small RNA, followed by 5' adapters. The RNA is then reverse transcribed to synthesize cDNA. PCR amplification and PAGE gel electrophoresis are then performed to separate the target DNA fragments, and the gel is excised and recovered to obtain the cDNA library.

[0031] (2) Library testing: After the library is constructed, Qubit2.0 is used for preliminary quantification, and the library is diluted to 1 ng / l. Then, the insert size of the library is detected using the highly sensitive Agilent 2100. After the insert size meets the expectation, the effective concentration of the library is accurately quantified using the Q-PCR method (library effective concentration>2nM) to ensure the quality of the library;

[0032] (3) Sequencing on the machine: After the library inspection is qualified, different libraries are pooled according to the effective concentration and the target data volume, and then sequenced on the Illumina SE50. The DNA polymerase, adapter primer and four dNTPs with base-specific fluorescent labels are added to the reaction system simultaneously using the sequencing-by-synthesis method. The 3′-OH of these four dNTPs is protected by chemical methods, so only one dNTP can be added at a time. After the dNTP is added to the synthetic chain, all unused free dNTPs and DNA polymerase will be washed away. Then, the buffer required for fluorescence excitation is added, the fluorescence signal is excited by laser, and an optical device is used to record the fluorescence signal. Finally, the optical signal is converted into sequencing bases by computer analysis. After the fluorescence signal is recorded, chemical reagents are added to quench the fluorescence signal and remove the dNTP 3′-OH protecting group so that the next round of sequencing reaction can be carried out. The feature of Illumina's sequencing technology that only adds one dNTP at a time can well solve the problem of accurate measurement of homopolymer length, and finally obtain the total length of the woodlice. RNA raw sequencing data; the above steps (1)-(3) were completed by Beijing Novogene Co., Ltd.

[0033] (4) Sequencing data quality assessment:

[0034] Raw image data files generated by high-throughput sequencing are converted into sequenced reads through base calling analysis. These are called raw data or raw reads. These raw data contain sequence information and corresponding sequencing quality information. To ensure the quality of subsequent information analysis, raw data must be evaluated and processed.

[0035] 2. Experimental results:

[0036] The raw RNA sequences (Raw data) of the pillbugs were obtained by high-throughput small RNA sequencing technology. The specific Raw data results are shown in Table 1. The meanings of the terms involved are as follows:

[0037] Sample: sample ID; Reads: statistics of raw sequence data, with four lines as a unit, counting the number of sequencing sequences in each raw sequencing file; Bases: the number of sequencing sequences multiplied by the length of the sequencing sequence, and converted to G as the unit; Error rate: refers to the sequencing error rate, calculated by formula 1; Q20: the percentage of bases with a Phred value greater than 20 in the total bases; Q30: the percentage of bases with a Phred value greater than 30 in the total bases; GC content: calculates the percentage of the sum of the number of G and C bases to the total number of bases.

[0038] Table 1 Small RNA sequencing data quality detection and analysis

[0039]

[0040] As can be seen from the results in Table 1, a total of 11,314,418 raw sequences of woodlice RNA were measured in this example; within the sequencing length range, the sequencing error rate of the base position was less than 0.01%, the Q20 and Q30 values were both greater than 95%, and the number of bases G and C accounted for 50.86% of the total number of bases.

[0041] The raw data were filtered, revealing 210 sequences with N% > 10%, 27,390 low-quality sequences, 6,391 sequences contaminated with 5' adapters, 651,399 sequences lacking 3' adapters or inserts, and 12,999 sequences containing polyA / T / G / C residues. After removing these sequences, 10,616,029 clean reads were obtained, representing 93.83% of the raw data (Table 2).

[0042] Table 2. Raw data filtering list

[0043]

[0044] The length distribution statistics of sRNA in woodlice were performed to obtain the peaks of the length distribution of sRNA of different lengths to determine the type of small RNA.

[0045] As shown in Table 2, 10,616,029 clean reads were obtained after quality control in this example, and a total of 11,314,418 sRNA reads were obtained after sRNA length screening. Length distribution statistics of these sRNAs showed that the length of animal sRNAs was generally between 18 and 35 nt, and that of miRNAs was concentrated in the range of 21 to 22 nt. The distribution of the experimental samples with a length of 21 to 22 nt was very high, indicating that the sequencing quality of this example was qualified.

[0046] The obtained small RNAs were aligned with the reference sequence to analyze their distribution on the reference genome. The results are shown in Table 3. A total of 1,004,414 reads matched the reference sequence, accounting for 15.04% of the small RNA sequences. Of these, 8.61% aligned in the same direction as the reference sequence, while 6.43% aligned in the opposite direction.

[0047] Table 3 Statistics of alignment between sRNA sequencing data and reference genome

[0048]

[0049] The reads aligned to the reference sequence were aligned with the identified miRNA sequences in miRBase to obtain the secondary structure, sequence, and length of the known mature miRNA. Figure 1 As shown), miRNAdpu-bantam (its structure is as shown Figure 2 shown), Figure 1-2 U is used in the sequence to represent uracil in RNA, and T is used in the sequence to represent uracil in RNA.

[0050] Figure 1 The results showed the precursor structure of avu-miR-8. The mature sequence of avu-miR-8 was: 5'-TAATACTGTCAGGTAAAGATGTC-3' (SEQ ID NO. 1), wherein 5'-AATACTG-3' was the seed region sequence of avu-miR-8.

[0051] Depend on Figure 2 The results showed that the mature sequence of dpu-bantam was: 5'-TGAGATCATTGTGAAAGCTGATT-3' (SEQ ID NO. 2), wherein 5'-GAGATCA-3' was the seed region sequence of dpu-bantam.

[0052] Example 2 avu-miR-8 functional detection

[0053] 1. Study on the effect on liver cancer cell proliferation

[0054] 1.1 Experimental Materials:

[0055] Experimental materials: Human liver cancer cell line HepG2 was purchased from Shanghai Biotechnology Co., Ltd. and MHCC97H cells were purchased from Suzhou Haixing Biotechnology Co., Ltd. The sequences of miRNA mimics are shown in Table 4 (synthesized by Guangzhou Ruibo Biotechnology Co., Ltd.).

[0056] Table 4 miRNA mimic sequences

[0057]

[0058] Experimental methods:

[0059] (1) Culture of HepG2 and MHCC97H liver cancer cells (HepG2 and MHCC97H were cultured in a complete medium containing 10% fetal bovine serum, 5% CO2, and a 37°C incubator. After 2 to 3 passages, the cells were collected by digestion and centrifugation, and the cell suspension was inoculated into a 96-well plate (100 μl / well). Approximately 5 × 10 cells were plated per well.3 Cells were mixed using the "cross" method to ensure uniform distribution within the wells and cultured in a 5% CO2, 37°C incubator for 24 hours. Transfection was performed after the cell confluence rate in the 96-well plate reached over 60%.

[0060] (2) Prepare miRNA mimics into a 20 μmol / L storage solution using DEPC-treated enzyme-free water and store at low temperature. When the density of HepG2 and MHCC97H cells reaches 50% to 70%, transfection is performed. Take appropriate amounts of mimics and Lipofectamine 3000, dilute them with Opti-MEM culture medium, mix the diluted Lipofectamine 3000 solution with mimics, and let it stand at room temperature for 15 minutes to form a transfection complex. Gently add the transfection complex to the culture well. The amount of mixture added to each well of the 96-well plate is: 10 μL Opti-MEM + 0.2 μL Lipofectamine 3000 + 0.5 μL mimic (or NC) (the same volume of culture medium must be aspirated before addition). Gently shake the 96-well plate in a "cross" method and place the 96-well plate in a 5% CO2, 37°C incubator for incubation.

[0061] (3) After transfection, the CCK8 method was used to observe the cell proliferation at 24, 48, and 72 hours after transfection. During the test, the old culture medium was discarded, and a mixture of complete culture medium and CCK-8 in a ratio of 9:1 was added (100 μL / well). The 96-well plate was placed in an incubator for 2 hours. The microplate reader was set to detect the absorbance of each experimental group at a wavelength of 450 nm, and the cell proliferation inhibition rate of each group was calculated. The results are shown in Figure 3 .

[0062] Inhibition rate calculation formula: Cell inhibition rate (%) = [(Ac-As) / (Ac-Ab)] × 100%,

[0063] Where, As is the absorbance of the experimental well (containing cells, culture medium, CCK-8 solution, and drug solution); Ac is the absorbance of the control well (containing cells, culture medium, CCK-8 solution but not drug); Ab is the absorbance of the blank well (containing culture medium and CCK-8 solution but not cells or drug).

[0064] Depend on Figure 3 A and Figure 3 B The results showed that avu-miR-8 group had a significant inhibitory effect on the proliferation of HepG2 and MHCC97H liver cancer cells 24, 48, and 72 hours after transfection, and the optimal action time of avu-miR-8 on liver cancer cells was 48 hours (Note: * indicates P < 0.05 compared with the NC group, ** indicates P < 0.01 compared with the NC group).

[0065] 2. Study the effect of avu-miR-8 on the migration and invasion of liver cancer cells.

[0066] 2.1 Experimental Materials and Methods

[0067] Experimental materials are the same as 1.1

[0068] 2.2 Experimental methods

[0069] 2.2.1 Effect of avu-miR-8 mimics on liver cancer cell migration by scratch assay

[0070] Specific steps: (1) Before inoculating cells, use a marker pen to draw three horizontal lines at a distance of 2 cm on the back of a 6-well plate, and use a culture medium without antibiotics to prepare a medium containing 2.5×10 5 The cell suspension was prepared by seeding 2 ml of the cell suspension into a 6-well plate. After 24 hours, the cell density was above 60%; (2) avu-miR-8 negative control (NC) and avu-miR-8 mimic (mimic) were transfected into HepG2 and MHCC97H liver cancer cells. The amount of mixture added to each well of a 6-well plate was: 250 μL Opti-MEM + 5 μL Lipofectamine 3000 + 10 μL mimic (or NC) (the same volume of culture medium should be aspirated before addition); (3) When the cell fusion rate reached 100%, a straight line was drawn perpendicularly to the bottom using a 200 μL pipette tip, and PBS was gently rinsed once to remove floating cells. Serum-free culture medium was then added, and the cells were placed in a 5% CO2, 37°C incubator for culture. Cell migration in the scratch at 0 and 24 h was observed and recorded under an inverted microscope. The scratch area was recorded, and the scratch area was tested using Image J software to calculate the cell migration rate. Cell migration rate (%) = (scratch area at time 0 - area at the time to be tested / scratch area at time 0) × 100%. The results are shown in Table 1. Figure 4 .

[0071] 2.2.2 Effect of avu-miR-8 mimics on HCC cell invasion by Transwell invasion assay

[0072] Specific steps: (1) Pre-cool the equipment and reagents required for preparing Matrigel, such as Tips, EP tubes, and DMEM. Then mix Matrigel stock solution with DMEM at a volume ratio of 1:6 to prepare a mixed solution. Add the resulting mixed solution to the upper chamber of the Transwell chamber (100 μL / well) and place it in a 5% CO2, 37°C incubator for 30 minutes. (2) Use a culture medium without antibiotics to prepare a medium containing 2.5×10 5(1) Prepare a cell suspension of 100 cells and seed the cell suspension in a 6-well plate at 2 ml per well. After 24 hours, the cell density is above 60%; (2) Transfect HepG2 and MHCC97H liver cancer cells with avu-miR-8 negative control (NC) and avu-miR-8 mimics (mimics). The amount of the mixture added to each well of the 6-well plate is: 250 μL Opti-MEM + 5 μL Lipofectamine 3000 + 10 μL mimic (or NC) (the same volume of culture medium must be aspirated before addition); (3) Place the Transwell chamber in a 24-well plate, add 600 μl of serum-free culture medium to the lower chamber and 50 μl of serum-free culture medium to the upper chamber to activate the chamber basement membrane, and let it stand in a 5% CO2, 37°C incubator overnight; (4) Digest and centrifuge the cells in the 6-well plate 24 hours after transfection, resuspend them in serum-free culture medium, and add 200 μl (2×10 5 / well) cell suspension, and at the same time, add 600 μl complete culture medium to the lower chamber, using the serum concentration difference between the upper and lower chambers to induce the migration of cells in the upper chamber to the lower chamber, and be careful to avoid the generation of bubbles; (5) After 24 hours of incubation in the incubator, remove the 24-well plate, add 4% paraformaldehyde to both the upper and lower chambers for fixation for 20 minutes, and rinse twice with PBS; stain with 0.1% crystal violet for 20 minutes, and then rinse twice with PBS, and then gently wipe the basement membrane of the chamber with a cotton swab to remove non-invaded cells; (6) Place the chamber in a ventilated place to dry naturally, and then use an inverted microscope to randomly select five fields of view for observation and photography. Image J image processing software is used to calculate the number of invasive cells. The results are shown in Figure 6. Figure 5 .

[0073] 2.3 Experimental Results

[0074] Depend on Figure 4 The results showed that the scratch test results showed that avu-miR-8mimic had a significant inhibitory effect on the migration ability of HepG2 and MHCC97H.

[0075] Depend on Figure 5 The results showed that the Transwell invasion assay results indicated that avu-miR-8 mimics had a significant inhibitory effect on the invasion of HepG2 and MHCC97H cells.

[0076] Example 3 Study on the prediction and verification of avu-miR-8 target genes

[0077] 1. Materials and Methods

[0078] 1.1 Experimental Materials

[0079] Online database: miRDB (http: / / mirdb.org / ),

[0080] RNAhybrid (https: / / bibiserv.cebitec.uni-bielefeld.de / rnahybrid) and

[0081] miRanda (http: / / www.microrna.org / microrna / home.do); dual fluorescence reporter system YAP1 and ZEB1 vectors were constructed and synthesized by Hanbio Biotech (Shanghai).

[0082] 1.2 Experimental methods

[0083] 1.2.1 Bioinformatics prediction of avu-miR-8 target genes

[0084] Through bioinformatics methods, the online databases miRDB, RNAhybrid and miRanda were used to predict the target genes of avu-miR-8. The intersection of the target genes predicted by the three databases was taken, and the oncogenes YAP1 and ZEB1 were selected as candidate target genes of avu-miR-8.

[0085] 1.2.2 Verification of YAP1 and ZEB1 as target genes of avu-miR-8 using a dual fluorescence reporter system

[0086] The 3′UTR of YAP1 and ZEB1 and the site-directed mutagenesis sequence with the avu-miR-8 binding site were transfected into the 3′ end of the pmirGLA plasmid luciferase reporter gene, respectively, and named YAP1-MUT (ZEB1-MUT) and YAP1-WT (ZEB1-WT). YAP1-MUT (ZEB1-MUT) and YAP1-WT (ZEB1-WT), avu-miR-8 mimic and NC mimic were co-transfected into 293T cells with the luciferase reporter vector, and cultured in a 37°C, 5% CO2 incubator for 24 hours. Luciferase activity was detected for each group. The results are shown in Figure 6 .

[0087] 2. Experimental results:

[0088] like Figure 6 A. Figure 6B, After co-transfection of YAP1 3'UTR wild type (h-YAP1-3'UTR-wt) and avu-miR-8 mimic, luciferase activity decreased significantly, indicating that avu-miR-8 can inhibit the post-transcriptional expression of YAP1 by binding to YAP1 3'UTR. When the YAP1 3'UTR binding site was mutated (h-YAP1-3'UTR-mu), luciferase activity recovered and showed no significant difference from the NC group, indicating that the inhibitory effect of avu-miR-8 on YAP1 depends on the integrity of its 3'UTR binding site. Similar results were also found for ZEB1, such as Figure 6 C. Figure 6 D, When avu-miR-8 mimic was co-transfected with h-ZEB1-3'UTR-wt, luciferase activity decreased significantly. However, when co-transfected with h-ZEB1-3'UTR-mu, luciferase activity was restored and showed no significant difference from the NC group. Therefore, avu-miR-8 can directly target the 3'UTRs of YAP1 and ZEB1, inhibiting their gene expression through miRNA-mRNA interactions.

[0089] Those skilled in the art should understand that the discussion of any of the above embodiments is merely illustrative and is not intended to imply that the scope of protection of the present application is limited to these examples. In line with the present application, the technical features in the above embodiments or different embodiments may be combined, the steps may be implemented in any order, and there are many other variations of different aspects of one or more embodiments of the present application as described above, which are not provided in detail for the sake of simplicity.

[0090] The one or more embodiments of this application are intended to encompass all such substitutions, modifications, and variations that fall within the broad scope of this application. Therefore, any omissions, modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of one or more embodiments of this application should be included in the scope of protection of this application.

Claims

1. A traditional Chinese medicine pill bug miRNA for inhibiting tumors, characterized by: The sequence of the miRNA is SEQ ID NO.1, and the sequence of SEQ ID NO.1 is TAATACTGTCAGGTAAAGATGTC.

2. A precursor sequence characterized by: The precursor sequence is a stem-loop structure, comprising the traditional Chinese medicine pill bug miRNA for inhibiting tumors as claimed in claim 1.

3. A use of the tumor-suppressing Chinese medicine pill bug miRNA as claimed in claim 1 or the precursor sequence as claimed in claim 2, characterized in that: The tumor-suppressing Chinese medicine pill bug miRNA or precursor sequence is used to prepare anti-tumor drugs.

4. The use according to claim 3, characterized in that: The tumor is liver cancer.

Images