Multiplex assay reagents and methods for a plurality of biological nucleic acids
By combining digital polymerase chain reaction (dPCR) with microfluidic technology and real-time monitoring of labeled probes, the problem of insufficient multiplex detection capability in traditional methods has been solved, enabling rapid, multi-target, and highly sensitive detection of various biological nucleic acids.
Patent Information
- Application Number
- CN202510947284.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-10
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2045-07-10
AI Technical Summary
Existing methods for detecting respiratory pathogens are insufficient to meet the clinical needs of sensitivity, multiple targets, and rapid detection. Traditional PCR technology is limited by the number of fluorescence channels and lacks multiplex detection capability, while isothermal amplification technology has poor sensitivity, and conventional methods have long detection times.
Digital polymerase chain reaction (dPCR) combined with microfluidic technology is used to achieve multiplex detection by using biologically specific and universal probes labeled with fluorescent and quenching groups and monitoring the PCR reaction process in real time.
It enables rapid, multi-target, and highly sensitive detection of various biological nucleic acids, with a detection limit as low as 5 copies/reaction, and can simultaneously detect 13 respiratory pathogens.
Smart Images

Figure CN120425087B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of nucleic acid in biotechnology, and particularly relates to a multiplex detection reagent and method for various biological nucleic acids. BACKGROUND
[0002] Respiratory tract infection (RTI) involves a variety of pathogens, usually accompanied by overlapping signs and symptoms, and sometimes there is mixed infection of multiple pathogens, and it is not reliable to predict pathogenic microorganisms according to clinical manifestations. Traditional pathogen detection methods mainly rely on isolation and culture and antigen and antibody detection, usually taking a long time and having poor sensitivity, which is difficult to meet the needs of clinical diagnosis, so sensitive and accurate multiplex molecular detection means are needed.
[0003] At present, the molecular detection process developed and applied in the field of respiratory pathogens mainly includes sample processing, signal amplification and downstream detection. The signal amplification method can be mainly divided into polymerase chain reaction (PCR) technology and non-PCR signal amplification methods mainly including isothermal amplification technology. Although the isothermal amplification related technology has the advantages of simple reaction conditions and independence on professional equipment such as thermal cycler, it still cannot replace the mainstream position of PCR technology in the field of molecular detection due to the lack of sensitivity to low-abundance nucleic acid samples. The conventional method in the field of respiratory pathogen molecular detection at present mainly contains two categories of qPCR and NGS, in which qPCR can complete multi-target detection covering common respiratory pathogens in a short time, but the detection sensitivity is poor, while the NGS method takes too long time for detection. In addition to some other detection methods such as chromatography, mass spectrometry, electrophoresis, etc., although they can distinguish multiple targets at the same time, the detection limit is usually 10^3 / ml, and since the detection process is independent of the signal amplification process, the detection usually takes a long time. Therefore, the above existing technologies are difficult to meet the clinical needs of sensitivity, multi-target and rapid detection.
[0004] Digital polymerase chain reaction (dPCR) is a new PCR technology based on traditional PCR and microfluidic technology. Compared with traditional qPCR, dPCR has higher tolerance to inhibitors and higher sensitivity. However, due to the use of end-point method, the multiplex detection capability of dPCR is greatly limited by the number of fluorescence channels, and usually only 3-5 targets can be detected simultaneously, which is difficult to meet the detection requirements of respiratory pathogens. Real-time dPCR developed on this basis can monitor the PCR reaction process. Based on this, the digital melting curve technology combines real-time dPCR and traditional melting curve analysis. Through real-time monitoring of the melting process of the target, the number of targets that can be detected in a single fluorescence channel is greatly expanded, and the multiplex detection capability of dPCR is improved, which has the potential to realize the multi-target, high-sensitivity and rapid nucleic acid detection of respiratory pathogens. SUMMARY
[0005] The technical problem to be solved by the present application is how to perform rapid multiplex detection of multiple biological nucleic acids.
[0006] To solve the above technical problems, the present application first provides a reagent for detecting multiple biological nucleic acids, which contains a probe set for detecting the multiple biological nucleic acids, the probe set containing a universal probe and n biological specificity probes;
[0007] The biological specificity probes are all single-stranded DNA labeled with a fluorescent group and a quencher group, and the fluorescent group and the quencher group are respectively denoted as fluorescent group 1 and quencher group 1; the sequence of the biological specificity probe is obtained by connecting a biological specificity region and a non-biological specificity region, the biological specificity region is used for specific binding with a biological nucleic acid, the non-biological specificity region does not specifically bind with the biological nucleic acid, and the non-biological specificity regions of the n biological specificity probes are the same or different; the quencher group 1 is labeled at the end of the biological specificity probe away from the non-biological specificity region, and the fluorescent group 1 is labeled at one end of the biological specificity region close to the non-biological specificity region;
[0008] The universal probe is single-stranded DNA labeled with a fluorescent group and a quencher group, and the fluorescent group and the quencher group are respectively denoted as fluorescent group 2 and quencher group 2, the fluorescent group 2 is different from the fluorescent group 1; the sequence of the universal probe contains the reverse complement sequence of the non-biological specificity region, the quencher group 2 is labeled in the middle of the universal probe and not on the reverse complement sequence of the non-biological specificity region, and the fluorescent group 2 is labeled at the end of the universal probe and located on both sides of the reverse complement sequence of the non-biological specificity region.
[0009] Specifically, the biological specificity region and the non-biological specificity region can be located at the 3' end and the 5' end of the biological specificity probe, respectively. The quencher 1 is located at the 3' end of the biological specificity probe.
[0010] In the above reagent, the non-labeled end of the universal probe with the fluorescent group 2 is modified with a three-carbon spacer (C3Spacer modification). Specifically, the fluorescent group 2 is located at the 5' end of the universal probe, and the three-carbon spacer (C3Spacer modification) is located at the 3' end of the universal probe. The reverse complement sequence of the non-biological specificity region is located on the side of the universal probe away from the fluorescent group 2 of the quencher 2.
[0011] The quencher 2 can be different from the quencher 1. The quencher 2 can also be the same as the quencher 1.
[0012] In the above reagent, the length of the biological specificity region can be 20-45 nucleotides. Specifically, the length of the biological specificity region can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleotides.
[0013] The length of the non-biological specificity region can be 8-14 nucleotides. Specifically, the length of the non-biological specificity region can be 8, 9, 10, 11, 12, 13, or 14 nucleotides.
[0014] The Tm value of the biological specificity region can range from 60 to 85°C. The Tm value of the biological specificity region can range from 61 to 84°C, 62 to 83°C, 63 to 82°C, 64 to 81°C, 65 to 80°C, 66 to 79°C, 67 to 78°C, 68 to 77°C, 69 to 76°C, 70 to 75°C, 71 to 74°C, or 72 to 73°C.
[0015] The Tm value of the non-biological specificity region can range from 35 to 45°C (e.g., 36 to 44°C, 37 to 43°C, 38 to 42°C, 39 to 41°C, or 40°C).
[0016] In the above reagent, the distance between the fluorescent group 1 and the quencher 1 can be 15-30 nucleotides (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides).
[0017] In the above reagent, the biological specific region between the fluorescent group 1 labeled nucleotide and the non-biological specific region can also have a 2' methoxy modification.
[0018] The 2' methoxy modification can be located at the terminal 2-4 nucleotides of the biological specific region.
[0019] In the above reagent, the universal probe can have a length of 60-100 nucleotides. The universal probe can have a length of 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides.
[0020] In the above reagent, the universal probe can have a distance of 15-20 nucleotides (such as 15, 16, 17, 18, 19, or 20 nucleotides) between the fluorescent group 2 and the quencher group 2.
[0021] After the non-biological specific region binds to the universal probe, an extended product can be obtained by extending in the direction of the fluorescent group 2. The extended product can have a length of 25-100 nucleotides. The extended product can have a length of 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides.
[0022] The extended product can have a Tm value in the range of 60-85°C. The extended product can have a Tm value in the range of 61-84°C, 62-83°C, 63-82°C, 64-81°C, 65-80°C, 66-79°C, 67-78°C, 68-77°C, 69-76°C, 70-75°C, 71-74°C, or 72-73°C.
[0023] The binding position of the non-biological specific region to the universal probe is unique.
[0024] The Tm value of the extended product and the Tm value of the biological specificity region can differ by at least one Tm value.
[0025] The probe set can further comprise an internal control probe having the same structure as the biological specificity probe.
[0026] The universal probe in the probe set can be one or more. When the universal probe in the probe set is more than one, the fluorescent groups labeled on each probe are not the same.
[0027] The reagent can further comprise a primer set for amplifying the plurality of biological nucleic acids, the primer set comprising a primer pair for amplifying each biological nucleic acid. The primer pair can be n primer pairs.
[0028] The primer set in the reagent can further comprise a universal primer pair, the two primers of the primer pair for amplifying each biological nucleic acid comprising the two primers of the universal primer pair. The primer set can further comprise an internal control primer pair.
[0029] The reagent can further comprise an endonuclease, such as Taq enzyme.
[0030] The plurality of organisms can be n organisms. n can be greater than or equal to 2.
[0031] The fluorescent group 1 and the fluorescent group 2 can be AMCA, Pacific Blue, Atto 425, BODIPY FL, FAM, Oregon Green 488, TET, R6G, Yakima Yellow, VIC, HEX, JOE, Quasar 570, CY3, NED, TAMRA, ROX, AquaPhluor 593, Texas Red, Atto 590, IR Dye 650, CY5, Quasar 670, or CY5.5.
[0032] The quenching group 1 and the quenching group 2 can be BBQ 650, Dabcyl, DBQ1, Eclipse, BHQ1, BHQ2, BHQ3, or MGB.
[0033] In an embodiment of the present application, the reagent for detecting multiple biological nucleic acids is a reagent for detecting respiratory pathogens, the respiratory pathogens being coronavirus SARS-cov-2, influenza virus type A, influenza virus type B, human parainfluenza virus type 1, human parainfluenza virus type 2, human parainfluenza virus type 3, respiratory syncytial virus, rhinovirus, human adenovirus, human bocavirus, Bordetella pertussis and Mycoplasma pneumoniae, the reagent containing a probe set for detecting respiratory pathogens, the probe set containing 12 specific probes and one universal probe, the sequences of the 12 specific probes being SEQ ID No. 29-SEQ ID No. 40 respectively, and the sequence of the universal probe being SEQ ID No. 42.
[0034] The probe set can further contain an internal reference probe, the sequence of the internal reference probe being SEQ ID No. 41.
[0035] The above-mentioned reagent for detecting respiratory pathogens further contains a primer set for detecting respiratory pathogens, the primer set containing 24 single-stranded DNAs, the sequences of which being positions 22-43 of SEQ ID No. 1, positions 23-43 of SEQ ID No. 2, positions 22-46 of SEQ ID No. 3, positions 23-41 of SEQ ID No. 4, positions 22-42 of SEQ ID No. 5, positions 23-44 of SEQ ID No. 6, positions 22-48 of SEQ ID No. 7, positions 23-49 of SEQ ID No. 8, positions 22-49 of SEQ ID No. 9, positions 23-47 of SEQ ID No. 10, positions 22-44 of SEQ ID No. 11, positions 23-47 of SEQ ID No. 12, positions 22-48 of SEQ ID No. 13, positions 23-53 of SEQ ID No. 14, positions 22-40 of SEQ ID No. 15, positions 23-44 of SEQ ID No. 16, positions 22-42 of SEQ ID No. 17, positions 23-43 of SEQ ID No. 18, positions 22-40 of SEQ ID No. 19, positions 23-41 of SEQ ID No. 20, positions 22-41 of SEQ ID No. 21, positions 23-42 of SEQ ID No. 22, positions 22-40 of SEQ ID No. 23, and positions 23-44 of SEQ ID No. 24.
[0036] The primer set further contains an internal reference primer, which is composed of two single-stranded DNAs shown in positions 22-38 of SEQ ID No. 25 and positions 23-41 of SEQ ID No. 26.
[0037] The reagent for detecting respiratory pathogens described above also contains a primer set for detecting respiratory pathogens, which contains 24 single-stranded DNAs, the sequences of which are SEQ ID No. 1-24 respectively.
[0038] The primer set also contains an internal reference primer, which is composed of two single-stranded DNAs shown in SEQ ID No. 25 and SEQ ID No. 26.
[0039] The primer set also contains a universal primer, which is composed of two single-stranded DNAs shown in SEQ ID No. 27 and SEQ ID No. 28.
[0040] The reagent for detecting respiratory pathogens can be only the probe set for detecting respiratory pathogens, can be only the primer set for detecting respiratory pathogens, and can also be composed of the probe set for detecting respiratory pathogens and the primer set for detecting respiratory pathogens.
[0041] The reagent for detecting respiratory pathogens in the preparation of products for detecting respiratory pathogens also belongs to the protection scope of the present application.
[0042] The respiratory pathogens are coronavirus SARS-cov-2, influenza virus type A, influenza virus type B, human parainfluenza virus type 1, human parainfluenza virus type 2, human parainfluenza virus type 3, respiratory syncytial virus, rhinovirus, human adenovirus, human bocavirus, Bordetella pertussis and / or Mycoplasma pneumoniae.
[0043] The present application also provides a kit for detecting respiratory pathogens, which contains the reagent for detecting respiratory pathogens, and the respiratory pathogens are coronavirus SARS-cov-2, influenza virus type A, influenza virus type B, human parainfluenza virus type 1, human parainfluenza virus type 2, human parainfluenza virus type 3, respiratory syncytial virus, rhinovirus, human adenovirus, human bocavirus, Bordetella pertussis and / or Mycoplasma pneumoniae.
[0044] The reagent or the kit can also contain a buffer & enzyme mixture, which is obtained by mixing 5x One-Step buffer (U+) II with 25x One-Step Enzyme mix (U+) II with water. Wherein, the 5x One-Step buffer (U+) II is diluted 5 times, and the 25x One-Step Enzyme mix (U+) II is diluted 20 times. The 5x One-Step buffer (U+) II and the 25x One-Step Enzyme mix (U+) II are products of Wuhan Hanhai New Enzyme Biotechnology Co., Ltd. (product number HMD3912).
[0045] The present application also provides a method for detecting a plurality of biological nucleic acids for non-disease diagnosis purposes, which comprises:
[0046] In a reaction system containing the DNA to be detected, endonuclease and the probe set and the primer set, the primer set is subjected to PCR amplification to obtain a PCR product; the endonuclease (such as Taq enzyme) is cut at the specific region and the non-specific region of the biological specific probe to obtain a specific fragment and a non-specific fragment; the specific fragment is combined with the PCR product and then melted to obtain a fluorescence signal and a corresponding Tm value; the non-specific fragment is combined with the universal probe and then extended, and then melted to obtain another fluorescence signal and a corresponding Tm value; whether the DNA to be detected contains the nucleic acid of the biological object is determined according to the fluorescence signal and the corresponding Tm value: if the fluorescence signal of a probe is collected in the reaction system and the obtained Tm values are consistent with the theoretical Tm value of the probe, then the DNA to be detected contains or is suspected to contain the nucleic acid of the biological object; otherwise, the DNA to be detected does not contain or is suspected not to contain the nucleic acid of the biological object.
[0047] The probe in the reagent for detecting multiple biological nucleic acids of the present application can form an amplification signal in the PCR reaction amplification stage to judge the sample positive and negative, and for the positive sample, a melting signal is generated in the subsequent melting process in two fluorescence channels, the melting signal 1 is derived from the combination of the probe itself and the target sequence, and the melting signal 2 is derived from the combination and extension of the intermediate primer generated in the amplification process under the endonuclease activity of Taq enzyme and another universal probe to form a series of specific amplicons, the two melting signals are independent of each other and are collectively used as the identification basis of the corresponding target. The reagent for detecting multiple biological nucleic acids of the present application can realize 13-pathogen target detection by using only two fluorescence channels. The reagent for detecting multiple biological nucleic acids of the present application can quickly, multi-target and high-sensitivity (detection limit as low as 5 copies / reaction) complete the identification of multiple biological nucleic acids.
[0048] The present application is further described in detail below with reference to the specific embodiments, and the examples given are only for illustrating the present application, but not for limiting the scope of the present application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the present application. BRIEF DESCRIPTION OF DRAWINGS
[0049] Figure 1 . Detection principle and probe design schematic. A. Melting signal coding mode schematic; B. Double-channel melting signal generation principle schematic; C. Probe design schematic.
[0050] Figure 2 . 13-pathogen (12-pathogen + 1-pathogen internal reference) target double-channel melting temperature clustering analysis.
[0051] Figure 3 . Melting curve of SARS-cov-2 probe. Negative indicates a negative control system without template.
[0052] Figure 4 . Melting curve of influenza virus type A probe. Negative indicates a negative control system without template.
[0053] Figure 5 . Melting curve of influenza virus type B probe. Negative indicates a negative control system without template.
[0054] Figure 6 . Melting curve of human parainfluenza virus type 1 probe. Negative indicates a negative control system without template.
[0055] Figure 7 . Melting curve of human parainfluenza virus type 2 probe. Negative indicates a negative control system without template.
[0056] Figure 8 . Melting curve of human parainfluenza virus type 3 probe. Negative indicates negative control system without template.
[0057] Figure 9 . Melting curve of respiratory syncytial virus probe. Negative indicates negative control system without template.
[0058] Figure 10 . Melting curve of rhinovirus probe. Negative indicates negative control system without template.
[0059] Figure 11 . Melting curve of human adenovirus probe. Negative indicates negative control system without template.
[0060] Figure 12 . Melting curve of human bocavirus probe. Negative indicates negative control system without template.
[0061] Figure 13 . Melting curve of Bordetella pertussis probe. Negative indicates negative control system without template.
[0062] Figure 14 . Melting curve of Mycoplasma pneumoniae probe. Negative indicates negative control system without template.
[0063] Figure 15 . Primer sequences. Wherein, K represents G or T, Y represents C or T, R represents A or G, S represents G or C.
[0064] Figure 16. Probe sequences and modifications. Among them, " / " represents with ROX modification or 2'methoxy modification, the last letter between " / " represents the nucleotide with ROX modification or 2'methoxy modification, for example, the 22nd nucleotide from the 5' end of SARS-cov-2-P with ROX modification, for example, the 14th nucleotide from the 5' end of Inf-B-P with 2'methoxy modification, the 16th nucleotide with ROX modification. Specifically, SARS-cov-2-P labels the fluorescent group ROX at the 22nd nucleotide from the 5' end, and labels the quencher group BHQ2 at the 3' end; Inf-A-P labels the fluorescent group ROX at the 15th nucleotide from the 5' end, and labels the quencher group BHQ2 at the 3' end; Inf-B-P labels the 2'methoxy modification at the 14th nucleotide from the 5' end, labels the fluorescent group ROX at the 16th nucleotide, and labels the quencher group BHQ2 at the 3' end; HPIV-1-P labels the 2'methoxy modification at the 16th nucleotide from the 5' end, labels the fluorescent group ROX at the 24th nucleotide, and labels the quencher group BHQ2 at the 3' end; HPIV-2-P labels the fluorescent group ROX at the 13th nucleotide from the 5' end, and labels the quencher group BHQ2 at the 3' end; HPIV-3-P labels the 2'methoxy modification at the 14th nucleotide from the 5' end, labels the fluorescent group ROX at the 21st nucleotide, and labels the quencher group BHQ2 at the 3' end; RSV-P labels the 2'methoxy modification at the 13th nucleotide from the 5' end, labels the fluorescent group ROX at the 21st nucleotide, and labels the quencher group BHQ2 at the 3' end; RhV-P labels the fluorescent group ROX at the 16th nucleotide from the 5' end, and labels the quencher group BHQ2 at the 3' end; HAdV-P labels the fluorescent group ROX at the 14th nucleotide from the 5' end, and labels the quencher group BHQ2 at the 3' end; HBoV-P labels the 2'methoxy modification at the 14th nucleotide from the 5' end, labels the fluorescent group ROX at the 22nd nucleotide, and labels the quencher group BHQ2 at the 3' end; B. pertussis-P labels the 2'methoxy modification at the 16th nucleotide from the 5' end, labels the fluorescent group ROX at the 28th nucleotide, and labels the quencher group BHQ2 at the 3' end; M. Pneumonia-P labels the 2'methoxy modification at the 13th nucleotide from the 5' end, labels the fluorescent group ROX at the 15th nucleotide, and labels the quencher group BHQ2 at the 3' end; RNaseP-P labels the 2'methoxy modification at the 16th nucleotide from the 5' end, labels the fluorescent group ROX at the 27th nucleotide, and labels the quencher group BHQ1 at the 3' end; the 5' end of the universal probe P is labeled with the fluorescent group Cy5, the 16th nucleotide from the 5' end is labeled with the quencher group BHQ3, and the 3' end is labeled with a three-carbon spacer (C3 Spacer label).
[0065] Figure 17 Target pathogen and detection target.
[0066] Figure 18 PCR reaction and real-time digital melting reaction conditions.
[0067] Figure 19 Sensitivity detection results. DETAILED DESCRIPTION
[0068] The experimental methods in the following examples are all routine methods, which are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, instruments, etc. used in the following examples can be obtained commercially, unless otherwise specified.
[0069] In the quantitative test in the following examples, at least three repeated experiments are set.
[0070] Example 1. Preparation of primer probe set for detecting respiratory pathogens
[0071] In this example, a primer probe set for detecting respiratory pathogens is prepared, which can be used to detect 12 respiratory pathogens (including 10 subtypes of 7 viral pathogens, 2 bacterial pathogens, Figure 17 ), with RNaseP as the internal reference, the primer probe set is composed of a primer set and a probe set. The primer set is composed of pathogen-specific primers, internal reference primers and universal primers, and the sequences of the primers are shown in Figure 15 . The probe set is composed of pathogen-specific probes, internal reference probe RNaseP-P and universal probe P, and the information of each probe is shown in Figure 16 .
[0072] The specific probe design schematic is shown in C of Figure 1 . The probe contains two functional regions: a specific region (blue part) that binds to the corresponding template and a non-specific region (orange part) that does not match the template but is complementary to another universal probe. The non-specific region of the specific probe corresponding to different targets may be the same or different, but it must be complementary to the universal probe. Different non-specific regions will match different positions of the universal probe. Each probe can produce two different fluorescence channel melting signals for its target to be detected, and has two Tm values. The Tm values of each probe are shown in Figure 17 , and the probe set can achieve high-sensitivity and rapid multiplex nucleic acid detection for pathogens (principle see Figure 1 ).
[0073] During the reaction, each probe produces two independent Tm values (two different fluorescence channels) for its target to be detected, and these two Tm values can be used as two-dimensional plane coordinates to determine the target corresponding to the probe.
[0074] Principle of melt curve signal generation in different fluorescence channels: During PCR amplification, the probe is cleaved at the junction between the specific region and the non-specific region under the endonuclease activity of Taq enzyme. The two functional regions after separation can each form a set of Tm signals. The specific region, after completion of PCR amplification, binds to the product obtained by amplification of the target, and generates Tm signal 1 (Tm1, ROX channel signal in this embodiment) during the melting process. The non-specific region, after the 40°C 10 min extension stage after completion of PCR amplification, is complementary to the universal probe added to the system and serves as an intermediate primer to extend the universal probe as a template. Due to the length difference of the extension product, different Tm values are generated during the melting process, i.e., Tm signal 2 (Tm2, CY5 signal in this embodiment).
[0075] The specific probe designed in this embodiment satisfies the following characteristics:
[0076] 1) Contains two functional regions: a specific region (blue part in C) that binds to the corresponding template and a non-specific region (orange part in C) that does not match the template but is complementary to another universal probe; Figure 1 Figure 1 2) The specific region (blue) is 20-45 nucleotides long, with a Tm range of 60-85°C (i.e., Tm1 range);
[0077] 3) The non-specific region (orange) is 8-14 nucleotides long, with a Tm range of 35-45°C;
[0078] 4) The fluorescent group and the quencher group are modified in the specific region (blue), with the quencher group modified at the 3' end and the fluorescent group modified in the middle, with a distance of 15-30 nucleotides between the quencher group and the fluorescent group.
[0079] A 2'-methoxy modification can be added near the junction between the specific region and the non-specific region to prevent excessive cutting of the probe by the exonuclease activity of Taq enzyme. The modification position is within the specific region, 2-4 nucleotides from the junction between the two regions, and needs to be modified between the fluorescent group and the non-specific region;
[0080] The non-specific region can be extended after complementary pairing with the universal probe, and the length of the amplicon after extension is 25-100 nucleotides, with a Tm range of 60-85°C (i.e., Tm2 range).
[0081] The universal probe designed in this embodiment satisfies the following characteristics:
[0082]
[0083] 1) Total length is 60-100 nucleotides, and the full-length Tm value is greater than 80℃;
[0084] 2) The 5' end is modified with a fluorescent group, and the 15-20 nucleotides away from the fluorescent group is modified with a quencher group;
[0085] 3) The fluorescent group and quencher group modified by the universal probe should belong to different fluorescence channels than the groups modified by the specific probe;
[0086] 4) The universal probe sequence is complementary to the non-specific region of the specific probe, and the complementary position is any position between the quencher group modification site and the 3' end of the universal probe. For each non-specific region of the specific probe, the complementary position is uniquely determined.
[0087] Example 2, Detection of respiratory pathogens
[0088] In this example, the primer probe set for detecting respiratory pathogens in Example 1 was used to detect recombinant plasmids containing 12 specific sequences of respiratory pathogens. The plasmids to be tested are as follows:
[0089] pUC57-SARS-cov-2: a recombinant plasmid obtained by inserting the specific fragment of coronavirus SARS-cov-2 into the multiple cloning site of pUC57;
[0090] pUC57-Inf-A: a recombinant plasmid obtained by inserting the specific fragment of influenza virus type A into the multiple cloning site of pUC57;
[0091] pUC57-Inf-B: a recombinant plasmid obtained by inserting the specific fragment of influenza virus type B into the multiple cloning site of pUC57;
[0092] pUC57-HPIV-1: a recombinant plasmid obtained by inserting the specific fragment of human parainfluenza virus type 1 into the multiple cloning site of pUC57;
[0093] pUC57-HPIV-2: a recombinant plasmid obtained by inserting the specific fragment of human parainfluenza virus type 2 into the multiple cloning site of pUC57;
[0094] pUC57-HPIV-3: a recombinant plasmid obtained by inserting the specific fragment of human parainfluenza virus type 3 into the multiple cloning site of pUC57;
[0095] pUC57-RSV: a recombinant plasmid obtained by inserting the specific fragment of respiratory syncytial virus into the multiple cloning site of pUC57;
[0096] pUC57-RhV: a recombinant plasmid obtained by inserting the specific fragment of rhinovirus into the multiple cloning site of pUC57;
[0097] pUC57-HAdV: is a recombinant plasmid obtained by inserting the specific fragment of human adenovirus into the multiple cloning site of pUC57;
[0098] pUC57-HBoV: is a recombinant plasmid obtained by inserting the specific fragment of human bocavirus into the multiple cloning site of pUC57;
[0099] pUC57-B. pertussis: is a recombinant plasmid obtained by inserting the specific fragment of Bordetella pertussis into the multiple cloning site of pUC57;
[0100] pUC57-M. Pneumonia: is a recombinant plasmid obtained by inserting the specific fragment of Mycoplasma pneumoniae into the multiple cloning site of pUC57;
[0101] pUC57-RNaseP: is a recombinant plasmid obtained by inserting the DNA fragment used as an internal reference into the multiple cloning site of pUC57.
[0102] The sequences of each fragment used are as follows:
[0103] SARS-CoV-2:
[0104] ATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACAAGGCGTTCCAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGGTGGTGACGGTAAA (SEQ ID No. 43);
[0105] Influenza virus type A:
[0106] AACACAGATCTTGAGGCTCTCATGGAATGGCTAAAGACAAGACCAATCCTGTCACCTCTGACTAAGGGGATTTTAGGGTTTGTGTTCACGCTCACCGTGCCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTGTCCAAAATGCCCTATCATTGGGATCTTGCACTTGATATTGTGGATTCTTGATCGTCTTTTTTTCAAATGCATTTACCGTCGCTTTAAATACGGACTGAAAGGAGGGCCTTCTACGGAAGGAGTGCCAAAGTCTATGAGGGAAGAATATCGA (SEQ ID No. 44);
[0107] Influenza virus B:
[0108] ATGTCGCTGTTTGGAGACACAATTGCCTACCTGCTTTCACTAATAGAAGATGGAGAAGGCAAAGCAGAACTAGCTGAAAAATTACACTGTTGGTTCGGTGGGAAAGAATTTGACCTAGATTCTGCTTTGGAATGGATAAAAAACAAAAGGTGCCTAACTGATATACAAAAAGCACTAATTGGTGCCTCTATATGCTTTTTAAAACCCAAAGACCAAGAAAGAAAAAGGAGATTCATCACAGAGCCCCTGTCAGGAATGGGAACAACAGCAACAAAGAAGAAAGGCCTAATTCTAGCTGAGAGAAAAATGAGAAGATGTGT (SEQ ID No. 45);
[0109] Human parainfluenza virus 1:
[0110] ACCACAATTTCAGGATGTGTTAGACTACCTTCATTATCAATTGGTGATGCAATATATGCGTATTCATCAAACTTAATCACTCAAGGATGTGCAGATATAGGGAAGTCATATCAGGTTTTACAATTAGGTTACATATCCTTAAATTCAGATATGTATCCTGATTTAAACCCGGTAATTTCTCATACCTATGACATCAACGACAACAGGAAATCATGTTCTGTAATAGCTGCAGGAACAAGGGGTTATCAGTTATGCTCCTTGCCCACTGTGAATGAGACTACAGA (SEQ ID No. 46);
[0111] Human parainfluenza virus type 2:
[0112] CATTGGTGTTACACTCACAATGTAATGCTTGGAGATTGCCTCGATTTCACGACATCTAATCAGTATTTAGCAATGGGGATAATACAACAATCTGCTGCAGCATTTCCAATCTTCAGGACTATGAAAACCATTTACCTAAGTGATGGAATCAATCGCAAAAGCTGTTCAGTCACTGCTATACCAGGAGGTTGTGTCTTGTATTGCTATGTAGCTACAAGATCTGAGAAAGAAGATTATGCCACAACTGATCTAGCTGAACTGAGACTTGCTTTCTATTATTATAATGATACCTTTATTGAAAGAGTCATATCTCTTCCAAATACAACAGGGC (SEQ ID No. 47);
[0113] Human parainfluenza virus type 3:
[0114] TTGATGGAAAGCGATGCTAAAAACTATCAAATCATGGATTCTTGGGAAGAGGAATCAAGAGATAAATCAACTAATATCTCCTCGGCCCTCAACATCATTGAATTCATACTCAGCACCGACCCCCAAGAAGACCTATCGGAAAACGACGAATCCAAGCCCAAGACACAAAAGACAAATGGAAAGGAAAGGAAGGATACAGAAGAGAGCAATCGATTTACAGAGAGGGCAATTACTCTATTGCAGAATCTTGGTGTAATTCAATCCACATCAAAATTAGATTTATACCAAGACAAGCGgGTTGTATGTGTAGCCAATGTACTAAAcAATGTAGACACTGCATCAAA (SEQ ID No. 48);
[0115] Respiratory syncytial virus:
[0116] ATGGAGCCTGAAAATTATAGTAATTTAAAATTAAGGAGAGACATAAGATGAAAGATGGGGCAAATACAAAGATGGCTCTTAGCAAAGTCAAGTTGAATGATACACTCAACAAAGATCAACTTCTGTCATCCAGCAAATACACCATCCAACGGAGCACAGGAGATAGTATTGATACTCCTAATTATGATGTGCAGAAACACATCAATAAGTTATGTGGCATGTTATTAATCACAGAAGATGCTAATCATAAATTCACTGGGTTAATAGGTATGTTATATGC (SEQ ID No. 49);
[0117] Rhinovirus:
[0118] GGTGTGAAGAGCCGCGTGTGCTCACTTTGAGTCCTCCGGCCCCTGAATGCGGCTAACCTTAAACCTGCAGCCATGGCTCATAAGCCAATGAGTTTATGGTCGTAACGAGTAATTGCGGGATGGGACCGACTACTTTGGGTGTCCGTGTTTCACTTTTTCCTTTATTAATTGGGGTGTTCTGGAACCAGTATATTCAATACTATGATTAATAACATTATAATAAGAACACTAGTTCTAGATGCATACAAAAATATTGATCTGGACAAGCTTAAAATAATTGCATATGGTGATGAT (SEQ ID No. 50);
[0119] Human adenovirus:
[0120] GAGAACCAGATTTTGGCGCGCCCGCCAGCCCCCACCATCACCACCGTCAGTGAAAACGTTCCTGCTCTCACAGATCACGGGACGCTACCGCTGCGCAACAGCATCGGAGGAGTCCAGCGAGTGACCATTACTGACGCCAGACGCCGCACCTGCCCCTACGTTTACAAGGCCCTGGGCATAGTCTCGCCGCGCGTCCGTAGATGTACCTGGACATCCAGGTGATGCCGGCGGCGGTGGTGGAGGCGCGCGGAAAGTCGCGGACGCGGTTCCAGATGTTGCGCAGCGGCA (SEQ ID No. 51);
[0121] Human bocavirus:
[0122] GACACAGTGGGGAGAGAGGCTCGGGCTCATATCATCAGGAACACCCAATCAGCCACCTATCGTCTTGCACTGCTTCGAAGACCTCAGACCAAGTGATGAAGACGAGGGAGAGTACATCGGGGAAAAAGCTGCCGCTTCCAGAACATTACAGAAAAAACTACCACGCAACCCTAGATAACGAAGTCATGCCAGGGCCTCAAACAATGGCCTATGGAGGACGTGGTCCGTGGGAACATCTTCCTGAGGTAGGAGATCAGCGCCTAGCTGCGTCTTCTGTTAGCACTACTTATAAACCTAAC (SEQ ID No. 52);
[0123] Bordetella pertussis:
[0124] CCACGGCGCTGCCCCAGGTCCGGGTCTCTTTGGTCAATCCCGCCCAGGCCCGGGACTTTGCCAAGGCCTTGGCGCTGCGCTCCAAAAATGATGCGCTCGACAGCTACGTGCTGGCTCGCTATGGACAGACGCTGAGCCCGGCGCTGTCGATGGTTCCATCGACAAGGCCATCGCGTTCTTGCGCGAACAGATCAAACAAATCGAGCGGGCGATCGATCAGCACATCGACAACCACCCCGACCTCAAGCAAGACTGCGAGCTGCTGAACTCCATCCCCGCCATCGGGCCTCAGGCCGGCAACGCCATCCT (SEQ ID No. 53);
[0125] Mycoplasma pneumoniae:
[0126] ATCAAGCTCAGTCCGACTCGCAAGGATCTACCACCACCGCAACAAGGAACGCCTTACCGGAGCACCCGAATGCTTTGGCCTTTCAGGTGAGTGTGGTGGAAGCGAGTGCTTACAAGCCAAACACGAGCTCCGGCCAAACCCAATCCACTAACAGTTCCCCCTACCTGCACTTGGTGAAGCCTAAGAAAGTTACCCAATCCGACAAGTTAGACGACGATCTTAAAAACCTGTTGGACCCCAACCAGGTTCGCACCAAGCTGCGCCAAAGCTTTGGTACAGACCATTCCACCCAGC (SEQ ID No. 54);
[0127] RNase P (internal control):
[0128] GCCACTATGGGACTTCAGCATGGCGGTGTTTGCAGATTTGGACCTGCGAGCGGGTTCTGACCTGAAGGCTCTGCGCGGACTTGTGGAGACAGCCGCTCACCGTGAGTTGCCCCGGCTTCGCGCCTGGCAACTTGAAAAACATTCTGGAGGTAAGCAAGCCTGGAGGCCAGGAGCCTAGGAGGGCTATTTGATCCAGATGAGAAGTAATGGTGACCTGAACTAGGGCAGAGGCACCTAGGATTGGAAAACATGGACAGATCACAGCACTACTTATGTAGTATACTTGGTAAGACCTGGTTGTTTAAAAGAGAAGGATGAG (SEQ ID No. 55).
[0129] wherein the underlined portion is the binding region of the pathogen-specific portion of the primer in Figure 15
[0130] 1. Preparation of the primer probe mixture: the primer probe set for detecting respiratory pathogens in Example 1 is mixed to obtain the primer probe mixture.
[0131] 2. Preparation of buffer & enzyme mixture: 5x One-Step buffer (U+) II was diluted 5 times, 25x One-Step Enzyme mix (U+) II was diluted 20 times, and 5x One-Step buffer (U+) II and 25x One-Step Enzyme mix (U+) II were mixed with water to obtain a mixture, wherein 5x One-Step buffer (U+) II and 25x One-Step Enzyme mix (U+) II were products of Wuhan Hanhai New Enzyme Biotechnology Co., Ltd. (product code HMD3912).
[0132] 3. Preparation of nucleic acid mixture: equal molar of each recombinant plasmid was mixed to obtain a nucleic acid mixture, and the concentration of each plasmid was 200 copies / 30 μl.
[0133] 4. Preparation of reaction system: 5 μl of primer probe mixture, 15 μl of buffer & enzyme mixture, and 30 μl of nucleic acid mixture. The concentration of primer probe in the reaction system was shown in Table 1. Figure 15 and Figure 16 The system without template was used as a negative control.
[0134] 5. The reaction system was added to the sample hole of the dPCR chip, and pressure injection was performed to disperse it into the microcell.
[0135] 6. The PCR reaction was performed according to the PCR program, and the amplification signal of the specific primer was used to determine whether the sample was positive. If it was positive, the real-time digital melting reaction was continued to collect the fluorescence signal. The conditions of PCR reaction and real-time digital melting reaction were shown in Table 2. Figure 18 .
[0136] 7. Data analysis
[0137] After the experiment, the fluorescence signals of all fluorescence channels of each microcavity on the dPCR chip were obtained, and the melting curve (Fig. 2) was drawn by using the analysis software, and the Tm value of each melting curve was obtained. The two-dimensional scatter plot (Fig. 3) was drawn with the Tm value of the ROX fluorescence channel as the horizontal coordinate axis and the Tm value of the CY5 fluorescence channel as the vertical coordinate axis, and the Tm value of the scatter point basically met the expected Tm value. The expected Tm value of each target was shown in Table 3. Figures 3-14 . Figure 2 . Figure 17 .
[0138] For the probe of internal reference RNase P, the Tm value of ROX fluorescence channel is 82.0℃, the Tm value of CY5 fluorescence channel is 80.6℃, Figure 2 The scatter point containing the coordinates indicates that the experiment is normal. For the probe of SARS-cov-2, the Tm value of ROX fluorescence channel is 77.1℃, the Tm value of CY5 fluorescence channel is 72.1℃, Figure 2 The scatter point containing the coordinates indicates that the sample to be tested contains a recombinant plasmid containing a specific fragment of SARS-cov-2; for the probe of influenza virus A, the Tm value of ROX fluorescence channel is 68.2℃, the Tm value of CY5 fluorescence channel is 66.2℃, Figure 2 The scatter point containing the coordinates indicates that the sample to be tested contains a recombinant plasmid containing a specific fragment of influenza virus A; for the probe of influenza virus B, the Tm value of ROX fluorescence channel is 62.9℃, the Tm value of CY5 fluorescence channel is 72.1℃, Figure 2 The scatter point containing the coordinates indicates that the sample to be tested contains a recombinant plasmid containing a specific fragment of influenza virus B; for the probe of human parainfluenza virus 1, the Tm value of ROX fluorescence channel is 68.5℃, the Tm value of CY5 fluorescence channel is 78.8℃, Figure 2 The scatter point containing the coordinates indicates that the sample to be tested contains a recombinant plasmid containing a specific fragment of human parainfluenza virus 1; for the probe of human parainfluenza virus 2, the Tm value of ROX fluorescence channel is 65.3℃, the Tm value of CY5 fluorescence channel is 74.2℃, Figure 2 The scatter point containing the coordinates indicates that the sample to be tested contains a recombinant plasmid containing a specific fragment of human parainfluenza virus 2; for the probe of human parainfluenza virus 3, the Tm value of ROX fluorescence channel is 61.3℃, the Tm value of CY5 fluorescence channel is 74.9℃, Figure 2 The scatter point containing the coordinates indicates that the sample to be tested contains a recombinant plasmid containing a specific fragment of human parainfluenza virus 3; for the probe of respiratory syncytial virus, the Tm value of ROX fluorescence channel is 64.3℃, the Tm value of CY5 fluorescence channel is 67.1℃, Figure 2 The scatter point containing the coordinates indicates that the sample to be tested contains a recombinant plasmid containing a specific fragment of respiratory syncytial virus; for the probe of rhinovirus, the Tm value of ROX fluorescence channel is 75.5℃, the Tm value of CY5 fluorescence channel is 66.9℃, Figure 2 The scatter point containing the coordinates indicates that the sample to be tested contains a recombinant plasmid containing a specific fragment of rhinovirus; for the probe of human adenovirus, the Tm value of ROX fluorescence channel is 77.2℃, the Tm value of CY5 fluorescence channel is 75.9℃, Figure 2The scattered dots containing the coordinates indicate that the sample to be detected contains the recombinant plasmid containing the specific fragment of human adenovirus; for the probe of human bocavirus, the Tm value of the ROX fluorescence channel is 70.7℃, and the Tm value of the CY5 fluorescence channel is 83.3 or 77.4℃, Figure 2 The scattered dots containing the coordinates indicate that the sample to be detected contains the recombinant plasmid containing the specific fragment of human bocavirus; for the probe of human bocavirus, the Tm value of the ROX fluorescence channel is 70.7℃, and the Tm value of the CY5 fluorescence channel is 83.3 or 77.4℃, Figure 2 The scattered dots containing the coordinates indicate that the sample to be detected contains the recombinant plasmid containing the specific fragment of human bocavirus; for the probe of human bocavirus, the Tm value of the ROX fluorescence channel is 70.7℃, and the Tm value of the CY5 fluorescence channel is 83.3 or 77.4℃, Figure 2 The scattered dots containing the coordinates indicate that the sample to be detected contains the recombinant plasmid containing the specific fragment of human bocavirus; for the probe of human bocavirus, the Tm value of the ROX fluorescence channel is 70.7℃, and the Tm value of the CY5 fluorescence channel is 83.3 or 77.4℃,
[0139] The above results show that the probe of the present application can not only detect 12 kinds of pathogens, but also distinguish each pathogen.
[0140] Example 3, Sensitivity of detecting respiratory pathogens
[0141] Each plasmid in Example 2 was diluted to a concentration of 200 copies / 30 microliters of nucleic acid mixed solution, and then detection was performed according to steps 1-7 in Example 2, and the concentration of each plasmid in the system was 5 copies / 30 microliters.
[0142] The obtained sensitivity results are shown in Table 3. Figure 19 Wherein, "theoretical concentration" is the actual concentration of the template in the system, and "actual measured concentration" is the copy number detected by the reaction.
[0143] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under the same parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In summary, according to the principle of the present application, this application intends to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which deviates from the range disclosed in the present application. Some basic features can be applied according to the scope of the following attached claims.
Claims
1. A reagent for detecting a plurality of biological nucleic acids, characterized by: The reagent contains a probe set for detecting the plurality of biological nucleic acids, and the probe set contains a universal probe and n biological-specific probes; The biological-specific probes are all single-stranded DNA labeled with a fluorescent group and a quencher group, and the fluorescent group and the quencher group are respectively marked as fluorescent group 1 and quencher group 1; the sequence of the biological-specific probe is obtained by connecting a biological-specific region and a non-biological-specific region, the biological-specific region is used for specific binding with a biological nucleic acid, the non-biological-specific region does not specifically bind with the biological nucleic acid, and the non-biological-specific regions of the n biological-specific probes are different; the quencher group 1 is labeled at the end of the biological-specific probe away from the non-biological-specific region, and the fluorescent group 1 is labeled at one end of the biological-specific region close to the non-biological-specific region; The universal probe is single-stranded DNA labeled with a fluorescent group and a quencher group, and the fluorescent group and the quencher group are respectively marked as fluorescent group 2 and quencher group 2, and the fluorescent group 2 is different from the fluorescent group 1; the sequence of the universal probe contains the reverse complementary sequence of the non-biological-specific region, the quencher group 2 is labeled in the middle of the universal probe and not on the reverse complementary sequence of the non-biological-specific region, and the fluorescent group 2 is labeled at the end of the universal probe and located on both sides of the quencher group 2 and the reverse complementary sequence of the non-biological-specific region; The length of the biological-specific region is 20-45 nucleotides; the length of the non-biological-specific region is 8-14 nucleotides; and the distance between the fluorescent group 1 and the quencher group 1 is 15-30 nucleotides; The Tm value of the biological-specific region ranges from 60 to 85°C; and the Tm value of the non-biological-specific region ranges from 35 to 45°C; The length of the universal probe is 60-100 nucleotides; and the distance between the fluorescent group 2 and the quencher group 2 in the universal probe is 15-20 nucleotides.
2. The agent of claim 1, wherein: The biological-specific region between the fluorescent group 1 labeled nucleotide and the non-biological-specific region is also modified with 2-methoxy.
3. The agent according to claim 1 or 2, characterized in that: The reagent also contains a primer set for amplifying the plurality of biological nucleic acids, and the primer set contains a primer pair for amplifying each biological nucleic acid.
4. The agent according to claim 1 or 2, characterized in that: The primer set contains a universal primer pair, and each primer pair for amplifying each biological nucleic acid contains two primers of the universal primer pair.
5. The agent of claim 1 or 2, wherein: The reagent also contains an endonuclease.
6. A method for detecting a plurality of biological nucleic acids other than for the purpose of disease diagnosis, characterized by: The method comprises: In a reaction system containing the DNA to be detected, endonuclease, the probe set according to any one of claims 1-4, and a primer set for amplifying the plurality of biological nucleic acids, the primer set is subjected to PCR amplification to obtain a PCR product; the endonuclease is used to cut the specific region and the non-specific region of the biological specific probe to obtain a specific fragment and a non-specific fragment; the specific fragment is combined with the PCR product and then melted to obtain a fluorescence signal and a corresponding Tm value; the non-specific fragment is combined with the universal probe and then extended, and then melted to obtain another fluorescence signal and a corresponding Tm value; whether the DNA to be detected contains the nucleic acid of the target organism is determined according to the fluorescence signal and the corresponding Tm value; if the fluorescence signal of a probe is collected in the reaction system and the obtained Tm value is consistent with the theoretical Tm value of the probe, then the DNA to be detected contains or is suspected to contain the nucleic acid of the target organism; otherwise, the DNA to be detected does not contain or is suspected not to contain the nucleic acid of the target organism.
Citation Information
Patent Citations
Multiplex nucleic acid quantitative detection method based on digital PCR (Polymerase Chain Reaction) technology
CN115851890A
Method for detecting target nucleic acid
CN117043334A
Probe combination, primer group and kit for real-time fluorescent PCR (Polymerase Chain Reaction) detection of target gene and application of probe combination, primer group and kit
CN117363767A