Method for identifying guanine quadruplex at whole transcriptome level based on self-assembly enrichment
By using peptides that specifically bind rG4 for isolation and enrichment, the complex and time-consuming problem of RNA guanine four-strand site identification in the prior art was solved, and rapid and efficient full transcriptome identification was achieved, which was suitable for a variety of mammalian cells.
Patent Information
- Application Number
- CN202410187678.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-02-05
- Publication Date
- 2025-08-05
AI Technical Summary
The prior art has complicated steps and takes a long time to identify RNA guanine quadrilateral (rG4) sites, and depends on biomagnetic beads and high temperature treatment, making it difficult to apply to low-quantity or low-quality samples.
The peptides specifically bound to rG4 were isolated and enriched. The peptide-RNA complex was prepared by fragmentation, purification, mutagenic reaction, centrifugation and purification, combined with qPCR detection and Illumina sequencing, and the identification of rG4 site at the entire transcriptome level was achieved.
It shortens the enrichment time, improves rG4 capture efficiency, reduces the risk of RNA degradation, is suitable for low-quantity or low-quality samples, and expands the application scope of transcripts.
Smart Images
Figure CN120425033A_ABST
Abstract
Description
1. Technical Field
[0001] The invention belongs to the field of biotechnology, and particularly relates to a novel method for identifying RNA guanine quadruplex (rG4) sites in animal transcriptomes at the whole transcriptome level based on the specific separation and enrichment of peptides rich in guanine fragments. 2. Background Technology
[0002] In the human transcriptome, certain regions rich in guanine (G) spontaneously form RNA guanine quadruplex structures (rG4) through Hoogsteen hydrogen bonding and π-π stacking.
[0003] Computational analysis and high-throughput experimental results of the human transcriptome have shown that there are thousands of RNA G-quadruplex (rG4) formation sites in mRNA. These rG4 sequences are commonly found in the 5′ and 3′ untranslated regions (UTRs) of mRNA, indicating that rG4 has a potential regulatory role in mRNA maturation, transport and translation. Therefore, mapping the distribution of rG4 in the human transcriptome is of great significance for understanding the functions of rG4-related genes. The immunoprecipitation method currently developed for the identification of rG4 sites based on next-generation sequencing uses proteins and ligands that interact with rG4, such as BG4, NMM, TASQ, etc., which are labeled, to capture rG4, and then obtain enriched fragments by magnetic bead-mediated immunoprecipitation. This type of method has been successfully applied to the identification of rG4 sites in the transcriptomes of different human cell lines such as MCF-7 and U2OS ( Figure 1 However, current methods are limited by complex and time-consuming procedures, reliance on specially modified biomagnetic beads for enrichment, and the need for heat treatment to purify and recover fragments. Furthermore, known proteins or ligands that bind to rG4 must be modified to facilitate magnetic bead separation and enrichment. These shortcomings make these methods difficult to apply to low-quality and low-volume samples.
[0004] We have developed a new method (CRP-seq) based on the specific separation and enrichment of peptides rich in guanine fragments for the identification of rG4 sites in animal transcriptomes at the whole transcriptome level. This method has been successfully applied to the identification of rG4 sites in Hela cells at the whole transcriptome level. This method relies on peptides that can specifically bind to rG4 and can achieve the separation and enrichment of rG4 in total RNA within 15 minutes. This method does not rely on magnetic beads and does not require heat treatment of samples. It can perform whole transcriptome sequencing analysis with an initial amount of RNA sample ten times lower than that of conventional methods. The main steps of this method include: extracting animal cell RNA and fragmenting it, purifying RNA, renaturing reaction, preparing peptide-RNA complexes, recovering the complexes by centrifugation, resuspending the peptide-RNA complexes with elution buffer and purifying them, detecting the degree of RNA G4 enrichment by qPCR, and finally constructing a library and performing bioinformatics analysis on the enriched RNA, thereby achieving the identification of G4 sites at the whole transcriptome level. The main technical process is shown in the attached. Figure 2 .
[0005] In conclusion, the development and application of this method will be beneficial to the study of the biological function of rG4 in the human transcriptome and its application in the development of gene therapy drugs targeting rG4. 3. Summary of the Invention
[0006] The purpose of the present invention is to provide a new method for identifying RNA guanine quadruplex (rG4) sites in animal transcriptomes at the whole transcriptome level based on the specific separation and enrichment of peptides rich in guanine fragments.
[0007] The present invention is achieved through the following technical solutions:
[0008] (1) Fragmented RNA;
[0009] (2) Purify RNA;
[0010] (3) renaturation reaction;
[0011] (4) preparing peptide-RNA complexes;
[0012] (5) centrifugal recovery and purification;
[0013] (6) Detect RNA G4 enrichment using qPCR;
[0014] (7) RNA enrichment was tested and library construction and Illumina sequencing were performed, and bioinformatics analysis was performed to identify G4 sites at the whole transcriptome level.
[0015] Compared with the prior art, the present invention has the following characteristics:
[0016] This method uses peptides that specifically bind to rG4 for separation and enrichment before library construction, effectively shortening the enrichment time before library construction, effectively inhibiting RNA degradation, and improving rG4 capture efficiency. Compared with existing rG4 immunoprecipitation sequencing methods, it has the following characteristics:
[0017] (1) Traditional ligands or proteins need to be modified with tags, which requires a foundation in molecular design and organic synthesis. The peptide (sequence 1) used in this method can be synthesized through artificial solid phase synthesis without the need for post-modification and can spontaneously bind to rG4 to form an insoluble complex.
[0018] (2) The traditional method requires 4-5 hours for separation and enrichment. This method does not require biological magnetic beads to assist in separation and enrichment, which shortens the enrichment time by 1 / 20 and achieves successful enrichment of rG4 within 15 minutes, effectively avoiding RNA degradation caused by long-term sample processing.
[0019] (3) The traditional method requires a minimum starting amount of 100,000 cells. This method can achieve the same sequencing effect with 1 / 10 of the starting amount, and can meet the sequencing requirements of complex samples such as low RNA quality and small sample size.
[0020] (4) This method is applicable to a variety of mammalian cells and can be directly used to identify rG4 sites in the entire transcriptome.
[0021] (5) This method can effectively identify noncoding RNAs other than mRNA through ribosome depletion rather than poly A enrichment, effectively expanding the application range of transcripts.
[0022] Table 1. Buffer formula required for recovery of enriched rG4 fragments
[0023] Lysis buffer Negative buffer Incubation buffer detergent eluent TRIZOL 10mM tris-HCl (pH 7) 10 mM tris-HCl (pH 7) 10 mM tris-HCl (pH 7) 10 mM tris-HCl (pH 8.8) 0.5% SDS (w / v) 150 mM KCl 10 mM KCl 10mM EDTA 150mM LiCl 1mM EDTA 10mM MgCl2 5mM CaCl2
[0024] Lysis buffer: lysis buffer; Glycogen: glycogen; tris-HCl: tris(hydroxymethyl)aminomethane; pH: pH; KCl: potassium chloride; MgCl2: magnesium chloride; CaCl2: calcium chloride; EDTA: ethylenediaminetetraacetic acid; mM: millimole; μM: micromole; bp: base pair. IV. Description of the Figures
[0025] Figure 1 .BG4-RIP-seq main steps flow chart
[0026] Figure 2 .Flowchart of the main steps of CRP-seq
[0027] Figure 3 .Agarose gel electrophoresis detection of Hela cell RNA disrupted by ultrasonic waves
[0028] Figure 4 .Gel image of Illumina sequencing library
[0029] Figure 5 Visualization of the rG4 site in Hela cells V. Specific Implementation Methods
[0030] Example 1: Combining Figure 2
[0031] (1) Extract RNA from animal cells and fragment it:
[0032] Take 100,000 cells, add Lysis buffer and incubate at room temperature for ten minutes, then place the sample on a non-contact ultrasonic disruptor stand pre-cooled at 4°C (the parameters of the ultrasonic disruptor are set to Medium energy, 30s on, 30s off as one cycle), treat with 20-30 cycles of ultrasound, take 10 μl of the mixture and extract RNA by phenol-chloroform-alcohol precipitation method, and detect the fragmentation effect with 1% agarose gel ( Figure 3 ), select the fragmentation condition in which RNA is evenly distributed between 100-500 bp, and store the fragmented RNA lysate at -80°C.
[0033] (2) Purification of RNA:
[0034] The fragmented lysate was added to chloroform solution at a ratio of lysis buffer to chloroform = 5:1, stirred vigorously, and allowed to stand at room temperature for ten minutes. After high-speed centrifugation at 12,000 rpm at 4°C, the upper aqueous layer was transferred to a new 1.5 mL centrifuge tube, 1.5 volumes of isopropanol were added, and allowed to stand at -20°C for ten minutes. After high-speed centrifugation at 12,000 rpm at 4°C, the supernatant was discarded, and the precipitate was retained to obtain purified RNA, which was stored at -80°C until use.
[0035] (3) Renaturation reaction:
[0036] After adding the purified RNA to the denaturation buffer, mix well on an ice plate, incubate at 65°C for 5 minutes, and place on ice until use.
[0037] (4) Preparation of peptide-RNA complex:
[0038] Dilute the renatured RNA to 100 ng / ml with incubation buffer on ice, add 100 μM peptide, mix thoroughly, and incubate at room temperature for 5 minutes.
[0039] (5) Centrifugal recovery and purification:
[0040] The peptide-RNA complex was centrifuged at 5000×g for 5 minutes at 4°C. The supernatant was removed, washed twice with washing buffer, and briefly centrifuged at 1000×g. The supernatant was removed and the pellet was air-dried. The eluent was added to the pellet, mixed thoroughly, and allowed to stand at room temperature for 5 minutes. The pellet was extracted with an equal volume of phenolform (1:1) and centrifuged at 12000 rpm at 4°C for 10 minutes. The supernatant was transferred to a new 1.5 ml centrifuge tube and 20 μg of Glycogen, 1 / 10 volume of 3M sodium acetate (pH 5.5), and 2.5 volumes of -20°C pre-cooled isopropanol were added. The mixture was mixed and placed in a -20°C refrigerator for 1 hour. The RNA was recovered by centrifugation at 12000 rpm for 10 minutes. The RNA pellet was washed with 75% ethanol, air-dried for 5 minutes, and dissolved in RNase-free water. The recovered RNA solution was stored at -20°C until use.
[0041] (6) Detect RNA G4 enrichment using qPCR:
[0042] A G4 site and a non-G4 site were selected to design primers respectively, and the amplified fragment size was 100-150bp.
[0043] Take 1μl Input RNA and 2μl enriched RNA as templates, dilute them three times, and perform qPCR with positive and negative primers respectively. ΔCt The enrichment factor was calculated by the method of , and the reaction with the positive and negative primer fold ratio greater than 5 was selected for the next experiment. The forward primer sequence used was:
[0044] F: ATGACTGAGTACAAACTGGTGGT, R: CATGTATTGGTCTCTCATGGCAC;
[0045] The reverse primer sequence is:
[0046] F: ACCAGTCAACAGGGGACATAA, R: CTTCGTGGGGTCCTTTTCACC.
[0047] (7) RNA samples that passed the enrichment test were subjected to library construction and Illumina sequencing. Bioinformatics analysis was performed to identify G4 sites at the whole transcriptome level. RNA fragments that met the requirements were subjected to ribosome depletion and used to construct Illumina sequencing libraries. The specific experimental protocol was carried out according to the experimental protocol provided by the kit. 200-600 bp DNA fragments were isolated and purified for 2x150PE sequencing on the Illumina NovaSeq sequencing platform.
[0048] The experimental results show that:
[0049] (1) The CRP-seq system process established in this experiment is as follows Figure 2 shown
[0050] (2) The fragmented RNA fragments are evenly distributed in the range of 100-500 bp, e.g. Figure 3 shown.
[0051] (3) The RNA after enrichment and recovery was amplified by a library construction and sequencing kit, and then purified to obtain nucleic acid fragments of 200-600 bp in size. The library construction and detection were as follows: Figure 4 shown.
[0052] (4) Through bioinformatics analysis, the visualization effect of rG4 site on transcripts is as follows Figure 5 shown.
Claims
1. A method for identifying RNA guanine quadruplex (rG4) sites in animal transcriptomes based on the specific separation and enrichment of guanine-rich fragments, characterized in that: The method mainly includes the following steps: (1) RNA fragmentation; (2) Purify RNA; (3) renaturation reaction; (4) preparing peptide-RNA complexes; (5) centrifugal recovery and purification; (6) Detect RNA G4 enrichment using qPCR; (7) The IP DNA that has been enriched is used for library construction and Illumina sequencing, and bioinformatics analysis is used to identify G4 sites at the whole transcriptome level.
2. The method according to claim 1, characterized in that: The nucleic acid sequence that specifically self-assembles with the peptide is rich in base G and can form a G-quadruplex, the general formula of which is as follows: Sequence 1: H(0-20)G(1-4)H(1-20)G(1-4)H(1-20)G(1-4)H(1-20)G(1-4)H(0-20) In the above general formula, nucleic acid comprises RNA and deoxyribonucleic acid; H is selected from A, T, C, and U except G base of nucleic acid; The sequence of the nucleic acid-specific peptide can be any of the following general formulas: Sequence 2: ZY(1-3)-XY(1-3)-X-[X]-XY(1-3)-X(1-3)-[Y] In the above general formula, the amino acid composition includes natural and unnatural amino acids; X specifically refers to lysine (Lys) or 2,4-diaminobutyric acid (Dab); Y refers to any amino acid other than Lys and Dab; an amide bond between [X] and [Y] forms a ring; Z refers to an isomer such as octanoic acid, which is connected to the peptide chain by an amide bond.
3. According to claim 1, the nucleic acid according to the general formula of Sequence 1 can bind to the peptide according to the general formula of Sequence 2 to form insoluble particles, and the particles meet the following conditions: (1) It can exist stably in acidic and neutral environments; (2) Redissolution of insoluble particles in alkaline environment; (3) The particles can be separated from the solution by centrifugation.
4. The method according to claim 1, wherein The process of extracting RNA from animal cells and fragmenting the cells in step (1) is as follows: adding the animal cells after removing the culture medium to a cell lysis solution, incubating at room temperature for ten minutes, placing the cells in an ultrasonic lyser, ultrasonicating for thirty minutes, and then placing the cells on ice for later use; The cell lysis solution includes: TRIZOL reagent containing 0.5% SDS.
5. The method according to claim 1, wherein Step (2) RNA purification is as follows: the fragmented lysate is added to a chloroform solution at a ratio of TRIZOL:chloroform = 5:1, stirred vigorously and allowed to stand at room temperature for ten minutes, centrifuged at high speed, the upper aqueous layer is collected, 1.5 times the volume of isopropanol is added, and allowed to stand at -20°C for ten minutes. After high-speed centrifugation, the supernatant is discarded, and the precipitate is retained to obtain purified RNA, which is then stored at -80°C for use.
6. The method according to claim 1, characterized in that The process of the denaturation reaction in step (3) is as follows: the purified RNA is added to the denaturation buffer, incubated at 65°C for 5 minutes, and placed on ice for use; The composition of the renaturation buffer is: 10 mM tris-HCl, 150 mM KCl.
7. The method according to claim 1, characterized in that Step (4) of preparing the peptide-RNA complex is as follows: dilute the denatured RNA to 100 ng / ml with incubation buffer, add 100 μM peptide, mix well, and incubate at room temperature for 5 min; The incubation buffer includes: 10 mM tris-HCl (pH 7), 10 mM KCl, and 1 mM EDTA.
8. The method according to claim 1, characterized in that The process of step (5) centrifugal recovery and purification is as follows: after mixing, the sample is centrifuged at 5000×g for 5 minutes at 4°C, the supernatant is removed, and the sample is washed twice with a washing solution, and the supernatant is removed; the eluent is added to the precipitate, mixed, and allowed to stand at room temperature for 5 minutes; the RNA fragments are extracted and centrifuged with an equal volume of a phenol-chloroform mixture (1:1), and then the RNA fragments are recovered by alcohol precipitation. The formula of the washing solution is: 10 mM tris-HCl (pH 7), 10 mM EDTA. The eluent included: 10 mM tris-HCl (pH 8.8), 150 mM LiCl, 10 mM MgCl2, 5 mM CaCl2.
9. The method according to claim 1, characterized in that Step (6) The process of detecting RNA G4 enrichment by qPCR is as follows: design primers for a G4 site and a non-G4 site respectively, and the amplified fragment size is 100-150bp; take 1μl input and 2μl RNA from the DNA fragment obtained in step (5) as templates, dilute them three times, and perform qPCR with positive and negative primers respectively, and use 2 ΔCt The enrichment fold was calculated by the method of , and the reactions with the positive and negative primer fold ratio greater than 5 were selected for the next experiment.
10. The method according to claim 1, characterized in that The process of step (7) constructing a library and performing Illumina sequencing on the IP DNA that has been tested for enrichment is as follows: the RNA that meets the requirements in step (6) is subjected to ribosome depletion and then used to construct an Illumina sequencing library, and 200-600 bp DNA fragments are separated and purified for 2x150PE sequencing on the Illumina NovaSeq sequencing platform.