Application of Simpicillium lanosoniveum in grease degradation

By using Simplicillium lanosoniveum fungal strain for oil degradation, the problem of kitchen waste disposal in remote rural areas has been solved, and the oil degradation is efficiently achieved, and environmental quality and resource utilization are improved.

CN120442418AActive Publication Date: 2025-08-08ACADEMY OF PLANNING & DESIGNING OF THE MINIST OF AGRI
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510908822.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-02
Publication Date
2025-08-08
Estimated Expiration
2045-07-02

AI Technical Summary

Technical Problem

The high oil content in kitchen waste in remote rural areas is caused by difficult waste disposal, oil and fat pollute the environment, and traditional physical and chemical methods are inefficient and have the risk of secondary pollution, and microbial degradation technology has not been fully developed.

Method used

Simplicillium lanosoniveum fungal strains are used to degrade oil and fat, and microbial agents in the form of dry powder or bacterial liquid are prepared through fermentation and culture, which are used for degradation of kitchen waste and oil-containing places, and combined with other oil-degrading strains to improve degradation efficiency.

Benefits of technology

Effectively degrade oil and fat, improve the garbage disposal process, reduce environmental pollution, improve resource utilization, reduce the risk of sewage discharge pipelines, and improve the self-purification capacity of water.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442418A_ABST
    Figure CN120442418A_ABST
Patent Text Reader

Abstract

The invention provides an application of Simpicillium lanosoniveum in degradation of oil and fat. The invention further provides an application of the Simpicillium lanosoniveum in degradation of the oil and fat. According to the present invention, the simple lanosoniveum is preserved in the China General Microbiological Culture Collection Center (CGMCC) on November 20, 2023, and has the preservation number of CGMCC No.40987, and the preservation number of the simple lanosoniveum is CGMCC No.40987; the provided cylindrosporium monococcum can be used for effectively degrading oil and fat.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of agricultural microorganisms. Simplicillium lanosoniveum Application in oil degradation. Background Art

[0002] In remote rural areas, waste with high grease content, such as food waste (kitchen waste), is difficult to transport to urban areas for centralized treatment, and oil-water separation technology is not yet widespread. High grease content impairs the aerobic fermentation and humification of food waste (kitchen waste) and the quality of fertilizer products. Grease treatment technologies similar to those used in this scenario are urgently needed to improve the resource utilization of oily pollutants. Furthermore, sewage pipes, such as those used for restaurant wastewater, are frequently clogged due to grease. When grease-laden wastewater is discharged into water bodies, grease floats on the surface, hindering oxygen dissolution, impairing the water's self-purification capacity, and harming aquatic ecosystems.

[0003] Traditional physical and chemical degradation methods (such as suspension and chemical flocculation) are subject to high investment, secondary pollution risks, and low COD / BOD removal rates, limiting their practical application. Microbial degradation, with its low cost and zero secondary pollution, is becoming a new trend. However, efficient oil-degrading bacteria remain to be discovered. Summary of the Invention

[0004] The present invention aims to solve one of the technical problems in the related art at least to a certain extent. The present invention provides a method for oil degradation. Simplicillium lanosoniveum It can be used for oil degradation, as a fungus that efficiently degrades oil, and can play the role of oil degradation. It can also supplement the existing oil-degrading bacteria library, provide more choices, and can also be combined with other known or unknown bacteria or fungi with oil-degrading functions, such as Fusarium spp. Fusarium proliferatum The compounds work together to achieve the effect of oil degradation.

[0005] Specifically, the present invention provides the following technical solutions: A first aspect of the present invention provides a Simplicillium lanosoniveum Use in oil degradation, the Simplicillium lanosoniveum It was deposited in the General Microbiology Center of China Culture Collection Administration on November 20, 2023, with the deposit number CGMCC No.40987.

[0006] According to an embodiment of the present invention, the Simplicillium lanosoniveum The sequence of 18s rDNA is shown in SEQ ID NO: 1.

[0007] In a second aspect of the present invention, a microbial agent is provided for use in oil degradation, wherein the microbial agent comprises Simplicillium lanosoniveum , Simplicillium lanosoniveumIt was deposited in the General Microbiology Center of China Culture Collection Administration on November 20, 2023, with the deposit number CGMCC No.40987.

[0008] According to an embodiment of the present invention, the Simplicillium lanosoniveum The sequence of 18s rDNA is shown in SEQ ID NO: 1.

[0009] According to an embodiment of the present invention, the microbial agent is a dry powder or a bacterial liquid, and the dry powder or the microbial agent Simplicillium lanosoniveum The effective viable count is at least 1×10 10 CFU / mL.

[0010] According to an embodiment of the present invention, the microbial agent is Simplicillium lanosoniveum It is obtained by fermentation culture in an enriched culture medium containing 0.16wt%~1.6wt% of animal and plant oils.

[0011] According to an embodiment of the present invention, the formula of the enrichment medium includes 0.1-0.5 g of MgSO4·7H2O, 1-2 g of (NH4)2SO4, 0.3-1 g of KH2PO4, 1-2 g of K2HPO4, 3-8 g of NaCl, 1.6-16 g of soybean oil, 1000 mL of deionized water, and a pH of 7.0-7.2.

[0012] The fermentation culture conditions are as follows: Simplicillium lanosoniveum After inoculation into the enrichment medium, the fermentation culture is carried out at 28-32° C. and 100-150 r / min for 2-7 days.

[0013] The third aspect of the present invention provides a method for degrading grease in a sample or a place, comprising: Simplicillium lanosoniveum or contain Simplicillium lanosoniveum The microbial agent is mixed with the sample and cultured, or placed in a place containing grease, so as to degrade the grease in the sample or the place.

[0014] According to an embodiment of the present invention, the Simplicillium lanosoniveum The inoculum amount is 0.2-5% (w / w) of the amount of the sample.

[0015] According to an embodiment of the present invention, the sample is selected from restaurant kitchen waste, grease-containing waste (such as wastewater, waste gas, waste residue), etc., and the place includes at least one of a grease-containing sewage pipe and a grease-containing pollutant collection place.

[0016] In a fourth aspect of the present invention, there is provided a Simplicillium lanosoniveum , Simplicillium lanosoniveumIt was deposited in the General Microbiology Center of China Culture Collection of Microorganisms on July 5, 2023, with the deposit number CGMCC No.40761, and the deposit address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0017] According to an embodiment of the present invention, the Simplicillium lanosoniveum The sequence of 18s rDNA is shown in SEQ ID NO: 1.

[0018] The beneficial effects achieved by the present invention are at least: The present invention provides Simplicillium lanosoniveum , which can effectively degrade oils and fats, and its main function is to accelerate the oil metabolism process. In addition, the provided Simplicillium lanosoniveum It can improve the original microbial community structure and microecology, and reduce the pollution of oil-containing pollutants to the environment. Simplicillium lanosoniveum The exogenous microbial agent can be prepared into solid powder or liquid as needed and used in the field of oil degradation.

[0019] Certificate of Deposit Classification named Simplicillium lanosoniveum The deposit number is CGMCC No.40987, the deposit institution is: General Microbiology Center of China Culture Collection Administration, the deposit date is: November 20, 2023, and the deposit address is: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 According to an embodiment of the present invention, Simplicillium lanosoniveum Schematic diagram of the colony characteristics.

[0021] Figure 2 According to an embodiment of the present invention, Simplicillium lanosoniveum Schematic diagram of morphological characteristics.

[0022] Figure 3 This is a diagram of oil degradation provided according to an embodiment of the present invention.

[0023] Figure 4 According to an embodiment of the present invention, Simplicillium lanosoniveum Growth trend chart.

[0024] Figure 5 According to an embodiment of the present invention, Simplicillium lanosoniveum pH trend chart.

[0025] Figure 6 According to an embodiment of the present invention, Simplicillium lanosoniveum Oil content change chart. DETAILED DESCRIPTION

[0026] The embodiments of the present invention are described in detail below. Examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and are intended to be used to explain the present invention, but should not be understood as limiting the present invention.

[0027] The present invention provides a Simplicillium lanosoniveum It was deposited in the General Microbiology Center of China Culture Collection of Microorganisms on November 20, 2023, with the deposit number CGMCC No.40987, and the deposit address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0028] Provided Simplicillium lanosoniveum The sequence of 18s rDNA is shown in SEQ ID NO: 1.

[0029] Its 18s rDNA sequence is shown below: CGTAGGTGAACCTGCGGAGGGATCATTATCGAGTTTATCCAACTCCCAACCCTATGTGAACCTACCTTTATGTTGCTTCGGCGGTCTCGCGCCGGGTTGCTCCCCTGGGGGCTCCCGGGACCACGCGTCCGCCGGAGACCACAAACTCTTG ATTTTCGCGAAAGCAGTATTATTCTGAGTGGCCGAAAGGCAAAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCG AATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCTCGAGCTCGTCTTCATTGACGGGATCGGTGTTGGGACCCGGCGAGCGGGGACTTTTGTCCTCTGCCGGCCCCGAAATTCAGT GGCGGCCCGTTGCGGCGACCTCTGCGTAGTAACTCAACCTCGCACCGGTAACAGCATCGTGGCCACGCCGTAAAACCCCCGACTTTTATAAGGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAAGCGGAGGA (SEQ ID NO: 1) Provided Simplicillium lanosoniveumThe material is obtained by taking food waste and screening it step by step through a culture medium containing animal and vegetable oils. After gradient acclimation through an enriched culture medium containing animal and vegetable oils, the Simplicillium lanosoniveum The animal and plant oils mentioned include but are not limited to soybean oil, corn oil, peanut oil, lard, etc. According to a preferred embodiment, the plant oil mentioned is soybean oil.

[0030] The present invention also provides a microbial agent, comprising the Simplicillium lanosoniveum. According to a specific embodiment, the provided microbial agent is according to the above-mentioned Simplicillium lanosoniveum According to the specific embodiment, the microbial agent can be prepared in the form of dry powder or bacterial liquid, wherein the dry powder or bacterial liquid Simplicillium lanosoniveum The effective viable count is at least 1×10 10 CFU / mL, for example, about 1.5×10 10 CFU / mL, 2×10 10 CFU / mL, 3×10 10 CFU / mL, 4×10 10 CFU / mL, 5×10 10 CFU / mL, 6×10 10 CFU / mL, 7×10 10 CFU / mL, 8×10 10 CFU / mL, 9×10 10 CFU / mL, etc. Before use, the dry powder can be activated with a certain amount of sterile water or special culture medium in advance, for example, it can be activated for 2 to 8 hours.

[0031] The microbial agent can be obtained by fermentation. Simplicillium lanosoniveum The fermentation is carried out by using an enrichment medium containing 0.16 wt% to 1.6 wt% of animal and vegetable oils (soybean oil according to a preferred embodiment). Simplicillium lanosoniveum After inoculation into the enrichment medium, the fermentation culture is carried out at 28-32° C. and 100-150 rpm for 2-7 days, for example, 5-7 days.

[0032] According to an embodiment of the present invention, the formula of the enrichment medium includes 0.1-0.5 g of MgSO4·7H2O, 1-2 g of (NH4)2SO4, 0.3-1 g of KH2PO4, 1-2 g of K2HPO4, 3-8 g of NaCl, 1.6-16 g of soybean oil, 1000 mL of deionized water, and a pH of 7.0-7.2.

[0033] The above mentioned fertilizers can be added to the basic fertilizersSimplicillium lanosoniveum Alternatively, the aforementioned microbial agents can be used to produce microbial fertilizers for applications requiring oil degradation. The base fertilizer mentioned above can be composted organic fertilizer. This compost can be household waste compost (using kitchen waste (food waste) for composting); livestock and poultry manure compost; dead wood compost (composting tree bark with fermentation aids such as chicken manure or oil residue); or leaf mold compost (composting fallen leaves from deciduous broadleaf trees).

[0034] The present invention also provides a method for degrading grease in a sample or a place, comprising: Simplicillium lanosoniveum Alternatively, the aforementioned microbial agent or microbial fertilizer may be mixed and cultured with the sample, or placed in a grease-containing location to degrade the grease in the sample or location. Such locations include, but are not limited to, food waste (kitchen waste) collection sites, food waste (kitchen waste) in remote rural areas that is difficult to transport for centralized processing, and grease-rich sewage pipes.

[0035] The above provided Simplicillium lanosoniveum Alternatively, microbial agents can be used in the field of oil degradation, such as aerobic fermentation of food waste. When the initial oil content of the feed is approximately 20% (e.g., when the oil content of the feed is 15-20%), the oil degradation efficiency is at least 40%, for example, 42%, 45%, 48%, 50%, 52%, 55%, 58%, 60%, etc. This oil degradation efficiency can be maintained after fermentation for more than 20 days (e.g., approximately 25 days).

[0036] The technical scheme of the present invention is described below by specific examples. It should be noted that these examples are only used to facilitate the understanding of those skilled in the art and should not be regarded as limiting the scope of protection of the present invention. Unless otherwise specified, the reagents used in the examples can be obtained commercially.

[0037] Example 1 Example 1 A strain was obtained by screening using the following method Simplicillium lanosoniveum , specifically including: A 5 g sample was taken from the high-temperature composting period of food waste composting process of a food waste treatment company in Suzhou, China Agricultural University, and incubated in 250 mL of enrichment medium (first soybean oil gradient: 1.6 g / L, 2.4 g / L, 3.2 g / L, 4 g / L, 4.8 g / L) at 30°C and 120 rpm for 6–7 days. Then, 5 mL of the bacterial liquid was transferred to 250 mL of new enrichment medium (second soybean oil gradient: 1.6 g / L, 2.4 g / L, 3.2 g / L, 4 g / L, 4.8 g / L) and incubated under the same conditions for 6–7 days. Six cycles of gradient acclimation (third soybean oil gradient: 3.2 g / L, 4 g / L, 4.8 g / L, 5.6 g / L, 6.4 g / L; fourth soybean oil gradient: 3.2 g / L, 4.8 g / L, The fifth concentration of soybean oil gradient was 5.6 g / L, 6.4 g / L, 8 g / L; the fifth concentration of soybean oil gradient was 6.4 g / L, 9.6 g / L, 11.2 g / L, 12.8 g / L, 16 g / L; the sixth concentration of soybean oil gradient was 6.4 g / L, 9.6 g / L, 11.2 g / L, 12.8 g / L, 16 g / L). Each time, the bacterial community with the best growth and better oil-dissolving performance in each cycle was selected for the next stage of gradient acclimation.

[0038] Then, the bacterial liquid with good growth after 6 cycles of acclimation was diluted gradiently and inoculated on the culture medium supplemented with neutral red. It was cultured at 30℃ for 48 hours and the colonies were observed to see whether they turned red. If they turned red, it meant that the strain could degrade oil and produce fatty acids.

[0039] The red colonies were screened and picked with an inoculating loop for streak separation. The purified strains were stored in beef extract peptone solid slant medium for future use.

[0040] The enrichment medium used consists of a basal medium and a gradient of soybean oil concentrations. The basal medium contains: 0.1 g MgSO₄·7H₂O, 1.0 g (NH₄)₂SO₄), 0.3 g KH₂PO₄, 1.5 g K₂HPO₄, 5.0 g NaCl, and 1000 mL deionized water, pH 7.0–7.2. A gradient of soybean oil concentrations (using soybean oil as the sole carbon source for gradient screening and acclimation of microorganisms) is used, with the concentration increasing gradually over the acclimation cycle (as shown above).

[0041] The beef extract peptone solid medium used is formulated as follows: 5 g beef extract, 5 g NaCl, 10 g peptone, 20 g agar powder, 1000 mL deionized water, pH 7.0. Both flat and slant formats are available.

[0042] The formula of the medium containing neutral red used is: add 1 mL of 1.6% (mass fraction) neutral red aqueous solution and 5.0 g of soybean oil to beef extract peptone solid medium.

[0043] The strain obtained by this method was named NHYJZ2. The obtained strain was then characterized as follows: (1) Colony characteristics like Figure 1 As shown, strain NHYJZ2 produced milky white colonies with distinct edges. Within a week, the colonies expanded to approximately 4 cm in diameter.

[0044] (2) Colony morphology Inoculate the strain from solid or liquid culture onto a blank glass slide and stain using Gram stain. Observe the colony details using an optical microscope at magnifications of 100x, 200x, 500x, 630x, and 1000x. Photograph using LASV 4.3 software.

[0045] Microscope observation Figure 2 As shown, from Figure 2 Obvious hyphae and spores can be observed.

[0046] (3) Identification of strains Genomic extraction was performed using a DNA extraction kit (manufacturer: Beijing Boyushun Biotechnology Co., Ltd.). The extracted DNA was used as a PCR template, and PCR amplification was performed using a PCR instrument (Biometra Tgradient) with primers (synthesized by BGI) to obtain PCR products. Taq DNA polymerase and other amplification reagents were purchased from TaKaRa.

[0047] The universal primers used include: ITS1:TCCGTAGGTGAACCTGCGG (SEQ ID NO:2); ITS4:TCCTCCGCTTATTGATATGC (SEQ ID NO:3).

[0048] The PCR amplification system was as follows: treated sample (20 ng / μL), template 2 μL, dNTP mixture (2.5 mM) 2.5 μL, primers (20 μM) 1.5 μL each, 10× ExTaq buffer (MgCl2) 2+ plus) 5 μL, ExTaq enzyme (5 U / μL) 0.2 μL, and add ddH2O to 50 μL.

[0049] The PCR amplification program was as follows: pre-denaturation at 94°C for 5 min; 30 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 45 s; and extension at 72°C for 5 min.

[0050] After the PCR amplification product was detected on 1.5% agarose, the target band was recovered and purified using a PCR purification kit (manufacturer: Promega). Bidirectional sequencing was performed using the amplification primers (manufacturer: ABI Sequencer 3730xl). The obtained sequencing results were spliced and entered into GenBank for online comparison using Blast. Finally, this strain was identified as Monosporus cylindrospermum Simplicillium cylindrosporum The sequence of its 18s rDNA is shown in SEQ ID NO: 1. The strain is deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms with the deposit number CGMCC No.40761.

[0051] Example 2 Example 2 The oil degradation ability of the strain prepared in Example 1 was identified.

[0052] (1) Oil degradation ability In order to enhance the oil degradation ability of this strain, the performance test of this strain was carried out using an enrichment medium (the formula of the base medium of this medium is the same as that of Example 1 above, except that the amount of soybean oil added is 10 g / L) and cultured at 30°C and 120 r / min. It was finally found that the oil degradation efficiency of this strain exceeded 80% on the second day, showing a shorter degradation time and efficiency. Without being limited by theory, it may be related to the production of hyphae and spores by the fungus. The increase in the specific surface area of the mycelium and the formation of the capture network enhance its ability to capture and degrade oil. The results are shown in Figure 2. Figure 3 shown.

[0053] The calculation formula for the mentioned grease degradation efficiency is as follows: (Fat content on day 0 - fat content on day n) / fat content on day 0 × 100% (2) Growth The OD600 value was used to evaluate the growth rate of the bacteria. The OD600 value can be used to indicate the growth rate of the bacterial colony; a larger OD600 value corresponds to a higher bacterial concentration. During the bacterial colony acclimation process, plant oil was used as the sole carbon source. The oil degradation efficiency represents the oil-degrading ability of the bacterial colony; the higher the oil degradation efficiency, the better the oil degradation performance of the bacterial colony.

[0054] The strain was cultured in an enrichment medium (the base medium formula of the medium was the same as that in Example 1 above, with 10 g / L soybean oil added) at 30°C and 120 rpm for 6 days, and the OD600 reached about 3.38. Figure 4shown.

[0055] (3) Acid production capacity To investigate the acid-producing capacity of the bacteria, we used pH to evaluate this indicator. The pH of the nutrient solution represents the acidity or alkalinity of the metabolites produced during bacterial growth. A decrease in pH indicates the production of acidic substances during microbial life, while an increase indicates the production of alkaline substances.

[0056] like Figure 5 As shown, this strain was cultured in an enrichment medium (the basic medium formula of the medium was the same as that in Example 1 above, with 10 g / L soybean oil added) at 30°C and 120 rpm for 6 days, and the pH value was about 3.1.

[0057] Example 3 Example 3 verifies the oil degradation ability of the provided strain.

[0058] Prepare a simulated fermentation tank with a volume of 725 mL. The fermentation tank is placed in a programmable temperature-raising insulated box. Its temperature is controlled by the insulated box. Set eight temperature platforms to simulate the actual fermentation process. Platform 1: 30℃ for 1 day, Platform 2: 40℃ for 1 day, Platform 3: 50℃ for 1 day, Platform 4: 55℃ for 1 day, Platform 5: 60℃ for 7 days, Platform 6: 40℃ for 4 days, Platform 7: 45℃ for 4 days, Platform 8: 30℃ for 8 days. Fill it with a mixture of food waste and straw (food waste: corn straw = 4:1 by mass ratio). The filling rate is 83% when full, that is, 600 mL of material. Set up two groups of experiments. The experimental group was then inoculated at an inoculation rate of 1% (W / W). Simplicillium lanosoniveum The viable count of the bacteria before inoculation was 1×10 10 CFU / mL, 6 mL was inoculated. The control group was not inoculated. Simplicillium lanosoniveum During the composting period, samples were collected on days 0, 3, 7, 13, 20, and 27. The ventilation rate was 0.2 L / (min·kg dry weight) and the interval was 30 min every 30 min.

[0059] Then the oil content of the material was measured at different time periods. Figure 6 As shown in the figure, after 27 days of aerobic fermentation, the oil degradation rate was 26.59% compared with the control group. Simplicillium lanosoniveum The experimental group had a higher oil degradation efficiency of 47.25%, an increase of 20.66%.

[0060] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A Simplicillium lanosoniveum Use in oil degradation, characterized in that described Simplicillium lanosoniveum It was deposited in the General Microbiology Center of China Culture Collection of Microorganisms on November 20, 2023, with the deposit number CGMCC No.40987.

2. The use according to claim 1, characterized in that described Simplicillium lanosoniveum The sequence of 18srDNA is shown in SEQ ID NO:

1.

3. The use of microbial agents in oil degradation, characterized in that: The microbial agent includes Simplicillium lanosoniveum , Simplicillium lanosoniveum It was deposited in the General Microbiology Center of China Culture Collection of Microorganisms on November 20, 2023, with the deposit number CGMCC No.40987.

4. The use according to claim 3, characterized in that The microbial agent is a dry powder or a bacterial liquid, and the dry powder or the bacterial liquid Simplicillium lanosoniveum The effective viable count is at least 1×10 10 CFU / mL.

5. The use according to claim 3, characterized in that The microbial agent is passed through Simplicillium lanosoniveum It is obtained by fermentation culture in an enriched medium containing 0.16wt% to 1.6wt% of animal and plant oils; The formula of the enrichment medium includes 0.1-0.5 g of MgSO4·7H2O, 1-2 g of (NH4)2SO4, 0.3-1 g of KH2PO4, 1-2 g of K2HPO4, 3-8 g of NaCl, 1.6-16 g of soybean oil, 1000 mL of deionized water, and a pH of 7.0-7.

2.

6. The use according to claim 5, characterized in that The fermentation culture conditions are as follows: Simplicillium lanosoniveum After inoculation into the enrichment medium, the fermentation culture is carried out at 28-32° C. and 100-150 r / min for 2-7 days.

7. A method for degrading grease in a sample or a place, characterized in that: include: Will Simplicillium lanosoniveum or contain Simplicillium lanosoniveum The microbial agent is mixed with the sample and cultured, or placed in a place containing grease, so as to degrade the grease in the sample or the place.

8. The method according to claim 7, wherein described Simplicillium lanosoniveum The inoculum amount is 0.2-5% (w / w) of the amount of the sample.

9. The method according to claim 7, characterized in that The sample is selected from at least one of kitchen waste and grease-containing waste, and the location is selected from at least one of a grease-containing sewage pipe and a grease-containing pollutant collection location.

10. A Simplicillium lanosoniveum , Simplicillium lanosoniveum It was deposited in the General Microbiology Center of China Culture Collection Administration on November 20, 2023, with the deposit number CGMCC No.40987.

Citation Information

Patent Citations

  • Simplicillium lanosoniveum and application of simplicillium lanosoniveum in dissolving lignite to prepare phthalic acid ester

    CN110747132A

  • New simplicillium microorganism having ability to control citrus disease injury and microbe-controlling method using the same

    JP2005073583A

  • Novel mannosyl lipid derivative derived from simplicillium lamellicola krict3 and composition for plant disease control or pest control containing novel mannosyl lipid derivative as active ingredient

    KR1020140033709A