Preparation method and application of carboxymethyl schizophyllan
By directly using the mycelium to ferment mycelium, the process flow is simplified, the degree of substitution of carboxymethyl crack polysaccharide is improved, the complex preparation process is solved, and the efficient moisturizing and repair performance is achieved. It is suitable for cosmetics and medical products.
Patent Information
- Application Number
- CN202510578275.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-30
- Publication Date
- 2025-08-08
- Estimated Expiration
- 2045-04-30
AI Technical Summary
The process of preparing water-soluble fission polysaccharides in the prior art is complicated, difficult to achieve industrialization, and the mycelium waste after fission fermentation is not effectively utilized.
The mycelium fermented by schizobacteria is used as raw material, and the purification steps are eliminated through pretreatment, alkalization treatment and low-temperature freezing treatment, and carboxymethylation reaction is carried out in combination with a carboxylated agent to prepare carboxymethyl polysaccharide.
The preparation process is simplified, and the production of high-substituted carboxymethyl cracked polysaccharides has been achieved, with significant moisturizing and repairing effects, and is suitable for cosmetics and medical fields.
Smart Images

Figure CN120441723A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of polysaccharide modification, in particular to a preparation method of carboxymethyl schizophyllan and its application. Background Art
[0002] Schizophyllum communes, also known as white ginseng, tree flower, and eight-ton firewood, belong to the Fungi, Basidiomycetes, Agaricales, Schizophyllaceae, and genus Schizophyllum. It is a fungus with important edible and medicinal properties and is widely distributed worldwide, growing in groups on dead branches and rotting wood of broadleaf and coniferous trees in spring and autumn. Schizophyllum contains a wealth of bioactive substances, particularly schizophyllans, which are abundant in its fruiting bodies, mycelium, and fermentation broth. Currently, industrial production of schizophyllans primarily involves fermenting liquid from the fungus, while the fermented mycelium is typically discarded as waste.
[0003] Schizophyllan is a neutral β-glucan with a backbone composed of D-pyranose glucose residues linked by β-1,3-glycosidic bonds. Three backbone D-pyranose glucose residues form a group, and each group has a D-pyranose glucose residue linked by a β-1,6-glycosidic bond on its side chain.
[0004] Molecular modification of polysaccharides can alter their structure and biological activity. Schizophyllan can be modified or modified through physical, chemical, and biological methods to obtain Schizophyllan derivatives. Chemical modification involves introducing specific groups into the polysaccharide molecular chain through the action of relevant chemical reagents to obtain Schizophyllan derivatives. In the prior art, carboxymethylated Schizophyllan is obtained by carboxymethylating Schizophyllan, thereby converting the neutral Schizophyllan into a negatively charged sodium carboxylate salt. This significantly improves its solubility while maintaining good rheological properties and anti-tumor activity.
[0005] However, the preparation of water-soluble Schizophyllan requires the preparation of purified Schizophyllan raw materials, and then further preparation of Schizophyllan derivatives to improve the water solubility of Schizophyllan. The preparation process is complicated and not conducive to industrialization. Therefore, the use of mycelium as a raw material to prepare water-soluble Schizophyllan has become an urgent problem to be solved. Summary of the Invention
[0006] In order to solve the above technical problems, the present invention provides a preparation method and application of carboxymethyl Schizophyllan. The present invention uses fermentation mycelium of Schizophyllan as raw material to prepare carboxymethyl Schizophyllan, eliminating the purification operation, greatly reducing the complexity of the preparation process, and providing convenience for subsequent industrial production.
[0007] To achieve this object, the present invention adopts the following technical solutions:
[0008] In a first aspect, the present invention provides a method for preparing carboxymethyl Schizophyllan, which comprises: pretreating Schizophyllan mycelium to obtain mycelium powder, mixing the mycelium powder with sodium hydroxide for alkalization treatment, and then performing low-temperature freezing treatment, and then adding a carboxylating agent for carboxylation treatment after thawing.
[0009] In the present invention, carboxymethyl Schizophyllan is prepared using fermented mycelium of Schizophyllan as raw material, eliminating the need for purification, significantly reducing the complexity of the preparation process, and facilitating subsequent industrial production. Furthermore, low-temperature freezing technology is employed to ensure that the alkali solution is in full contact with the Schizophyllan mycelium, facilitating the substitution reaction and yielding carboxymethyl Schizophyllan with a high degree of substitution.
[0010] Preferably, the pretreatment step includes drying, crushing and screening the Schizophyllum mycelium.
[0011] Preferably, the pore size of the sieve is 100-200 mesh, for example, it can be 100 mesh, 110 mesh, 120 mesh, 130 mesh, 140 mesh, 150 mesh, 160 mesh, 170 mesh, 180 mesh, 190 mesh or 200 mesh.
[0012] In a specific embodiment of the present application, the mycelium of Schizophyllum is obtained by activating the strain, fermenting, collecting the fermentation product and filtering it.
[0013] Preferably, the mycelium powder is subjected to an infiltration treatment before the alkalization treatment.
[0014] Preferably, the wetting agent includes anhydrous ethanol and isopropyl alcohol.
[0015] Preferably, the mass volume ratio of the mycelium powder and the wetting agent is 1:(30-50) g / mL, and the (30-50) can be, for example, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48 or 50.
[0016] Preferably, the immersion temperature is 65-75°C, and the immersion time is 0.5-2 hours. The 65-75°C may be, for example, 65°C, 66°C, 67°C, 68°C, 69°C, 70°C, 71°C, 72°C, 73°C, 74°C, or 75°C. The 0.5-2 hours may be, for example, 0.5 hours, 0.6 hours, 0.8 hours, 1 hour, 1.2 hours, 1.4 hours, 1.6 hours, 1.8 hours, or 2 hours.
[0017] Preferably, the mass concentration of the sodium hydroxide is 30% to 50%, for example, 30%, 35%, 40%, 45% or 50%.
[0018] Preferably, the mass ratio of the mycelium powder to sodium hydroxide is 1:(1-3), and the (1-3) can be, for example, 1, 1.2, 1.4, 1.6, 1.8, 2, 2.2, 2.4, 2.6, 2.8 or 3.
[0019] Preferably, the alkalization treatment time is 20 to 40 min, for example, it can be 20 min, 22 min, 24 min, 26 min, 28 min, 30 min, 32 min, 34 min, 36 min, 38 min or 40 min.
[0020] Preferably, the low-temperature freezing temperature is -18 to -6°C, and the freezing time is 4 to 12 hours. The -18 to -6°C may be, for example, -18°C, -16°C, -14°C, -12°C, -10°C, -8°C, or -6°C. The 4 to 12 hours may be, for example, 4 hours, 6 hours, 8 hours, 10 hours, or 12 hours.
[0021] Preferably, the thawing method comprises ultrasound and / or heating;
[0022] Preferably, the ultrasonic power is 200-400 W, and the duration is 0.5-2.0 h. The 200-400 W may be, for example, 200 W, 220 W, 240 W, 260 W, 280 W, 300 W, 320 W, 340 W, 360 W, 380 W, or 400 W. The 0.5-2.0 h may be, for example, 0.5 h, 0.6 h, 0.8 h, 1.0 h, 1.2 h, 1.4 h, 1.6 h, 1.8 h, or 2.0 h.
[0023] Preferably, the heating temperature is 20-30°C, for example, 20°C, 22°C, 24°C, 26°C, 28°C or 30°C.
[0024] Preferably, the carboxylating agent comprises chloroacetic acid and / or sodium chloroacetate.
[0025] Preferably, the concentration of the carboxylating agent is 2 to 6 mol / L, for example, 2 mol / L, 2.5 mol / L, 3 mol / L, 3.5 mol / L, 4 mol / L, 4.5 mol / L, 5 mol / L, 5.5 mol / L or 6 mol / L.
[0026] Preferably, the carboxylating agent is added at a rate of 1 to 5 mL / min, such as 1 mL / min, 1.5 mL / min, 2 mL / min, 2.5 mL / min, 3 mL / min, 3.5 mL / min, 4 mL / min, 4.5 mL / min, or 5 mL / min.
[0027] Preferably, the mass ratio of the carboxylating agent to sodium hydroxide is (0.8-1.5): 1. The (0.8-1.5) can be, for example, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4 or 1.5.
[0028] Preferably, the carboxylation treatment temperature is 40-70°C, and the time is 2-6 hours. The 40-70°C may be, for example, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, or 70°C. The 2-6 hours may be, for example, 2 hours, 2.5 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, or 6 hours.
[0029] Preferably, the preparation method further comprises adding a neutralizing agent after carboxylation treatment, centrifuging to obtain a precipitate, re-dissolving, concentrating by membrane filtration, and drying to obtain the product.
[0030] Preferably, the neutralizing agent comprises any one of acetic acid, hydrochloric acid, propionic acid, oxalic acid or citric acid, or a combination of at least two thereof.
[0031] Preferably, the neutralizing agent adjusts the pH value to 6 to 8, for example, 6, 6.2, 6.4, 6.6, 6.8, 7.0, 7.2, 7.4, 7.6, 7.8 or 8.
[0032] Preferably, the centrifugation speed is 2000-6000 rpm, and the time is 10-30 min. The 2000-6000 rpm can be, for example, 2000 rpm, 2500 rpm, 3000 rpm, 3500 rpm, 4000 rpm, 4500 rpm, 5000 rpm, 5500 rpm, and 6000 rpm. The 10-30 min can be, for example, 10 min, 12 min, 14 min, 16 min, 18 min, 20 min, 22 min, 24 min, 26 min, 28 min, or 30 min.
[0033] Preferably, the reconstitution solvent comprises water.
[0034] Preferably, the pore size of the filtering membrane is 100-200 nm, for example, it can be 100 nm, 120 nm, 140 nm, 160 nm, 180 nm or 200 nm.
[0035] In a second aspect, the present invention provides a cosmetic containing carboxymethyl Schizophyllan, wherein the cosmetic comprises carboxymethyl Schizophyllan prepared by the method for preparing carboxymethyl Schizophyllan according to the first aspect.
[0036] Preferably, the cosmetics include any one of essence, lotion, emulsion, cream, cleanser or facial mask, or a combination of at least two of them.
[0037] Preferably, the amount of carboxymethyl Schizophyllan added to the cosmetic is ≥ 0.05‰, for example, it can be 0.5%, 0.4%, 0.3%, 0.2%, 0.1% or 0.05%.
[0038] Compared with the prior art, the present invention has at least the following beneficial effects:
[0039] 1. The present invention uses Schizophyllum fermentation mycelium as raw material to prepare carboxymethyl Schizophyllum polysaccharide, thereby realizing the comprehensive utilization of Schizophyllum fermentation waste.
[0040] 2. The present invention adopts low-temperature freezing technology to make the alkali solution fully contact with the mycelium of Schizophyllum, which is conducive to the substitution reaction and obtains carboxymethyl Schizophyllum polysaccharide with a high degree of substitution.
[0041] 3. The present invention adopts the in-situ method of Schizophyllum mycelium to prepare carboxymethyl Schizophyllan, and realizes the effective separation of Schizophyllan and protein through pretreatment, alkalization treatment, separation and purification, and the transparency of the prepared carboxymethyl Schizophyllan solution is significantly improved.
[0042] 4. The highly substituted carboxymethyl schizophyllan prepared by the present invention has significant moisturizing and repairing effects and can be used as a functional raw material in the cosmetic and medical fields. DETAILED DESCRIPTION
[0043] For the convenience of understanding the present invention, the present invention is given below with examples. It should be understood by those skilled in the art that the examples are only for the purpose of helping to understand the present invention and should not be regarded as specific limitations of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0044] Figure 1 It is a standard curve graph.
[0045] Figure 2 The figure shows the relative expression of AQP3 gene.
[0046] Figure 3 This is the result graph of cell scratch repair rate.
[0047] Example 1
[0048] Preparation of carboxymethyl schizophyllan in this example
[0049] Fermented Schizophyllum mycelia were dried, crushed, and sieved through a 100-mesh sieve to obtain Schizophyllum mycelia powder. 10 g of the powder was added to 300 mL of anhydrous ethanol and isopropanol, and the mixture was refluxed at 75°C for 1 hour. The volume ratio of anhydrous ethanol to isopropanol was 1:7. The mixture was cooled to room temperature, and then 20 mL of 50% sodium hydroxide solution was added. The mixture was stirred at 500 rpm for 30 minutes and then frozen at -18°C for 4 hours. The mixture was thawed at 20°C and transferred to a reactor. The reaction temperature was maintained at 60°C, and 2 mol / L chloroacetic acid solution was added dropwise at 1 mL / min until the mass ratio of chloroacetic acid to sodium hydroxide was 1:1. The reaction was continued for 4 hours. The pH was adjusted to 7 with acetic acid, and the mixture was centrifuged at 4000 rpm for 10 minutes to obtain a precipitate. The precipitate is added into 100 times the volume of water, stirred and dissolved, filtered, washed and concentrated using a 150 nm ceramic membrane to obtain a carboxymethyl Schizophyllan concentrated solution; the concentrated solution is dried to obtain carboxymethyl Schizophyllan.
[0050] Example 2
[0051] Preparation of carboxymethyl schizophyllan in this example
[0052] Fermented Schizophyllum mycelia were dried, crushed, and sieved through a 150-mesh sieve to obtain Schizophyllum mycelia powder. 10 g of the powder was added to 500 mL of anhydrous ethanol and isopropanol, and the mixture was refluxed at 65°C for 2 h. The volume ratio of anhydrous ethanol to isopropanol was 1:5. The mixture was cooled to room temperature, and then 50 mL of 40% sodium hydroxide solution was added. The mixture was stirred at 500 rpm for 20 min and then frozen at -10°C for 8 h. The mixture was thawed at 30°C and transferred to a reactor. The reaction temperature was maintained at 70°C. A 4 mol / L chloroacetic acid solution was then added dropwise at 3 mL / min until the mass ratio of chloroacetic acid to sodium hydroxide reached 1.2:1. The mixture was allowed to react for 2 h. The pH was adjusted to 6 with acetic acid, and the mixture was centrifuged at 4000 rpm for 20 min to obtain a precipitate. The precipitate is added into 100 times the volume of water, stirred and dissolved, filtered, washed and concentrated using a 100 nm ceramic membrane to obtain a carboxymethyl Schizophyllan concentrated solution; the concentrated solution is dried to obtain carboxymethyl Schizophyllan.
[0053] Example 3
[0054] Preparation of carboxymethyl schizophyllan in this example
[0055] Fermented Schizophyllum mycelia were dried, crushed, and sieved through a 200-mesh sieve to obtain Schizophyllum mycelia powder. 10 g of the powder was added to 400 mL of anhydrous ethanol and isopropanol, and the mixture was refluxed at 60°C for 0.5 h. The volume ratio of anhydrous ethanol to isopropanol was 1:10. The mixture was cooled to room temperature, and then 100 mL of 30% sodium hydroxide solution was added. The mixture was stirred at 500 rpm for 40 min and then frozen at -6°C for 12 h. Thawed using 300 W ultrasonic power for 60 min, transferred to a reactor, and the reaction temperature maintained at 40°C. A 2 mol / L chloroacetic acid solution was then added dropwise at 20 mL / min until the mass ratio of chloroacetic acid to sodium hydroxide reached 1.1:1. The reaction was continued for 6 h. The pH was adjusted to 6 with acetic acid, and the mixture was centrifuged at 4000 rpm for 30 min to obtain a precipitate. The precipitate is added into 100 times the volume of water, stirred and dissolved, filtered, washed and concentrated using a 200 nm ceramic membrane to obtain a carboxymethyl Schizophyllan concentrated solution; the concentrated solution is dried to obtain carboxymethyl Schizophyllan.
[0056] Example 4
[0057] This example prepares carboxymethyl schizophyllan, which differs from Example 1 only in that anhydrous ethanol is used as the wetting agent instead of isopropyl alcohol, and isopropyl alcohol is distributed to anhydrous ethanol according to the ratio in Example 1. The rest is the same as Example 1.
[0058] Example 5
[0059] This example prepares carboxymethyl Schizophyllan, which differs from Example 1 only in that the volume ratio of anhydrous ethanol to isopropanol is 1:3, and the rest is the same as Example 1.
[0060] Example 6
[0061] This example prepares carboxymethyl Schizophyllan, which differs from Example 1 only in that the volume ratio of anhydrous ethanol to isopropanol is 1:12, and the rest is the same as Example 1.
[0062] Example 7
[0063] This example prepares carboxymethyl Schizophyllan, which is the same as Example 1 except that the low-temperature treatment temperature is -2°C.
[0064] Example 8
[0065] This example prepares carboxymethyl Schizophyllan, which is the same as Example 1 except that the low-temperature treatment time is 1 h.
[0066] Example 9
[0067] This example prepares carboxymethyl Schizophyllan, which differs from Example 1 only in that the mass of the mycelium powder remains unchanged, the mass-to-volume ratio of the mycelium powder to sodium hydroxide is 1:0.5, and the rest is the same as Example 1.
[0068] Example 10
[0069] This example prepares carboxymethyl Schizophyllan, which differs from Example 1 only in that the mass of the mycelium powder remains unchanged, the mass-to-volume ratio of the mycelium powder to sodium hydroxide is 1:5, and the rest is the same as Example 1.
[0070] Example 11
[0071] This example prepares carboxymethyl Schizophyllan, which differs from Example 1 only in that the mass of chloroacetic acid remains unchanged, and the mass ratio of chloroacetic acid to sodium hydroxide is 0.6:1. The rest is the same as Example 1.
[0072] Example 12
[0073] This example prepares carboxymethyl Schizophyllan, which differs from Example 1 only in that the mass of chloroacetic acid remains unchanged, the mass ratio of chloroacetic acid to sodium hydroxide is 1.7:1, and the rest are the same as Example 1.
[0074] Comparative Example 1
[0075] This comparative example prepares carboxymethyl Schizophyllan, which differs from Example 1 only in that the low-temperature freezing treatment is not performed, and the alkalized Schizophyllan mycelium powder is directly carboxylated. The rest is the same as Example 1.
[0076] Comparative Example 2
[0077] This comparative example prepares carboxymethyl Schizophyllan, which differs from Example 1 only in that no pretreatment is performed and the Schizophyllan mycelium is directly alkalized. The rest is the same as Example 1.
[0078] Test Example 1
[0079] This test example measures the degree of substitution of carboxymethyl schizophyllan prepared in the above examples and preparation examples.
[0080] The degree of substitution of carboxymethyl in carboxymethyl schizophyllan was determined by titration. The specific method is based on GB / T20375-2006 (Determination of carboxymethyl content in modified starch-carboxymethyl starch). Carboxymethyl schizophyllan was acidified with hydrochloric acid to convert all carboxymethyl salts into acid form. It was then precipitated with methanol, washed and dried. 1.5 g of the acidified sample was weighed, moistened with 2 mL of methanol, and 75 mL of water was added to dissolve it, followed by addition of 25 mL of 0.1 mol / L sodium hydroxide solution. 2-3 drops of 10 g / L phenolphthalein alcohol solution were added, and the solution was titrated with 0.1 mol / L dilute hydrochloric acid until colorless. The specific results of the degree of substitution are shown in Table 1.
[0081] The degree of substitution is calculated as follows:
[0082]
[0083] Where, c: molar concentration of dilute hydrochloric acid used for titration, in moles per liter (mol / L); M c : Acidic carboxymethyl molar mass (-CH2-COOH), 58g / mol; V b The volume of dilute hydrochloric acid consumed during blank titration, in milliliters (mL); V a The volume of dilute hydrochloric acid consumed during sample titration, in milliliters (mL); m is the mass of carboxymethyl Schizophyllan used for titration, in milligrams (mg); w m The water content of carboxymethyl schizophyllan used for titration is % (accurate to 0.01%).
[0084]
[0085] Among them, x c w is the degree of substitution of carboxymethyl schizophyllan in the dried experimental sample; c is the mass fraction of carboxymethyl in the dried experimental sample, %; M a is the molar mass of dehydrated grapes, M a =162g / mol; M c is the molar mass of the acidic carboxymethyl group after reaction with Schizophyllan, Me=58 g / mol.
[0086] Table 1
[0087] Group Degree of substitution Example 1 0.88 Example 2 1.02 Example 3 0.92 Example 4 0.86 Example 5 0.90 Example 6 0.87 Example 7 0.85 Example 8 0.80 Example 9 0.56 Example 10 0.82 Example 11 0.53 Example 12 0.86 Comparative Example 1 0.33 Comparative Example 2 0.45
[0088] The above results show that the mycelium is crushed to reduce its particle size, which is beneficial for the alkalization treatment. At the same time, the contact area between Schizophyllan and chloroacetic acid during the carboxylation reaction is increased, which is beneficial for the substitution reaction. In addition, during the alkalization process, the ice crystals formed during the low-temperature freezing process will destroy the microstructure of the mycelium, which is beneficial for the carboxymethylation reaction and can significantly increase the degree of substitution of carboxymethyl Schizophyllan.
[0089] Test Example 2
[0090] This test example is to determine the content of carboxymethyl schizophyllan protein
[0091] The BCA method was used to draw a standard curve based on the absorbance of the purple chelate generated by the reaction of protein with copper ions and dimethicone at 562 nm. Bovine serum albumin (BSA) was used as the standard protein. The protein content was calculated by comparison with the standard curve. The specific results are shown in Table 2. Figure 1 shown.
[0092] Table 2
[0093] Group Protein content% Example 1 0.66 Example 2 0.48 Example 3 0.34 Example 4 0.67 Example 5 0.66 Example 6 0.66 Example 7 0.86 Example 8 0.66 Example 9 0.98 Example 10 0.24 Example 11 0.51 Example 12 0.36 Comparative Example 1 2.71 Comparative Example 2 1.81
[0094] The results show that the mycelium is crushed to reduce its particle size, allowing for more complete contact between the alkali and the protein in the mycelium, which is beneficial for the separation of protein from Schizophyllan. Furthermore, during the alkalinization process, the mycelium is subjected to low-temperature freezing. The ice crystals formed during the freezing process destroy the microstructure of the mycelium, further enhancing the interaction between the alkali and the protein, and improving the protein removal efficiency, thereby obtaining highly transparent, highly substituted carboxymethyl Schizophyllan.
[0095] Test Example 3
[0096] This test case conducts an in vitro moisturizing experiment
[0097] In human skin, the primary active moisturizing factors are natural moisturizing factors, such as aquaporin (AQP3). In vitro cell experiments were conducted to test the effects of carboxymethylated schizophyllan polysaccharides with varying degrees of substitution on AQP3 gene expression in HaCaT cells, thereby assessing the moisturizing efficacy of the samples.
[0098] HaCaT cells were seeded in 6-well plates at 6×105 per well and cultured at 37°C, 5% CO2 for 12 hours. After incubation, the cells were gently rinsed once with D-Hanks. Fresh culture medium was added to the normal control group, and fresh culture medium containing CM-SPG prepared in Example 1 at different concentrations was added to the sample group. The cells were cultured at 37°C, 5% CO2 for 24 hours. After the culture, the cells were collected, and total RNA was extracted from each experimental group. cDNA was synthesized, and q-PCR was used to detect the gene expression of β-actin and AQP3 genes. The primers are shown in Table 3. The relative expression level of AQP3 gene expression was calculated. The specific test results are shown in Table 3. Figure 2 As shown in the results, it was found that compared with the blank control group, the addition of carboxymethyl schizophyllan significantly increased the gene expression of AQP3, thereby promoting the moisturizing effect.
[0099] Table 3
[0100] Primer name sequence name Primer sequence (5'-3') β-actin-F SEQ ID NO.1 GGACTCCTATGTGGGTGACGAGG β-actin-R SEQ ID NO.2 GGGAGAGCATAGCCCTCGTAGAT AQP3-F SEQ ID NO.3 AGACAGCCCCTTCAGGATTT AQP3-R SEQ ID NO.4 TCCCTTGCCCTGAATATCTG
[0101] Test Example 4
[0102] This test case performs an in vitro repair test (cell scratch test)
[0103] Select human fibroblasts with good vitality, collect the cells and count them, and prepare 5×10 5 To a cell suspension of 100 cells / mL, 2 mL of complete culture medium was added to allow the cells to adhere to the wall and grow. The next day, when the cell confluence was about 95%, a 10 μL pipette tip was used to draw a vertical line along the black line marked by the marker. The original complete culture medium was discarded and washed 2-3 times with PBS to remove cell debris. Fresh culture medium was added to the normal control group, fresh culture medium containing carboxymethyl schizophyllan (CM-SPG) prepared in Example 1 at different concentrations was added to the sample group, and fresh culture medium containing 10% serum was added to the positive control group. The cells were observed under an inverted microscope and photographed at 0 h and 24 h. The pictures were analyzed with the help of Image J software to calculate the cell scratch migration rate. The specific test results are shown in the figure below. Figure 3 As shown, carboxymethyl schizophyllan can significantly enhance the repair ability of cells.
[0104] Cell scratch repair rate = (initial intercellular distance mean - intercellular distance mean at time t) / initial intercellular distance mean.
[0105] In summary, the present invention uses fermented mycelium of Schizophyllum as raw material to prepare carboxymethyl Schizophyllum, eliminating the need for purification, greatly reducing the complexity of the preparation process, and facilitating subsequent industrial production. Furthermore, the use of low-temperature freezing technology allows the alkali solution to fully contact the Schizophyllum mycelium, facilitating the substitution reaction. The resulting highly substituted carboxymethyl Schizophyllum has significant moisturizing and repairing properties and can be used in cosmetics.
[0106] The applicant declares that the above is only a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention fall within the scope of protection and disclosure of the present invention.
Claims
1. A method for preparing carboxymethyl schizophyllan, characterized in that: The preparation method comprises: The mycelia of Schizophyllum is pretreated to obtain mycelia powder, which is then mixed with sodium hydroxide for alkalization treatment and then subjected to low-temperature freezing treatment. After thawing, a carboxylating agent is added to perform carboxylation treatment.
2. The preparation method according to claim 1, characterized in that The pretreatment step includes drying, crushing and screening the mycelium of Schizophyllum; Preferably, the pore size of the sieve is 100-200 mesh.
3. The preparation method according to claim 1 or 2, characterized in that Before the alkalization treatment, the mycelium powder is subjected to an infiltration treatment; Preferably, the wetting agent includes anhydrous ethanol and isopropyl alcohol; Preferably, the volume ratio of anhydrous ethanol to isopropanol is 1:(5-10); Preferably, the mass volume ratio of the mycelium powder to the infiltrant is 1:(30-50) g / mL; Preferably, the soaking temperature is 65-75° C., and the soaking time is 0.5-2 h.
4. The preparation method according to any one of claims 1 to 3, characterized in that The mass concentration of the sodium hydroxide is 30% to 50%; Preferably, the mass ratio of the mycelium powder to sodium hydroxide is 1:(1-3); Preferably, the alkalization treatment time is 20 to 40 minutes.
5. The preparation method according to any one of claims 1 to 4, characterized in that The low-temperature freezing temperature is -18 to -6°C and the time is 4 to 12 hours; Preferably, the thawing method comprises ultrasound and / or heating; Preferably, the power of the ultrasound is 200-400W, and the time is 0.5-2.0h; Preferably, the heating temperature is 20-30°C.
6. The preparation method according to any one of claims 1 to 5, characterized in that The carboxylating agent includes chloroacetic acid and / or sodium chloroacetate; Preferably, the concentration of the carboxylating agent is 2 to 6 mol / L; Preferably, the carboxylating agent is added at a rate of 1 to 5 mL / min; Preferably, the mass ratio of the carboxylating agent to sodium hydroxide is (0.8-1.5):
1.
7. The preparation method according to any one of claims 1 to 6, characterized in that The temperature of the carboxylation treatment is 40-70° C., and the time is 2-6 hours.
8. The preparation method according to any one of claims 1 to 6, characterized in that The preparation method further comprises adding a neutralizing agent after carboxylation treatment, centrifuging to obtain a precipitate, re-dissolving, concentrating by membrane filtration, and drying to obtain the product; Preferably, the neutralizing agent comprises any one of acetic acid, hydrochloric acid, propionic acid, oxalic acid or citric acid, or a combination of at least two thereof; Preferably, the neutralizing agent adjusts the pH value to 6 to 8; Preferably, the centrifugal speed is 2000-6000 rpm, and the time is 10-30 min; Preferably, the reconstitution solvent comprises water; Preferably, the pore size of the membrane filtration is 100-200 nm.
9. A cosmetic containing carboxymethyl schizophyllan, characterized in that: The cosmetic comprises carboxymethyl Schizophyllan prepared by the preparation method of carboxymethyl Schizophyllan according to any one of claims 1 to 8.
10. The cosmetic containing carboxymethyl Schizophyllan according to claim 9, characterized in that The cosmetics include any one of essence, lotion, emulsion, cream, cleanser or facial mask, or a combination of at least two; Preferably, the added amount of carboxymethyl schizophyllan in the cosmetic is ≥0.05‰.
Citation Information
Patent Citations
Schizophyllum commune fermentation product and preparation method and application thereof
CN113755544A
Sulfated schizophyllan, preparation method thereof and application of sulfated schizophyllan in cosmetics
CN114014948A
Preparation process of carboxymethyl chitosan and carboxymethyl chitosan gel
CN117886968A
Carboxy methyl schizophllan polysacharide preparing method and its use for use in cosmetics and anticancer drugs
CN1775813A