SERS biosensor as well as preparation method and application thereof

Abstract

The invention belongs to the field of spectroscopy detection, and relates to an SERS (Surface Enhanced Raman Scattering) biosensor and a preparation method and application thereof, in particular to an SERS biosensor based on a CRISPR / Cas13a system and a DNAzyme signal amplification strategy, a preparation method of the SERS biosensor and application of the SERS biosensor in preparation of a nucleic acid detection kit, especially application of the SERS biosensor in preparation of a gastric cancer exosome nucleic acid detection kit. The SERS biosensor comprises an SERS sensing chip, a first reagent and a second reagent, the SERS sensing chip is a silver nanorod array substrate modified with a tetrahedral DTP probe; the first reagent is an SERS probe, a buffer solution of the SERS probe and a ZnSO4 solution; the second reagent is a CRISPR / Cas13a system and a buffer solution thereof; the reagents and a nucleic acid sample to be detected are mixed and then dropwise added to the surface of an SERS sensing chip, and high-sensitivity accurate detection of nucleic acid such as gastric cancer exosome nucleic acid is realized by virtue of a CRISPR / Cas13a system, a DNAzyme signal amplification strategy and SERS enhancement performance of a silver nanorod array substrate.

Description

Technical Field

[0001] The present invention belongs to the field of spectroscopic detection and relates to a SERS biosensor and a preparation method and application thereof. Specifically, it relates to a SERS biosensor based on the CRISPR / Cas13a system and a DNAzyme signal amplification strategy, a preparation method thereof, and application thereof in the preparation of a nucleic acid detection kit, especially an application in a gastric cancer exosome nucleic acid detection kit. Background Art

[0002] Gastric cancer is one of the malignant tumors with high morbidity and mortality rates worldwide, posing a serious threat to human health. The early symptoms of gastric cancer are not significant and are easily ignored or misdiagnosed as other gastrointestinal diseases. Therefore, most gastric cancer patients often miss the best time for treatment, which greatly reduces the effectiveness of treatment and the survival rate of patients. At present, the main detection methods for gastric cancer include endoscopy, CT scan and endoscopic ultrasound. However, these methods have problems such as insufficient sensitivity and specificity in the early stages of gastric cancer, complex operation and high cost. There is an urgent need to develop a highly sensitive and specific detection method to improve the early diagnosis rate of gastric cancer.

[0003] Liquid biopsy, as an emerging diagnostic method, offers the advantages of being non-invasive, easy to use, enabling real-time monitoring, and enabling multiple sampling. MicroRNAs (miRNAs) are a class of short, non-coding RNAs consisting of approximately 22 nucleotides. Numerous studies have shown that their expression is closely associated with various diseases, making miRNAs a promising biomarker for disease diagnosis.

[0004] Compared to the complex vesicle structures of exosomes, miRNAs are more specific. Exosomes carry a wide variety of components, making it difficult to pinpoint key information closely related to the development and progression of cancer simply by detecting exosomes. For example, the expression of exosome surface markers can be influenced by multiple factors and may vary under different physiological or pathological conditions. Compared to miRNAs, which are widely involved in regulating gene expression, miRNA expression is limited. During the development and progression of cancer, the expression of specific miRNAs changes, which is closely related to the development and progression of cancer. Compared to simply detecting exosomes, detecting miRNAs in exosomes can more accurately reflect the characteristics of cancer and improve diagnostic specificity.

[0005] Compared to circulating miRNAs, exosomal miRNAs offer several advantages as biomarkers: first, the exosome envelope protects miRNAs from degradation by RNases; second, exosomal miRNAs are stable for up to five years at -20°C and can withstand a limited number of freeze-thaw cycles. These characteristics give exosomal miRNAs significant advantages over circulating miRNAs as biomarkers, and liquid biopsy research is increasingly focusing on exosomal miRNAs. For example, miRNA-106a is highly expressed in gastric cancer tissue, suggesting that accurate detection of miRNA-106a in exosomes could potentially enable efficient and early diagnosis of gastric cancer. However, detection of exosomal miRNAs faces the dual challenges of a complex biological environment and low abundance.

[0006] Commonly used exosomal nucleic acid detection techniques, such as fluorescence detection, electrochemical detection, and RT-qPCR, have certain shortcomings in practical applications. Although fluorescence detection methods offer high sensitivity, they are susceptible to interference from background fluorescence and require complex labeling procedures. Electrochemical detection methods offer reasonable sensitivity and specificity, but they require high electrode materials and suffer from poor signal stability. RT-qPCR is a widely used nucleic acid detection method with high sensitivity and specificity, but its operation is cumbersome, detection time is long, and it requires stringent equipment and experimental conditions, resulting in high costs. In contrast, new biosensor technologies have been widely used for the qualitative and quantitative analysis of trace molecules due to their high sensitivity, rapid detection speed, and convenient operation. Among them, surface-enhanced Raman scattering (SERS) technology can detect at the single-molecule level, providing rich molecular spectral information. It accurately identifies target molecules through a unique Raman spectral fingerprint, while avoiding the spectral overlap issues encountered in fluorescence detection. SERS technology is simple to operate and has a fast detection speed, making it suitable for rapid on-site analysis and large-scale screening. It also enables multiplexed detection, greatly improving detection throughput and efficiency.

[0007] However, exosomes derived from specific cells only account for a very small proportion of all exosomes in body fluids. Their tiny size and limited content pose a huge challenge to improving detection sensitivity, making it difficult to meet the detection needs of extremely low-abundance exosome miRNAs. In recent years, SERS-based exosome miRNA detection technology has gradually developed: for example, the SERS nanoplasmonic platform developed by the Qi team (Qi G, Diao X, Tian Y, et al. Electroactivated SERS Nanoplatform for Rapid and Sensitive Detection and Identification of Tumor-Derived Exosome miRNA [J]. Analytical Chemistry, 2024, 96 (46), 18519-18527.) achieved linear detection of exosome miRNA (0.5-3nM), but its sensitivity still cannot meet clinical detection requirements. In order to improve sensitivity, signal amplification strategy has become the key to improving analytical performance. Zhao's team (Zhao Y, Fang X, Bai M, et al. A microfluidic surface-enhanced Raman scattering (SERS) sensor for microRNA in extracellular vesicles with nucleic acid-tyramine cascade amplification [J]. Chinese Chemical Letters, 2022, 33 (4): 2101-2104.) combined rolling circle amplification (RCA) with tyramine signal amplification (TSA) technology to develop a cascade amplification SERS biosensor with a detection limit of 1 pM, but the sensitivity improvement came at the expense of a 4-hour detection time; Ma's team (Ma D, Huang C, Zheng J, et al. Quantitative detection of exosomal microRNA extracted from human blood based on surface-enhanced Raman scattering[J].Biosensors&Bioelectronics,2018,101:167-173.) The detection time was shortened to 60 minutes by using Au@R6G@AgAu nanoparticles combined with double-stranded specific nuclease (DSN)-mediated target cyclic amplification technology. However, the sensor exhibited nonlinear calibration characteristics within the test concentration range, which increased the difficulty of quantitative analysis.Therefore, developing exosomal miRNA SERS sensors with both high sensitivity and rapid response remains a major challenge. Summary of the Invention

[0008] Purpose of the invention: In response to the demand for highly sensitive detection of exosome nucleic acids, the present invention combines the CRISPR / Cas13a system with the DNAzyme signal amplification strategy to provide a SERS biosensor and its preparation method and application. The SERS biosensor exhibits excellent nucleic acid detection performance: simple preparation, no amplification and professional technicians are required for detection, short detection time (80 minutes), wide linear range (100aM to 1nM), high sensitivity (detection limit as low as 53.16aM level), good specificity, excellent reproducibility and satisfactory recovery rate in human serum. In addition, the SERS biosensor successfully detected exosome nucleic acids from gastric cancer cells, with a detection limit of exosomes as low as 6.1×10 3 particles / mL, which can achieve highly sensitive detection of gastric cancer exosome nucleic acids, providing an innovative and feasible solution for early gastric cancer diagnosis.

[0009] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0010] In a first aspect, the present invention provides a SERS biosensor, comprising: a SERS sensor chip, a first reagent, and a second reagent;

[0011] like Figure 1a As shown, the SERS sensor chip is a silver nanorod array substrate modified with tetrahedral DTP probes; the tetrahedral DTP probes are assembled from DNA single chains with base sequences as shown in SEQ ID NO: 1 to SEQ ID NO: 7, and the DNA single chains shown in SEQ ID NO: 1 to SEQ ID NO: 7 are respectively denoted as DNA single chains A, B, C, D, E, F and H3; wherein the 5' ends of single chains A, E and F are modified with SH-(CH2)6;

[0012] The first reagent is a SERS probe, a buffer solution and a ZnSO4 solution; Figure 1bAs shown, the SERS probe is prepared by modifying the surface of gold nanoparticles with a double-stranded binder DNAzyme / LS, a hairpin-type nucleic acid chain H1, and a Raman signal molecule 4-mercaptobenzoic acid (4-MBA); the double-stranded binder DNAzyme / LS is a conjugate of a single-stranded DNA DNAzyme and a closed chain LS, wherein the base sequences of DNAzyme, LS, and H1 are shown in SEQ ID NO: 8 to SEQ ID NO: 10, respectively; wherein the 5' end of DNAzyme is modified with SH-(CH2)6, and the 3' end of H1 is modified with SH-(CH2)6; the molar ratio of the assembled substances of DNAzyme / LS and H1 is in the range of 1:1 to 1:6 and preferably 1:3; preferably, the buffer of the SERS probe is 0.5×TBE;

[0013] The second reagent is a CRISPR / Cas13a system and its buffer; the CRISPR / Cas13a system includes Cas13a protein, crRNA and uracil-modified hairpin-type recognition single-stranded H2; the crRNA base sequence is shown in SEQ ID NO: 11, and the uracil-modified hairpin-type recognition single-stranded H2 base sequence is shown in SEQ ID NO: 12; preferably, the configuration concentrations of the Cas13a protein and crRNA are both 0.1 to 2 μM, and the configuration concentration of the uracil-modified hairpin-type recognition single-stranded H2 is 1 to 30 μM.

[0014] Preferably, the particle size of the gold nanoparticles is 15 nm.

[0015] Preferably, the SERS sensor chip is prepared by co-culturing a tetrahedral DTP probe with a silver nanorod array substrate for 3 hours, wherein the tetrahedral DTP probe is connected to the substrate surface via a thiol group to form an Ag-S covalent bond with the silver nanorods;

[0016] The tetrahedral DTP probe is formed by mixing seven DNA chains, namely A, B, C, D, E, F and H3, and then annealing them. The annealing step includes: heating to 95°C for 5 minutes, cooling to 4°C and holding for 30 minutes. The silver nanorod array is prepared using vacuum electron beam evaporation coating equipment and oblique angle deposition technology. The silver nanorod array substrate is covered with a layer of polydimethylsiloxane (PDMS) film with 3×10 small holes, and the aperture of each small hole is 4 mm and the height is 1 mm.

[0017] Preferably, the steps of preparing the SERS probe and its buffer in the first reagent include:

[0018] 1) Mix the single-stranded DNAzyme with triscarboxyethylphosphine solution (TCEP) at a ratio of 1:1000 to remove disulfide bonds, adjust the volume to 50 μM, and react at 25°C for 3 hours; then mix the 50 μM DNAzyme with 50 μM closed-chain LS and anneal to form a DNAzyme / LS hybrid product;

[0019] 2) The hairpin nucleic acid chain H1 was mixed with TCEP at a molar ratio of 1:1000, the volume was fixed to 50 μM, and the mixture was reacted at 25°C for 3 hours before annealing.

[0020] 3) Mixing 50 μM of the DNAzyme / LS solution obtained in step 1), 50 μM of the H1 solution obtained in step 2), and 2.3 nM of the AuNPs solution in 5×TBE buffer, and incubating the mixture with shaking at 300 rpm at 25°C for 6 hours. The volume ratio of the DNAzyme / LS solution, H1 solution, AuNPs solution, and 5×TBE buffer was 1:3:200:20.

[0021] 4) adding 2M NaCl solution in a volume of 2, 4, 6, and 8 times the volume of the DNAzyme / LS solution to the mixture obtained in step 3) every 0.5 hour, and incubating at 25° C. with shaking at 300 rpm for 6 hours;

[0022] 5) To the mixture obtained in step 4), 100 μM 4-MBA was added in a volume 10 times that of the DNAzyme / LS solution added, and the mixture was incubated with shaking at 300 rpm at 25°C for 3 hours. The mixture was then centrifuged at 12,000 rpm for 20 minutes in 0.5×TBE buffer and washed three times by centrifugation. Finally, the SERS probe was redispersed in 12 times the volume of the DNAzyme / LS solution added in 0.5×TBE buffer and stored at 4°C for subsequent use.

[0023] In a second aspect, the present invention provides the use of the aforementioned SERS biosensor in the preparation of a nucleic acid detection kit. The nucleic acid, or target strand, includes, but is not limited to, high-fidelity, specific fragments of miRNA-like nucleic acids and long non-coding RNA (lncRNA). Long non-coding RNAs are RNA molecules longer than 200 nucleotides that do not encode proteins. Although they do not participate in protein synthesis, studies have shown that lncRNAs play an important regulatory role in various biological processes, including gene expression, chromatin structure, cell differentiation, and immune responses, and are closely associated with diseases such as cancer and neurodegenerative diseases.

[0024] As a preferred embodiment of the application of the SERS biosensor of the present invention in the preparation of a nucleic acid detection kit, the application is a two-step method, and the application steps include:

[0025] In the first step, 0.5 μM Cas13a, 0.5 μM crRNA, 20 μM H2, 10× Reaction Buffer and target chain solutions of different gradient concentrations in the second reagent were mixed respectively, wherein the target chain solution of different gradient concentrations refers to miR-106a with a gradient concentration increasing from 100 aM to 1 nM and DEPC-treated water as blank; after mixing, react at 37°C and 40 rpm for 30 minutes, wherein the configuration volume ratio of Cas13a, crRNA, H2, 10× Reaction Buffer, and target chain solution is 1:1:2:6:4;

[0026] In the second step, the SERS probe, 1×TM buffer, and 20 μM ZnSO4 solution in the first reagent were mixed with the reaction system in the first step, and then dropped into the small hole of the SERS sensor chip after mixing. The reaction was carried out at 37°C and 40 rpm for 50 minutes. The volume of SERS probe, 1×TM buffer, and ZnSO4 solution added were 12 times, 8 times, and 4 times the amount of Cas13a added, respectively. After the reaction, each small hole was washed three times with ultrapure water for subsequent testing.

[0027] During the test, the central area of each well was selected to collect the SERS spectrum. A calibration curve was constructed based on the SERS characteristic peak intensity and the Target chain concentration, and the detection limit was calculated. Calibration curve drawing method: the target logarithmic concentration was used as the horizontal axis, the value of the SERS characteristic peak was used as the vertical axis, a scatter plot was drawn, and the scatter plot was linearly fitted to obtain the calibration curve and linear relationship. Detection limit (LOD) calculation method: the sum of the blank signal average value and its 3 times standard deviation was substituted into the calibration curve relationship. The calculated concentration is the detection limit. Unless otherwise specified, the detection limit is calculated according to this definition throughout the text.

[0028] In a third aspect, the present invention provides the use of the above-mentioned SERS biosensor in preparing a gastric cancer exosome nucleic acid detection kit, wherein the application steps include: extracting gastric cancer exosome nucleic acid and preparing a nucleic acid detection kit;

[0029] The gastric cancer exosome nucleic acid extraction step comprises: growing the human gastric cancer cell line SGC-7901 to be detected in a cell culture medium containing 10% FBS and 1% penicillin / streptomycin in a DMEM cell culture medium at 37°C and 5% CO 2；When the cells grew to 80% confluence, the culture medium was removed, and the cells were washed three times with 1×PBS (pH=7.0) buffer, and then the culture medium was replaced with DMEM medium containing 10% dFBS (Exosomes-depleted FBS) and 1% penicillin / streptomycin; after 48 hours, the culture supernatant was collected and centrifuged several times, wherein the first centrifugation (500g, 4°C) was 10 minutes to remove cells; the second centrifugation (10000g, 4°C) was 90 minutes to remove apoptotic bodies and cell debris; the third centrifugation (1000000g, 4°C) was 120 minutes, and the supernatant was removed; finally, the centrifugal sediment was dispersed with 1×PBS (pH 7.0) buffer to obtain the exosome test solution derived from human gastric cancer cell SGC-7901; the exosome test solution derived from human gastric cancer cell SGC-7901 was lysed to obtain a lysate to facilitate the detection of miR-106a therein; the lysis treatment steps included: using immunostaining permeabilization solution (Triton X-100, 1%) was mixed with exosomes at a volume ratio of 1:9 at 37°C for 10 min to lyse the exosomes, and different exosome concentrations (10 4 ~10 7 particles / mL) lysate;

[0030] The steps of preparing the nucleic acid detection kit include: taking lysates of different exosome concentrations as targets, and using a mixed solution of 1×PBS (pH=7.0) buffer and immunostaining permeabilization solution (Triton X-100, 1%) as blank for detection; using the SERS biosensor described in the first aspect for detection, and preferably, using the two-step method described in the second aspect for detection; after collecting SERS spectra, calculating the miR-106a concentration in exosomes of different concentrations through the working curve, and constructing a calibration curve based on the SERS characteristic peak intensity and exosome concentration to calculate the detection limit.

[0031] The detection principle of the present invention is as follows: Figure 1c As shown, for example, the SERS biosensor provided by the present invention is used for gastric cancer exosome nucleic acid detection. When the target nucleic acid miR-106a is present, miR-106a will complementarily hybridize with the crRNA wrapped inside the Cas13a protein, activating the RNA enzymatic activity of the Cas13a protein; the activated CRISPR / Cas13a system can cut any single-stranded RNA, including the uracil-modified hairpin-type recognition single-stranded H2, which can be cut to produce a DNA fragment US; subsequently, the US fragment can complement the LS of the double-stranded binder DNAzyme / LS on the SERS probe to form a double-stranded structure, releasing the capture end of the DNAzyme; in the presence of Zn 2+Under the presence of conditions, DNAzyme walks on the surface of the SERS probe and specifically cuts the special site of the hairpin H1. The DNA fragment H1-half generated after cutting can hybridize with the H3 hairpin on the tetrahedral DTP probe, so that the SERS probe is captured by the tetrahedral DTP probe on the surface of the SERS sensor chip, thereby outputting a significantly enhanced Raman signal from the Raman molecule 4-MBA on the SERS probe, realizing the detection of the target nucleic acid; one target nucleic acid in the sample can activate the CRISPR / Cas13a system to produce a large number of US fragments, thereby realizing highly sensitive detection of the target nucleic acid.

[0032] Beneficial effects: Compared with the prior art, the SERS biosensor provided by the present invention uses gold nanoparticle-modified DNA hairpin H1, DNAzyme / LS and Raman signal molecule 4-MBA as SERS probes, and modifies tetrahedral DTP probes on silver nanorod arrays as SERS capture substrates. Combining the CRISPR / Cas13a and DNAzyme signal amplification strategies, the constructed biosensor specifically recognizes miR-106a through the CRISPR / Cas13a system, activates trans-cleavage activity, cuts hairpin H2 to produce single-stranded US to trigger the DNAzyme reaction, thereby amplifying the signal and outputting the SERS signal. The SERS biosensor provided by the present invention exhibits excellent miRNA-106a detection performance: short detection time (<80 minutes), wide linear range (100aM to 1nM), and a detection limit as low as 53.16aM. It also has good specificity, excellent reproducibility and satisfactory recovery in human serum. For example, the sensor was used for gastric cancer exosome nucleic acid detection. It successfully detected gastric cancer cell-derived exosome miRNA-106a, with a detection limit of exosomes as low as 6.1×10 3 particles / mL, which can achieve highly sensitive detection of gastric cancer exosome nucleic acids, providing an innovative and feasible solution for early gastric cancer diagnosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1a Schematic diagram of the assembly process of the SERS sensor chip of the present invention;

[0034] Figure 1b Schematic diagram of the assembly process of the SERS probe of the present invention;

[0035] Figure 1c This is a diagram showing the working principle of the SERS biosensor for gastric cancer exosome nucleic acid detection according to the present invention;

[0036] Figure 2a is an absorption spectrum characterization diagram of the SERS probe of the present invention;

[0037] Figure 2bThis is a dynamic light scattering characterization diagram of the SERS probe of the present invention;

[0038] Figure 2c is a SERS spectrum characterization diagram of the SERS probe of the present invention;

[0039] Figure 3a This is a gel electrophoresis representation of the CRISPR / Cas13a system mechanism of the present invention;

[0040] Figure 3b This is a gel electrophoresis characterization diagram of the sensing mechanism of the SERS biosensor of the present invention;

[0041] Figure 4a The SERS spectrum diagram of the SERS biosensor sensing mechanism of the present invention;

[0042] Figure 4b for Figure 4a The spectral lines at 1077cm -1 SERS peak intensity corresponding to the Raman shift;

[0043] Figure 5a The SERS spectra of the two-step and one-step SERS biosensor sensing strategies of the present invention are compared;

[0044] Figure 5b for Figure 5a The spectral lines at 1077cm -1 SERS peak intensity corresponding to the Raman shift and the corresponding signal-to-noise ratio;

[0045] Figure 6a The DNA feed ratios of the SERS probe DNAzyme and H1 are different;

[0046] Figure 6b The SERS spectra of the SERS probe DNAzyme and H1 at different ratios according to the present invention are shown;

[0047] Figure 6c for Figure 6b The spectral lines at 1077cm -1 SERS peak intensity corresponding to the Raman shift;

[0048] Figure 7a The SERS spectra of the SERS sensor chip modified with different tetrahedral DTP probe concentrations according to the present invention are shown in FIG.

[0049] Figure 7b for Figure 7a The spectral lines at 1077cm -1 SERS peak intensity corresponding to the Raman shift;

[0050] Figure 8a The SERS spectra of the SERS biosensor Cas13a of the present invention at different reaction times;

[0051] Figure 8b for Figure 8a The spectral lines at 1077cm -1 SERS peak intensity corresponding to the Raman shift;

[0052] Figure 8c The SERS spectra of the SERS biosensor DNAzyme of the present invention at different reaction times;

[0053] Figure 8d for Figure 8c The spectral lines at 1077cm -1 SERS peak intensity corresponding to the Raman shift;

[0054] Figure 9a The SERS spectra of the SERS biosensor of the present invention detecting nucleic acids at different concentrations are shown;

[0055] Figure 9b for Figure 9a The spectral lines at 1077cm -1 Linear calibration curve of SERS peak intensity corresponding to Raman shift and logarithm of nucleic acid concentration;

[0056] Figure 9c This is a validation table for the recovery rate of nucleic acids in 10% human serum detected by the SERS biosensor of the present invention;

[0057] Figure 10a The SERS spectra of the SERS biosensor of the present invention for detecting specific and nonspecific targets;

[0058] Figure 10b for Figure 10a The spectral lines at 1077cm -1 SERS peak intensity corresponding to the Raman shift;

[0059] Figure 10c These are SERS spectra of five different batches of SERS biosensors of the present invention detecting nucleic acids of the same concentration;

[0060] Figure 10d for Figure 10c The spectral lines at 1077cm -1 SERS peak intensity corresponding to the Raman shift;

[0061] Figure 10e The results are the uniformity characterization results of nucleic acid detection by the SERS biosensor of the present invention;

[0062] Figure 11a TEM characterization of exosomes from gastric cancer cell SGC-7901;

[0063] Figure 11b This is the nano-flow cytometry distribution diagram of exosomes in gastric cancer cell SGC-7901;

[0064] Figure 11c This is the SERS spectra of the SERS biosensor of the present invention detecting gastric cancer exosomes with different concentrations;

[0065] Figure 11d for Figure 11c The spectral lines at 1077cm -1 Linear calibration curve of SERS peak intensity corresponding to Raman shift and logarithm of exosome concentration;

[0066] Figure 11e This is a validation table of the SERS biosensor of the present invention for detecting nucleic acid concentrations and recovery rates in exosomes of different concentrations. DETAILED DESCRIPTION

[0067] In order to enable technicians in related fields to better understand the content of the patent of this invention, the embodiments of the present invention are described in detail below. This embodiment is implemented on the premise of the technical solution of the present invention, and a detailed implementation method and specific operation process are given, but the content of the present invention is not limited to the embodiments.

[0068] Zinc sulfate heptahydrate (ZnSO4·7H2O, ≥99.5%), tris(hydroxymethylaminomethane) (C4H 11 NO3, Tris ≥ 98%), boric acid (H3BO3, 99.5%), ethylenediaminetetraacetic acid (C 10 H 16N₂O₄, EDTA, 99%), and magnesium chloride (MgCl₂·6H₂O, ≥98%) were purchased from Sinopharm Chemical Reagent Co., Ltd. Tris(hydroxymethyl)aminomethane, boric acid, and ethylenediaminetetraacetic acid were used to prepare TBE solution, while Tris(hydroxymethyl)aminomethane and magnesium chloride were used to prepare 1× TM buffer (10 mM tris-HCl and 1 mM MgCl₂, pH 8.0). 4-Mercaptobenzoic acid (4-MBA, 99%) and tris(2-carboxyethyl)phosphine (TCEP) were purchased from Sigma-Aldrich. Phosphate-buffered saline (PBS), fetal bovine serum (FBS), exosome-depleted FBS (dFBS), and incomplete high-glucose DMEM were purchased from Jiangsu KeyGen Biotech Co., Ltd. CRISPR-Cas13a (Lbu) gene editing protein and reaction buffer (10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2, pH 8.3) were purchased from Guangzhou Bolais Biotechnology Co., Ltd. Immunostaining permeabilization solution (Triton X-100, 1%) was purchased from Shanghai Yuanye Biotechnology Co., Ltd. Human serum was purchased from Beijing Zhongke Chenyu Technology Co., Ltd. Gold nanoparticles (AuNPs) with a diameter of 15 nm were purchased from Biocell International, UK. DEPC-treated water was purchased from Sangon Biotech (Shanghai) Co., Ltd. and used to dissolve nucleic acid powder. All other solutions were prepared with Millipore ultrapure water (18.2 MΩ·cm).

[0069] The DNA base sequence fragments used in the present invention are all artificially synthesized and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The ssDNA used for tetrahedral DTP probe assembly in the following examples: A, B, C, D, E, F and H3, DNA single-stranded DNAzyme, closed chain LS, hairpin nucleic acid chain H1, crRNA, uracil-modified hairpin recognition single chain H2, DNA single chain US generated after H2 is cut, DNA single chain H1-half generated after H1 is cut, specific target miRNA-106a, non-specific target miRNA-21, non-specific target miRNA-155, non-specific target 1-miss miRNA-106a base sequences are shown in SEQ ID NO: 1 to SEQ ID NO: 18 in the sequence table, and the specific sequences are as follows:

[0070] A:5'-SH-(CH2)6-GTCTGAGGCAGTTGAGAGATCTCGAACATTCCATCGTACGATCATAGA TCAAT-3';

[0071] B:5’-TAAGTCTGAAGATCCATTTATCACCAGCTGCTGCACGCCATAGTAGACGTATCACC TGTCC-3’;

[0072] C:5’-AGCTACTTGCTACACGAGGATCTTCAGACTTAGGAATGTTCGAGATCACATGCGA GGACTCGGTCCAATACCGTACTAACGATTACAGATCAAATCGTACGATCATAGATCAAT-3’;

[0073] D:5’-CAGCTGGTGATAAAACGTGTAGCAAGTAGCTTTGATCTGTAATCGACTCTACGGG AAGAGC-3’;

[0074] E:5’-SH-(CH2)6-ATGCCCATCCGGCTCACTACTATGGCGTGCAGATCGTACGATCATAGAT CAAT-3’;

[0075] F:5’-SH-(CH2)6-CGAGTCCTCGCATGACTCAACTGCCTCAGACGGACAGGTGATACGAG AGCCGGATGGGCATGCTCTTCCCGTAGAGATAGTACGGTATTGGAC-3’;

[0076] H3:5’-GGATCGTCTTTACAGGCGCCACCTCCGCCTGTAAAGACGATCCTTTTTTATTGATCTATGATCGTACGAT-3’;

[0077] DNAzyme:5’-SH-(CH2)6-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGACGATCTAGTTGAGCTGTCTGCAGCAACCTCTGTAGTG-3’;

[0078] LS:5’-CACTACAGAGGTTGCTGCAGACGATCTGGT-3’;

[0079] H1:5’-CCACCTCATTGAAATATGCAGACGTTGAAGGATCGTCTTTACAGGCGGAGGTGG TTTTTT-(CH2)6-SH-3’;

[0080] crRNA:5'-GACCACCCAAAAUGAAGGGGACUAAAACCUACCUGCACUGUAAGCAC UUUU-3';

[0081] H2:5'-CAGAGGTTGCGTUUUUUUACCAGATCGTCTGCAACCTCTGTAGTG-3';

[0082] US:5'-ACCAGATCGTCTGCAGCAACCTCTGTAGTG-3';

[0083] H1-half:5'-AGGATCGTCTTTACAGGCGGAGGGTGGTTTTTT-3';

[0084] miRNA-106a:5'-AAAAGUGCUUACAGUGCAGGUAG-3';

[0085] miRNA-21:5'-UAGCUUAUCAGACUGAUGUUGA-3';

[0086] miRNA-155:5'-UUAAUGCUAAUCGUGAUAGGGGU-3';

[0087] 1-miss miRNA-106a:5'-AAAAGUGCUUAGAGUGCAGGUAG-3';

[0088] Example 1: Preparation of SERS biosensor for gastric cancer exosome nucleic acid detection

[0089] The SERS biosensor for gastric cancer exosome nucleic acid detection described in Example 1 includes a SERS sensor chip, a first reagent containing a SERS probe and a ZnSO4 solution, and a second reagent containing a CRISPR / Cas13a system.

[0090] 1. Preparation of SERS sensor chip:

[0091] Preparation of silver nanorod array substrate: The silver nanorod array substrate was prepared by the vacuum electron beam evaporation coating method described in Section 2 of Song C, Chen J, Zhao Y, et al. Gold-modified silver nanorod arrays for SERS-based immunoassays with improved sensitivity. Journal of Materials Chemistry B, 2014, 2(43): 7488-7494. The prepared silver nanorod array substrate was then covered with a polydimethylsiloxane (PDMS) film having 3×10 small holes, each with a pore diameter of 4 mm and a height of 1 mm. The substrate was rinsed multiple times with diethyl pyrocarbonate (DEPC) water before use.

[0092] Preparation of tetrahedral DTP probe: The above DNA single strands A, B, C, D, E, F, and H3 were mixed in 1× TM buffer at a molar ratio of 1:1:1:1:1:1:3, heated to 95°C for 5 minutes, cooled to 4°C and maintained for 30 minutes to obtain a tetrahedral DTP probe solution, and diluted to 1 μM;

[0093] Preparation of SERS sensor chip: Take 20 μL of tetrahedral DTP probe solution and add it dropwise onto the above-mentioned silver nanorod array substrate, and incubate it in an environment of 37°C and 60-80% humidity for 3 hours. Use DEPC-treated water to rinse the small holes and soak them in DEPC-treated water for 10 minutes to reduce RNase that decomposes RNA in the reaction environment, thereby obtaining a silver nanorod array substrate with tetrahedral DTP probes modified on the surface, namely the SERS sensor chip of the present invention. During the above-mentioned incubation process, the tetrahedral DTP probes are connected to the substrate surface through the thiol group to form Ag-S covalent bonds with the silver nanorods.

[0094] 2. Preparation of SERS probe:

[0095] 1) Mix the single-stranded DNAzyme with triscarboxyethylphosphine solution (TCEP) at a ratio of 1:1000 to remove disulfide bonds, adjust the volume to 50 μM, and react at 25°C for 3 hours; then mix the 50 μM DNAzyme with 50 μM closed-chain LS and anneal to form a DNAzyme / LS hybrid product;

[0096] 2) The hairpin nucleic acid chain H1 was mixed with TCEP at a molar ratio of 1:1000, the volume was fixed to 50 μM, and the mixture was reacted at 25°C for 3 hours before annealing.

[0097] 3) Mix 2.5 μL of the 50 μM DNAzyme / LS solution obtained in step 1), 7.5 μL of the 50 μM H1 solution obtained in step 2), and 500 μL of the 2.3 nM AuNPs solution in 50 μL of 5× TBE buffer and incubate at 25°C with shaking at 300 rpm for 6 h;

[0098] 4) adding 5 μL, 10 μL, 15 μL, and 20 μL of 2M NaCl solution to the mixture obtained in step 3) every 0.5 hour, and incubating with shaking at 300 rpm at 25° C. for 6 hours;

[0099] 5) To the mixture obtained in step 4), 25 μL of 100 μM 4-MBA was added, and the mixture was incubated with shaking at 300 rpm at 25°C for 3 hours. The mixture was then centrifuged at 12,000 rpm for 20 minutes in 0.5× TBE buffer and washed three times. Finally, the nanoparticles were redispersed in 0.5× TBE, the volume was fixed to 30 μL, and the SERS probe was obtained. The SERS probe was stored at 4°C for subsequent use.

[0100] The results of SERS probe absorption spectrum, dynamic light scattering (DLS) and SERS spectrum characterization are as follows: Figure 2a As shown in the figure, the absorption peak of unmodified 15nm gold nanoparticles (AuNPs) is located at 519nm. After modification with DNA probes (H1, DNAzyme / LS), the absorption peak red-shifted to 522.5nm, resulting in a 3.5nm red-shift. This red-shift is due to the local refractive index change caused by the interaction between the DNA probe and the gold nanoparticle surface, proving that the DNA probe was successfully modified on the gold nanoparticles. After the Raman reporter molecule 4-MBA was further modified on the surface of the DNA-modified AuNPs, the absorption peak of the SERS probe further red-shifted to 524.5nm. This further red-shift is because the introduction of the 4-MBA molecule changed the refractive index of the nanoparticle surface, proving that the Raman reporter molecule 4-MBA was successfully modified on the gold nanoparticles. As shown in the figure Figure 2b As shown in the figure, the DLS hydrodynamic diameter of the unmodified 15nm AuNPs is 20.87±2.7nm, while the hydrodynamic diameter of the DNA-modified AuNPs is 27.41±5.2nm. This increase is due to the DNA probe molecules attached to the nanoparticle surface to form an additional covering layer, proving that the DNA probe is successfully modified on the gold nanoparticles. After further modification with 4-MBA, the hydrodynamic diameter of the SERS probe increases to 35.07±5.3nm. This further increase is due to the 4-MBA molecules attached to the surface of the DNA-modified nanoparticles, proving that the Raman reporter molecule 4-MBA is successfully modified on the gold nanoparticles. Figure 2c The SERS spectrum of the SERS probe is shown at 1077 cm-1 At 1580cm -1 There is an obvious characteristic peak at the center, which corresponds to the characteristic peak of the Raman reporter molecule 4-MBA, and has a good SERS response, indicating that the SERS probe was successfully constructed.

[0101] The feasibility of characterizing the mechanism of CRISPR / Cas13a system by polyacrylamide gel electrophoresis (PAGE): Figure 3a Shown is a PAGE characterization of the CRISPR / Cas13a system mechanism. The gel electrophoresis conditions are: 100V, 65 minutes, 10% PAGE. Lane 2 is the target miR-106a. Lane 3 is the hairpin H2 and the CRISPR / Cas13a system (Cas13a+crRNA), in which the CRISPR / Cas13a system does not appear, and the only band in lane 3 corresponds to the hairpin H2. Lane 4 is the target miR-106a, hairpin H2 and CRISPR / Cas13a system, in which the CRISPR / Cas13a system does not appear, and the target miR-106a band is not visible due to being bound by the crRNA in the CRISPR / Cas13a system. Lane 5 is a single-stranded DNA US, that is, a single-stranded DNA produced after the H2 hairpin is cut. Comparing lanes 3 and 4, the band corresponding to the H2 hairpin in lane 4 disappears, and is replaced by two new bands that move downward. Compared to the band in lane 5, the slower-moving band in lane 4 is very close to the band in lane 5, meaning the bands correspond to similar or identical DNA bases, confirming that the slower-moving band is US. This demonstrates that when the target is added to the system, the CRISPR / Cas13a system is activated, cleaving the H2 hairpin and successfully generating the US strand.

[0102] The feasibility of further characterizing the sensing mechanism by polyacrylamide gel electrophoresis (PAGE): Figure 3bThe following figure shows the PAGE characterization of the sensing mechanism. The gel electrophoresis conditions were: 100V, 65 minutes, 10% PAGE. Lane 2 represents US, lane 3 represents DNAzyme, and lane 4 represents the DNAzyme-blocked strand LS. Comparing lanes 3, 4, and 5, a new band shifted upwards in lane 5, while the corresponding bands for DNAzyme and LS disappeared, indicating successful hybridization between the DNAzyme and LS, i.e., DNAzyme blocking. Comparing lanes 2, 4, and 6, a new band shifted upwards in lane 6, indicating hybridization between US and LS. Lane 7 represents US and DNAzyme blocked with LS. Comparing lanes 3, 5, 6, and 7, a band appeared at the same position as in lane 3, a band at the same position as the DNAzyme-LS hybridization band in lane 5 disappeared, and a band appeared at the same position as the US-LS hybridization band in lane 6. This indicates that the US strand can bind to the LS strand and release the DNAzyme, demonstrating that US can successfully unlock the blocked DNAzyme. Lane 9 is DNAzyme, lane 10 is H1 hairpin, and lane 11 is without Zn addition. 2+ When H1 and DNAzyme were mixed, lane 12 was the system with the addition of Zn 2+ When H1 and DNAzyme were mixed, lane 13 was the DNA single-strand H1-half produced after H1 was cut. By comparing lanes 11, 12, and 13, we can see that the addition of Zn 2+ A band that does not exist in lane 11 and is located at the same position as lane 13 is produced in lane 12, indicating that this band corresponds to H1-half, proving that when Zn 2+ In the presence of α-terminal ...

[0103] Example 2: Feasibility verification of SERS biosensor for nucleic acid detection

[0104] In this Example 2, the feasibility of using SERS biosensors for nucleic acid detection was verified using a two-step method and a one-step method respectively.

[0105] The specific operation steps of the two-step method are as follows: the first step is to mix the target miR-106a, CRISPR / Cas13a system, and hairpin H2 to produce a large number of US chains; the second step is to mix the SERS probe, Zn 2+Add to the reaction system to activate the DNAzyme cutting activity and carry out subsequent reactions. The experimental scheme of the two-step method is as follows: in the first step, 1μL 0.5μM Cas13a, 1μL 0.5μM crRNA, 1μL 20μM H2, 3μL 10×Reaction Buffer, and 2μL of a certain concentration (miR-106a concentration is gradually increased from 100aM to 1nM) Target chain (or DEPC-treated water as blank) are mixed and reacted at 37°C and 40rpm for 30min. In the second step, 6μL SERS probe, 4μL 1×TM buffer, and 2μL 20μM ZnSO4 solution are mixed with the reaction system in the first step, mixed and dropped into the small hole, and reacted at 37°C and 40rpm for 50min. After the reaction, each small hole is washed three times with ultrapure water for subsequent testing.

[0106] The specific steps of the one-step method are as follows: target miR-106a, CRISPR / Cas13a system, hairpin H2, SERS probe, Zn 2+ The reaction was added to the wells using a one-pot method. The one-step protocol was as follows: 1 μL of 0.5 μM Cas13a, 1 μL of 0.5 μM crRNA, 1 μL of 20 μM H2, 3 μL of 10× Reaction Buffer, 6 μL of SERS probe, 4 μL of 1× TM buffer, and 2 μL of 20 μM ZnSO4 solution were mixed. Then, 2 μL of a certain concentration of miR-106a chain (or DEPC-treated water as a blank) was added. After mixing, the mixture was dripped into the wells and reacted at 37°C and 40 rpm for 50 minutes. After the reaction, each well was rinsed three times with ultrapure water for subsequent testing.

[0107] During the test, the central area of each small hole was selected to collect the SERS spectrum. A calibration curve was constructed based on the SERS characteristic peak intensity and the Target chain concentration, and the detection limit was calculated. Calibration curve drawing method: the target logarithmic concentration was used as the horizontal axis, the SERS characteristic peak as the vertical axis, a scatter plot was drawn, and the scatter plot was linearly fitted to obtain the calibration curve and linear relationship. Detection limit (LOD) calculation method: the sum of the blank signal average and its 3 times standard deviation was substituted into the calibration curve relationship. The calculated concentration is the detection limit. Unless otherwise specified, the detection limit is calculated according to this definition throughout the text.

[0108] In order to verify the feasibility of the overall sensing mechanism, four incomplete systems (each lacking crRNA, Zn 2+, H2, miR-106a) as the control group and three groups of target with different concentrations (10fM, 10pM, 1nM) were used as the control group to conduct the experiment in a two-step method, and the feasibility was verified by comparing the SERS intensity. Four different control groups (using DEPC-treated water to replace the corresponding missing part) and three groups of target with different concentrations (10fM, 10pM, 1nM) were set up for verification. No target and no crRNA controls were set up to compare the effect of the Cas13a system on the sensing mechanism when it is not activated. No H2 and no Zn were set up. 2+ To compare the effect of inactivated DNAzyme on the sensing mechanism. Figure 4a are the SERS spectra of different control groups. Figure 4b 1077cm -1 The intensity of the characteristic Raman peak is compared with that of the control sample. It can be seen that no matter which key variable is missing, the SERS signal is extremely low and detection cannot proceed normally. Only when the system is complete can a strong SERS signal be generated, and the Raman spectral peak intensity shows a regular change with concentration. These results prove that the proposed sensing mechanism is feasible.

[0109] Example 3: Comparison of two-step and one-step SERS biosensor sensing strategies

[0110] In order to find the most suitable experimental procedure for SERS sensor, experiments were conducted using two-step method and one-step method respectively, and the SERS signal intensity and signal-to-noise ratio of different concentrations (1pM, 1nM) and blank were compared to determine which strategy has better detection effect. The experiment used blank (DEPC-treated water instead of target), 1pM and 1nM concentrations of miR-106a for comparison. Figure 5a are the SERS spectra of different control groups. Figure 5b 1077cm -1 Intensity comparison of Raman characteristic peaks. Figure 5b It can be seen that with the increase of target concentration, the two methods 1077cm -1The SERS signal intensity gradually increased. The SERS intensity of the two-step method was higher than that of the one-step method in different experimental groups. It can be seen from the comparison of the highest concentration of 1nM that the SERS intensity of the two-step method is about 5000a.u., and the SERS intensity of the one-step method is about 3000a.u. Under this condition, the SERS intensity of the two-step method is about twice that of the one-step method. When the target concentration is 1pM, the signal-to-noise ratio of the two-step method is about 7.8, and the signal-to-noise ratio of the one-step method is 4.6; at a concentration of 1nM, the signal-to-noise ratio of the two-step method is about 12.3, and the signal-to-noise ratio of the one-step method is 8.6; this proves that the signal-to-noise ratio of the two-step method is also higher than that of the one-step method, and the two-step method has a stronger detection effect. At the same time, considering that the activity of Cas13a protein is stronger under weak alkaline conditions (pH8.3) and the activity of DNAzyme is stronger under neutral conditions (pH 7.0), the two-step strategy can better play the advantages of the two systems to obtain better detection performance. Therefore, the two-step sensing strategy was selected for subsequent detection.

[0111] Example 4: Optimization of SERS biosensor preparation and testing conditions

[0112] 1. Optimization of the ratio of SERS probe DNAzyme to H1

[0113] The SERS probe is modified with a closed DNAzyme and a hairpin H1. When the DNAzyme is activated, it will walk on the surface of the SERS probe and cut H1 to produce a single-stranded H1-half, so that the probe can be captured. When preparing the SERS probe, the amount of DNA material with thiol groups is fixed. For example, when using 500μL AuNPs to prepare the probe, a total of 10μL of 50μM DNA chains modified with thiol groups should be added. Therefore, choosing a suitable feed ratio can maximize the single-stranded H1-half product and generate the strongest signal from the SERS probe. Figure 6a As shown, different volume ratios, i.e., different amounts of DNAzyme and hairpin H1, were added to 500 μL of AuNPs to prepare the probe. When preparing the probe, the concentration and volume of the LS chain and DNAzyme were kept consistent.

[0114] The optimal feed ratio was determined by comparing the SERS signal intensities obtained by detecting 10 fM targets using SERS probes prepared with different feed ratios (1:1-1:6). Figure 6b The SERS spectra of the SERS probes prepared with different feed ratios are shown in Figure 2. Figure 6c 1077cm -1Comparison of the intensity of the Raman characteristic peaks. It can be seen that when the feed ratio is 1:1, 1:2, and 1:3, the signal intensity increases with the increase in the H1 hairpin ratio. When the feed ratio is 1:4, 1:5, and 1:6, the signal intensity decreases with the increase in the H1 hairpin ratio. The signal intensity reaches its highest at a feed ratio of 1:3, so the feed ratio was determined to be 1:3 for the preparation of SERS probes.

[0115] 2. Optimization of Tetrahedral DTP Probe Concentration

[0116] To prepare the optimal SERS capture substrate, the concentration of the modified tetrahedral DTP probes needs to be optimized. The experiment used different concentrations of tetrahedral DTP probes (10nM, 50nM, 100nM, 300nM, 500nM, 1μM, 2μM, 3μM, and 5μM) to prepare the capture substrate. A two-step detection method was used with a target concentration of 1pM. The optimal incubation concentration of the tetrahedral DTP probes was determined by comparing the SERS signal intensity detected on the capture substrates prepared with different concentrations of tetrahedral DTP probes. Figure 7a The SERS spectra measured on the SERS capture substrate incubated with tetrahedral DTP probes at different concentrations are shown in Figure 2. Figure 7b 1077cm -1 The intensity of the Raman characteristic peak. Figure 7b It can be seen that when the tetrahedral DTP probe concentration is below 500nM, the SERS intensity increases almost uniformly with increasing concentration. However, when the tetrahedral DTP probe concentration increases to 1μM, the growth rate of the SERS intensity gradually slows down until there is no longer a significant change. At this point, the SERS intensity tends to saturate, indicating that the reaction has reached equilibrium. The results show that the optimal incubation concentration of tetrahedral DTP probes for preparing SERS capture substrates is 1μM.

[0117] 3. Optimization of Sensing Strategy Detection Time

[0118] In order to obtain the best sensing performance, the detection time of the sensing strategy needs to be optimized. A 1pM concentration target was used as the detection object to determine the optimal time for each of the two steps. For the first step time optimization, the Cas13a reaction time was set to 5-60 minutes, the second step DNAzyme reaction time was fixed to 1 hour, and the SERS signal was measured to determine the optimal time; for the second step time optimization, the Cas13a reaction was fixed to 1 hour, the second step DNAzyme reaction time was 5-180 minutes, and the SERS signal was measured to determine the optimal time. The optimal time of the two-step reaction was combined to determine the optimal detection time of the sensor. Figure 8a The SERS spectra obtained by performing Cas13a reactions at different times (5-60 min) are shown. Figure 8b For its 1077cm -1 The intensity of the Raman characteristic peak. Figure 8b It can be seen that when the first step reaction time is within 30 minutes, the signal intensity increases with the increase of reaction time, and when the reaction time reaches 30 minutes, the signal intensity reaches the maximum. After the reaction time exceeds 30 minutes, the signal intensity does not change significantly, indicating that the reaction has reached equilibrium. This shows that the optimal time for Cas13a reaction is 30 minutes.

[0119] Figure 8c The SERS spectra were obtained by DNAzyme reaction at different time intervals (5-180 min). Figure 8d For its 1077cm -1 The intensity of the Raman characteristic peak. Figure 8d As can be seen, when the second-step reaction time is less than 50 minutes, the signal intensity increases with the reaction time. The signal intensity reaches its maximum at 50 minutes. Beyond 50 minutes, the signal intensity remains unchanged, indicating that the reaction has reached equilibrium. Therefore, the optimal time for the second-step DNAzyme reaction is 50 minutes. Taking into account the reaction times of both steps, the overall optimal sensing detection time is 80 minutes.

[0120] Example 5: Working curve and detection limit of SERS biosensor for nucleic acid detection

[0121] In order to verify the accuracy and reliability of the SERS sensor, a recovery experiment was performed. The detection performance of the sensor was evaluated by comparing the recoveries of spiked samples with different concentrations. First, a standard solution of miR-106a was prepared with a concentration range of 100aM to 1nM. Then, the 10% human serum sample was divided into four groups, and miR-106a standard solutions with concentrations of 400pM, 2pM, 70fM and 3.5fM were added, respectively. 2μL of each target was taken for a two-step experiment. The standard sample was tested to obtain a working curve, and then the SERS intensity measured by the diluted human serum sample was substituted back into the working curve to obtain the test concentration. The recovery rate was calculated (recovery rate (%) = (test concentration / spiked concentration) × 100%) to evaluate the accuracy and reliability of the sensor.

[0122] Figure 9a The SERS spectra obtained when the SERS sensor detected miR-106a at different concentrations (100aM to 1nM). Figure 9b The characteristic peak at 1077 cm -1 There is a good linear correlation between the SERS intensity and the logarithm of miR-106a concentration, which is expressed as: 1077 =637.80×Lg C miR-106a +10833.56(R 2=0.996). By calculation, the detection limit (LOD) of the SERS sensor was determined to be 53.16aM. To evaluate the reliability and accuracy of the SERS sensing strategy, 10% human serum samples were divided into four groups and miR-106a was added at concentrations of 400pM, 2pM, 70fM, and 3.5fM, respectively. The experimental results are summarized in Figure 9c The recoveries ranged from 94.87% to 108.44%, and the relative standard deviation (RSD) was less than 6.21%. These results indicate that the SERS sensor has high accuracy and reliability in detecting miR-106a.

[0123] Example 6: Characterization of the performance of SERS biosensor for detecting nucleic acids

[0124] To evaluate the performance of the SERS sensor, its specificity, stability, repeatability, and uniformity were characterized. Specificity was characterized by comparing the SERS intensity of specific targets (miR-106a, mixture) with nonspecific targets (miR-21, miR-155, 1-miss miR-106a). Stability and repeatability were characterized by measuring the SERS intensity changes of five different batches of SERS sensors at the same miR-106a concentration (10pM). Uniformity was characterized by randomly collecting multiple (30 per group) SERS spectra of different target concentrations (1fM, 1pM, 1nM) and comparing the SERS intensity changes.

[0125] In order to verify the SERS performance of the sensor, a specificity experiment was performed. By analyzing the SERS signal of the specific target miR-106a in the mixed sample and comparing it with the SERS intensity difference of miR-106a alone and the nonspecific target, the specific detection ability of the sensor for miR-106a was evaluated. First, a standard solution of 10pM miR-21, 10pM miR-155 and 1pM single base mutation 106a (1-miss miR-106a) was prepared as a nonspecific target. Then, a standard solution of 1pM miR-106a and a mixed solution (mixture) containing 10pM miR-21, 10pM miR-155, 1pM 1-missmiR-106a and 1pM miR-106a were prepared as specific targets. 2μL of each target was taken for a two-step experiment, and the measured SERS intensities of different targets were compared to evaluate the specificity of the sensor. Figure 10aThe SERS spectra of specific experiments using 10pM miR-21, miR-155, 1pM single-base mutation 106a (1-miss miR-106a), 1pM miR-106a, and a mixture of all the above targets are shown. Figure 10b 1077cm in Figure a -1 From the SERS intensity at , we can see that only the system with miR-106a can produce a strong SERS signal, proving that the sensor has good specificity.

[0126] Figure 10c The SERS spectra of 5 different batches of SERS sensors when detecting the same concentration (10 pM) of miR-106a are shown. -1 The SERS intensity at Figure 10d As shown in Figure 3, the RSD is 7.88%, which further proves that the SERS sensor has good stability and repeatability. Figure 10e The characteristic peak 1077cm of each group of 30 random points is shown when the SERS sensor detects 1fM, 1pM, and 1nM. -1 The relative standard deviation (RSD) of the SERS intensity was less than 4.15%, indicating that the sensor had excellent uniformity.

[0127] Example 7: Detection of gastric cancer exosome nucleic acids using SERS biosensor

[0128] To verify the detection performance of the constructed SERS biosensor for gastric cancer exosome nucleic acids, exosomes of human gastric cancer cell SGC-7901 were lysed to detect the exosomal nucleic acid miR-106a. The SERS intensities corresponding to exosomes with different concentrations were obtained. The miR-106a concentrations in exosomes with different concentrations were calculated against the miR-106a working curve. A calibration curve related to exosome concentration and SERS intensity was constructed, and the detection limit was calculated.

[0129] Human gastric cancer cells SGC-7901 were purchased from the Cell Bank of the Type Culture Collection Committee of the Chinese Academy of Sciences. The cells were grown in DMEM (Duplex Medium) supplemented with 10% FBS and 1% penicillin / streptomycin at 37°C in a 5% CO2 atmosphere. When the cells reached 80% confluency, the medium was removed, and the cells were washed three times with 1×PBS (pH 7.0). The medium was then replaced with DMEM supplemented with 10% dFBS (exosome-depleted FBS) and 1% penicillin / streptomycin. After 48 h, the culture supernatant was collected and centrifuged multiple times, including the first centrifugation (500 g, 4°C) for 10 min to remove cells; the second centrifugation (10,000 g, 4°C) for 90 min to remove apoptotic bodies and cell debris; the third centrifugation (1,000,000 g, 4°C) for 120 min, after which the supernatant was removed; and finally, 1× PBS (pH 7.0) buffer was used to disperse the centrifugal sediment to obtain the exosome solution derived from human gastric cancer cell SGC-7901.

[0130] The experiment used exosomes from human gastric cancer cell line SGC-7901, and the exosomes were lysed to detect miR-106a. The specific method is as follows: Immunostaining permeabilization solution (Triton X-100, 1%) was mixed with exosomes at a volume ratio of 1:9 at 37°C for 10 minutes to lyse the exosomes. Different exosome concentrations (10 4 -10 7 The lysate was prepared from 2 μL of exosome lysate at different concentrations. A blank was prepared using a mixture of 1× PBS (pH 7.0) buffer and immunostaining permeabilization solution (Triton X-100, 1%). The experiment was performed in a two-step process. After acquiring SERS spectra, the concentration of miR-106a in exosomes of different concentrations was calculated using a working curve. A calibration curve was constructed based on the SERS characteristic peak intensity and exosome concentration, and the detection limit was calculated.

[0131] Figure 11a TEM image of exosomes. Figure 11b This is the nano-flow cytometry distribution diagram of exosomes. The average particle size of exosomes is about 76.6nm. Figure 11c The SERS sensor detects different concentrations (10 4 -10 7 The SERS spectra were obtained when the exosomes contained 500 μg of 400 μg of exosomes. Figure 11d The characteristic peak at 1077 cm -1The linear relationship between SERS intensity and the logarithmic concentration of exosomes indicates that the SERS sensor can detect exosomal nucleic acid miR-106a. The miR-106a concentrations in exosomes with different concentrations were detected by comparing the working curve of miR-106a detection. Figure 11e As shown. Further, Figure 11d As shown in FIG, by fitting the relationship between SERS intensity and the logarithm of exosome concentration, a calibration curve of SERS intensity and the logarithm of exosome concentration can be obtained as I 1077 =734.48×Lg C exosomes -2325.93(R 2 =0.976), the detection limit was calculated to be 6.1×10 3 particles / mL. This indicates that the sensor has good detection ability for exosomal nucleic acids and can provide new potential for high-sensitive detection of exosomal nucleic acids.

Claims

1. A SERS biosensor, characterized in that: The SERS biosensor comprises: a SERS sensor chip, a first reagent, and a second reagent; the SERS sensor chip is a silver nanorod array substrate modified with tetrahedral DTP probes; the tetrahedral DTP probes are assembled from DNA single strands having base sequences as shown in SEQ ID NO: 1 to SEQ ID NO: 7, and are sequentially denoted as DNA single strands A, B, C, D, E, F, and H3; wherein the 5' ends of single strands A, E, and F are modified with SH-(CH2)6; The first reagent is a SERS probe, a buffer solution thereof, and a ZnSO4 solution; the SERS probe is prepared by modifying the surface of gold nanoparticles with a double-stranded binder DNAzyme / LS, a hairpin-type nucleic acid chain H1, and a Raman signal molecule 4-mercaptobenzoic acid (4-MBA); the double-stranded binder DNAzyme / LS is a conjugate of a single-stranded DNA DNAzyme and a closed chain LS, wherein the base sequences of DNAzyme, LS, and H1 are shown in SEQ ID NO: 8 to SEQ ID NO: 10, respectively; wherein the 5' end of DNAzyme is modified with SH-(CH2)6, and the 3' end of H1 is modified with SH-(CH2)6; the molar ratio of the assembled substances of DNAzyme / LS to H1 ranges from 1:1 to 1:6; The second reagent is a CRISPR / Cas13a system and its buffer; the CRISPR / Cas13a system includes Cas13a protein, crRNA and uracil-modified hairpin-type recognition single-stranded H2; the crRNA base sequence is shown in SEQ ID NO: 11, and the uracil-modified hairpin-type recognition single-stranded H2 base sequence is shown in SEQ ID NO:

12.

2. A SERS biosensor according to claim 1, characterized in that: The molar ratio of DNAzyme / LS to H1 was 1:

3.

3. The SERS biosensor according to claim 1, wherein: The buffer of the SERS probe is 0.5×TBE.

4. The SERS biosensor according to claim 1, wherein: The configuration concentrations of the Cas13a protein and crRNA are both 0.1 to 2 μM, and the configuration concentration of the uracil-modified hairpin-type recognition single-stranded H2 is 1 to 30 μM.

5. The SERS biosensor according to claim 1, wherein: The particle size of the gold nanoparticles is 15 nm.

6. The SERS biosensor according to claim 1, wherein: The SERS sensor chip is prepared by co-culturing a tetrahedral DTP probe with a silver nanorod array substrate for 3 hours. The tetrahedral DTP probe is connected to the substrate surface via a thiol group and the silver nanorod to form an Ag-S covalent bond. The tetrahedral DTP probe is formed by mixing seven DNA chains, namely A, B, C, D, E, F and H3, and then annealing. The annealing step includes: heating to 95°C for 5 minutes, cooling to 4°C and holding for 30 minutes. The silver nanorod array is prepared using vacuum electron beam evaporation coating equipment and oblique angle deposition technology. The silver nanorod array substrate is covered with a layer of polydimethylsiloxane (PDMS) film with 3×10 small holes, and the aperture of each small hole is 4 mm and the height is 1 mm.

7. The SERS biosensor according to claim 1, wherein: The steps of preparing the SERS probe and its buffer in the first reagent include: Step S1, mixing a single-stranded DNAzyme with tricarboxyethylphosphine solution (TCEP) at a molar ratio of 1:1000 to remove disulfide bonds, adjusting the volume to 50 μM, and reacting at 25° C. for 3 hours; mixing the reacted 50 μM DNAzyme with 50 μM closed chain LS and annealing the mixture to form a DNAzyme / LS hybrid product; Step S2, mixing the hairpin nucleic acid chain H1 and TCEP at a molar ratio of 1:1000, fixing the volume to 50 μM, reacting at 25° C. for 3 hours, and then annealing; Step S3, 50 μM of the DNAzyme / LS solution obtained in step S1, 50 μM of the H1 solution obtained in step S2, and 2.3 nM of the AuNPs solution were mixed in 5×TBE buffer and incubated with shaking at 300 rpm at 25°C for 6 h, wherein the volume ratio of the DNAzyme / LS solution, H1 solution, AuNPs solution, and 5×TBE buffer was 1:3:200:20; Step S4, adding 2M NaCl solution in a volume of 2, 4, 6, and 8 times the volume of the DNAzyme / LS solution to the mixture obtained in step S3 every 0.5 hours, and incubating with shaking at 25°C and 300 rpm for 6 hours; Step S5, add 100 μM 4-MBA in a volume 10 times the amount of DNAzyme / LS solution added to the mixture obtained in step S4, incubate with shaking at 300 rpm at 25°C for 3 hours, centrifuge at 12000 rpm for 20 minutes with 0.5×TBE buffer, and wash three times by centrifugation; finally, obtain redispersed SERS probes in 12 times the volume of 0.5×TBE buffer with a volume 12 times the amount of DNAzyme / LS solution added, and store at 4°C for subsequent use.

8. Use of the SERS biosensor according to claim 1 in preparing a nucleic acid detection kit.

9. The use according to claim 8, characterized in that The application steps include: In the first step, 0.5 μM Cas13a, 0.5 μM crRNA, 20 μM H2, 10× Reaction Buffer and target chain solutions of different gradient concentrations in the second reagent were mixed respectively, wherein the target chain solution of different gradient concentrations refers to miR-106a with a gradient concentration increasing from 100 aM to 1 nM and DEPC-treated water as blank; after mixing, react at 37°C and 40 rpm for 30 minutes, wherein the configuration volume ratio of Cas13a, crRNA, H2, 10× Reaction Buffer, and target chain solution is 1:1:2:6:4; In the second step, the SERS probe, 1×TM buffer, and 20 μM ZnSO4 solution in the first reagent were mixed with the reaction system in the first step, and then dropped into the small hole of the SERS sensor chip after mixing. The reaction was carried out at 37°C and 40 rpm for 50 minutes. The volume of SERS probe, 1×TM buffer, and ZnSO4 solution added were 12 times, 8 times, and 4 times the amount of Cas13a added, respectively. After the reaction, each small hole was washed three times with ultrapure water for subsequent testing. During the test, the central area of each small hole was selected to collect the SERS spectrum; a calibration curve was constructed based on the SERS characteristic peak intensity and the target chain concentration, and the detection limit was calculated; the calibration curve was drawn by taking the target logarithmic concentration as the horizontal axis and the value of the SERS characteristic peak as the vertical axis, and a scatter plot was drawn. The scatter plot was linearly fitted to obtain the calibration curve and linear relationship; the detection limit (LOD) was calculated by substituting the sum of the blank signal average and its three times standard deviation back into the calibration curve relationship, and the calculated concentration was the detection limit.

10. Use of the SERS biosensor according to claim 1 in preparing a gastric cancer exosome nucleic acid detection kit, the application comprising: Gastric cancer exosome nucleic acid extraction and preparation of nucleic acid detection kit; The gastric cancer exosome nucleic acid extraction step includes: growing human gastric cancer cells SGC-7901 to be detected in a DMEM cell culture medium containing 10% FBS and 1% penicillin / streptomycin, and the culture environment is 37°C, 5% CO2; when the cells grow to 80% confluence, removing the culture medium, washing three times with 1×PBS (pH=7.0) buffer, and replacing the culture medium with a DMEM culture medium containing 10% dFBS and 1% penicillin / streptomycin; after 48 hours, collecting the culture medium supernatant and performing multiple centrifugation treatments, wherein the first centrifugation (500g, 4°C) is 10 minutes to remove cells; a second centrifugation (10000g, 4°C) for 90 min to remove apoptotic bodies and cell debris; a third centrifugation (1000000g, 4°C) for 120 min, and then the supernatant was removed; finally, 1×PBS (pH=7.0) buffer was used to disperse the centrifugal sediment to obtain an exosome test solution derived from human gastric cancer cell SGC-7901; the exosome test solution derived from human gastric cancer cell SGC-7901 was lysed to obtain a lysate to facilitate the detection of miR-106a therein; the lysis treatment step comprises: using an immunostaining permeabilization solution (Triton X-100, 1%) to mix with the exosomes at a volume ratio of 1:9 at 37°C for 10 min to lyse the exosomes, and obtaining different exosome concentrations (10 4 ~10 7 particles / mL) lysate; The steps of preparing the nucleic acid detection kit include: taking lysates of different exosome concentrations as targets, and using a mixed solution of 1×PBS (pH=7.0) buffer and immunostaining permeabilization solution (Triton X-100, 1%) as blank for detection; The SERS biosensor according to claim 1 is used for detection; after collecting the SERS spectrum, the concentration of miR-106a in exosomes of different concentrations is calculated by the working curve, and a calibration curve is constructed based on the SERS characteristic peak intensity and the exosome concentration to calculate the detection limit.

Images