Streptococcus equi for producing micromolecular hyaluronic acid as well as preparation method and application of streptococcus equi

Abstract

The invention relates to streptococcus equi capable of producing micromolecular hyaluronic acid as well as a preparation method and application of the streptococcus equi, and belongs to the technical field of bioengineering. The classification of the streptococcus equi for producing the small-molecule hyaluronic acid is named as streptococcus equi, and the classification of the streptococcus equi is named as streptococcus equi; the preservation number of the streptococcus equi is CGMCC (China General Microbiological Culture Collection Center) No.30659, the preservation unit is China General Microbiological Culture Collection Center, and the preservation time is May 16, 2024. The yield of the streptococcus equi micromolecular hyaluronic acid reaches 20 g / L or above, the molecular weight of the hyaluronic acid is lower than 10 kD, and the streptococcus equi micromolecular hyaluronic acid has potential and wide application value in industry.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and in particular to a Streptococcus equine producing small molecule hyaluronic acid, and a preparation method and application thereof. Background Art

[0002] Hyaluronic acid (HA) is a naturally occurring glycosaminoglycan (GAG) in living organisms. Hyaluronic acid is composed of D-glucuronic acid and N-acetyl-D-glucosamine linked by β-1,3 glycosidic bonds to form disaccharide units, which are then linked by β-1,4 glycosidic bonds to form polysaccharides. Its molecular formula is (C 14 H 21 NO 11 Hyaluronic acid is widely found in animal connective tissue and in group A and group C hemolytic streptococci. HA production processes are primarily divided into animal tissue extraction and bacterial fermentation. Compared to animal tissue extraction, bacterial fermentation offers advantages in raw materials, cost, and safety, making it the predominant HA production method. Among HA-producing bacteria, Streptococcus zooepidemicus and Streptococcus equine are the primary HA-producing strains due to their low pathogenicity.

[0003] Based on molecular weight, hyaluronic acid can be divided into three categories: high molecular weight (>2000kD), low molecular weight (10-2000kD), and oligomeric hyaluronic acid (below 10kD). The biological activity of hyaluronic acid is closely related to its molecular weight. High molecular weight hyaluronic acid has strong water retention but lacks physiological activity. Low molecular weight hyaluronic acid has physiological functions such as promoting bone and angiogenesis, promoting wound healing, and enhancing immune regulation. Hyaluronic acid enzymatic hydrolysis is an important method for preparing bioactive low molecular weight hyaluronic acid. Among them, small molecule hyaluronic acid oligosaccharides have unique biological functions and have important application prospects in the fields of health care and medicine.

[0004] Enzymatic degradation is currently the primary method for preparing small-molecule hyaluronic acid. The enzyme used is hyaluronidase (HAase), a type of glycosidase that can degrade hyaluronic acid and some glycosaminoglycans into disaccharides or small oligosaccharides. Based on the specificity of the enzyme, hyaluronidases can be divided into three categories. The first category: endohyaluronan glucosaminidase (Hyalμronoglμcosaminidase, EC3.2.1.35), represented by hyaluronidases derived from human, bovine testicles, and bee venom. This type of enzyme belongs to the glycoside hydrolase class and can degrade hyaluronic acid by hydrolyzing the β-1,4-glycosidic bond between disaccharide units. The final product is generally a hyaluronic acid tetrasaccharide or hexasaccharide with N-acetyl-D-glucosamine as the reducing end. The second type: endohyaluronan glucuronidases (Hyalμronoglμcμronidase, EC3.2.1.36), represented by hyaluronidases from the salivary glands of leeches, also belong to the class of glycoside hydrolases. They hydrolyze the β-1,3-glycosidic bonds within disaccharide units to degrade hyaluronic acid, thereby producing oligosaccharides with glucuronic acid reducing ends, generally with hyaluronate tetrasaccharide as the final product. The third type: hyaluronan lyases (Hyalμronate Lyase, EC4.2.2.1), represented by hyaluronidases from the genus Streptococcus, belong to the class of lyases. They degrade hyaluronic acid by cleaving the β-1,4-glycosidic bonds between disaccharide units to produce the unsaturated disaccharide 2-aminoacetyl-2-deoxy-3-O-(β-D-glucose-4-enpyranuronic acid-)D-glucose. Therefore, their mechanism of action and products are significantly different from those of the first two types of hydrolases. Summary of the Invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a Streptococcus equine pestis that produces small molecule hyaluronic acid and its preparation method and application. The present invention produces a Streptococcus equine pestis that can produce a high amount of small molecule hyaluronic acid through genetic engineering recombination.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] In the first aspect, the present invention provides a Streptococcus equi that produces small molecule hyaluronic acid. The classification name of the Streptococcus equi is Streptococcus equi; the preservation number of the Streptococcus equi is: CGMCC No. 30659, the preservation unit is: General Microbiology Center of China Culture Collection Administration of Microorganisms, and the preservation time is: May 16, 2024.

[0008] The invention produces a Streptococcus equine plague bacteria capable of high-yielding small-molecule hyaluronic acid through genetic engineering recombination. The bacteria high-yields hyaluronic acid, and the molecular weight of the hyaluronic acid is 5-10 kD.

[0009] As a preferred embodiment of the first aspect, the Streptococcus equine includes a plasmid vector for heterologously expressing a hyaluronidase gene derived from leech; wherein, the plasmid vector is operably connected to a nucleotide fragment of the leech hyaluronidase gene, a promoter P170, a streptococcal ribosome binding site nucleotide fragment, and a signal peptide nucleotide fragment; the promoter expresses the hyaluronidase gene derived from leech; and the signal peptide is connected to the N-terminus of the expression product of the hyaluronidase gene derived from leech.

[0010] The P170 expression system selected by the present invention is a type of inducible expression system in lactococcus, which is controlled by the strong inducible promoter P170. P170 is an inducible promoter obtained by transposon mutagenesis screening. When the bacteria grow to the stationary phase, low pH values induce P170 expression and increase the expression, thereby regulating protein expression. Compared with other systems, the P170 expression system achieves self-induction by reducing the pH during growth, which is beneficial to the purification of downstream proteins. This expression system has been widely used in the industrial production of Lactococcus lactis. Although the promoter of this system is a strong inducible promoter, its suitable pH range for operation is narrower and can only be strongly transcribed when pH<5.5. During the hyaluronic acid fermentation process, along with the accumulation of hyaluronic acid and byproduct lactic acid, the pH value decreases, which is very suitable for the activation of the P170 expression system.

[0011] As a preferred embodiment of the first aspect, the signal peptide is signal peptide Q54873 or signal peptide Q53591.

[0012] The present invention has found that combining the P170 promoter in the P170 expression system with the signal peptide Q54873 or the signal peptide Q53591 on the same plasmid vector for expressing the target gene can significantly provide the expression level of the target gene, and the two have a synergistic effect. To verify this discovery, in the Examples section, the inventors combined various promoters with signal peptides and found that the P170 promoter, when used in combination with other signal peptides, did not improve the target gene expression level. At the same time, the signal peptide Q54873 or Q53591 was used in combination with other promoters, but did not improve the target gene expression level. The inventors also combined other promoters with other signal peptides to express the target gene, but did not achieve the effect of improving the target gene. As can be seen, the present invention has found that the P170 promoter, when combined with the signal peptide Q54873 or Q53591 to express the target gene, has a synergistic effect and can significantly improve the expression level of the target gene.

[0013] As a preferred embodiment of the first aspect, the amino acid sequence of the signal peptide Q53591 is shown in SQE ID No: 19; the amino acid sequence of the signal peptide Q54873 is shown in SQE ID No: 20.

[0014] As a preferred embodiment of the first aspect, the nucleotide sequence of the signal peptide Q53591 is shown as SQE ID No: 7; the nucleotide sequence of the signal peptide Q54873 is shown as SQE ID No: 6.

[0015] As a preferred embodiment of the first aspect, the nucleotide sequence of the promoter P170 is shown in SQEIDNo:1.

[0016] In a second aspect, the present invention provides a method for constructing the Streptococcus equine pestis described in the first aspect, comprising the following steps:

[0017] 1) inserting a promoter P170 nucleotide sequence fragment, a streptococcal ribosome binding site nucleotide sequence fragment, and a signal peptide Q54873 or a signal peptide Q53591 nucleotide sequence fragment into the first 13 bp of the hyaluronidase gene fragment to obtain a recombinant nucleotide fragment;

[0018] 2) operably inserting the recombinant nucleotide fragment before the T7 terminator of the pNZ5319 backbone vector fragment to obtain a recombinant plasmid vector;

[0019] 3) transferring the recombinant plasmid vector of step 2) into Streptococcus equine pestis by electroporation to obtain recombinant Streptococcus equine pestis;

[0020] 4) Screening and sequencing the recombinant Streptococcus equine pestis described in step 3) for positive clones, and the recombinant Streptococcus equine pestis with the correct plasmid sequence is the recombinant Streptococcus equine pestis.

[0021] As a preferred embodiment of the second aspect, the nucleotide sequence of the promoter P170 is shown in SQEID No: 1; the nucleotide sequence of the streptococcal ribosome binding site nucleotide sequence fragment is shown in SQE ID No: 29; the nucleotide sequence of the hyaluronidase gene fragment is shown in SQE ID No: 17; the amino acid sequence of the signal peptide Q53591 is shown in SQEID No: 19; and the amino acid sequence of the signal peptide Q54873 is shown in SQEID No: 20.

[0022] In a third aspect, the present invention provides an inducible expression vector, which uses a pNZ5319 vector as a skeleton and also includes a promoter P170 element, a streptococcal ribosome binding site element, and a signal peptide element; the promoter P170 element, the streptococcal ribosome binding site element, and the signal peptide element are operably connected in sequence, and the connected fragments are inserted before the T7 terminator of the pNZ5319 vector; the promoter P170 expresses the target gene, and the N-terminus of the expression product of the target gene is connected to the signal peptide; the signal peptide is signal peptide Q54873 or signal peptide Q53591.

[0023] The present invention discovered that combining promoter P170 with either signal peptide Q54873 or signal peptide Q53591 to express a target gene significantly increases its expression level, with experiments confirming a synergistic effect. Furthermore, the expression vector also contains a Streptococcus ribosome binding site element. Inserting the target gene into the correct location within the inducible expression vector allows for inducible expression of the target gene in Streptococcus.

[0024] In a fourth aspect, the present invention provides a composition for increasing the production of low-molecular-weight hyaluronic acid in Streptococcus equine, the composition comprising: a promoter P170 nucleotide fragment and a signal peptide nucleotide fragment; the signal peptide is signal peptide Q54873 or signal peptide Q53591; the molecular weight of the low-molecular-weight hyaluronic acid is <9KD.

[0025] The present invention found that when recombinantly expressing exogenous genes, selecting promoter P170 to express the exogenous genes and connecting the N-terminus of the exogenous gene expression product with signal peptide Q54873 or signal peptide Q53591 can increase the production of small molecular weight hyaluronic acid in Streptococcus equine.

[0026] As a preferred embodiment of the fourth aspect, the composition further comprises a streptococcal ribosome binding site nucleotide fragment and an exogenous hyaluronidase gene fragment.

[0027] As a preferred embodiment of the fourth aspect, the promoter P170, the signal peptide (Q54873 or Q53591), the streptococcal ribosome binding site and the exogenous hyaluronidase gene are connected as follows:

[0028] A promoter P170 nucleotide sequence fragment, a streptococcal ribosome binding site nucleotide sequence fragment, and a signal peptide nucleotide sequence fragment are sequentially inserted into the -13 bp portion before the exogenous hyaluronidase gene fragment to obtain a recombinant nucleotide fragment.

[0029] When the Streptococcus ribosome binding site nucleotide fragment and the exogenous hyaluronidase gene fragment are linked to the aforementioned promoter P170 and signal peptide in the manner described above and recombined with an expression plasmid (e.g., pNZ5319 plasmid), a recombinant expression plasmid is obtained that can increase the production of low-molecular-weight hyaluronic acid in Streptococcus equine plague. Therefore, when the promoter P170 is combined with the signal peptide Q54873 or the signal peptide Q53591, the production of low-molecular-weight hyaluronic acid in Streptococcus equine plague can be increased.

[0030] In a fifth aspect, the present invention provides the use of the Streptococcus equine pestis described in the first aspect, the inducible expression vector described in the third aspect, or the composition for increasing the production of small molecular weight hyaluronic acid in Streptococcus equine pestis described in the fourth aspect in the production of small molecule hyaluronic acid.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] The present invention obtains a high-molecular-weight hyaluronic acid-producing Streptococcus equine by constructing a heterologous expression recombinant plasmid. In the recombinant plasmid, the expression level of the hyaluronidase gene derived from leech is increased by the synergistic effect between promoter P170 and signal peptide Q54873 or Q53591, thereby improving the enzymatic activity of the hyaluronidase and enabling it to degrade more low-molecular-weight hyaluronic acid. The plasmid is transferred into Streptococcus equine to obtain a recombinant bacterium with the best enzyme production, thereby degrading and producing a small-molecule hyaluronic acid with biomedical activity. The present invention produces a small-molecule hyaluronic acid amount of more than 20g / L, with a molecular weight of less than 10kD, and has potential and wide application value in industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 is a schematic diagram of the plasmid pNZ5319-P170-Q53591-hyal;

[0034] Figure 2 Schematic diagram of the plasmid pNZ5319-P170-Q54873-hyal. DETAILED DESCRIPTION

[0035] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0036] The present invention provides a Streptococcus equine that produces small molecule hyaluronic acid. The Streptococcus equine of the present invention is classified and named Streptococcus equine; the Streptococcus equine has a deposit number of CGMCC No. 30659, and is deposited with the General Microbiology Center of the China Culture Collection Administration of Microorganisms on May 16, 2024. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0037] Example 1 Construction of recombinant strains

[0038] 1. Synthesize the following gene fragments separately:

[0039] 1) Amplify the pNZ5319 vector fragment,

[0040] Amplification primers are as follows:

[0041] 5319-HR-F:atgagctcccgctgagcaat

[0042] 5319-HR-R:gggcatgactaacatgag

[0043] 2) Amplify the Hyal gene fragment of the leech-derived hyaluronidase gene (Hyaluronidase)

[0044] Amplification primers are as follows:

[0045] Hyal-up-F:gtaattctcatgttagtcatgcccAATCAGAAATCATGTTAAGGCT

[0046] Hyal-up-R: CTGATACCTCCTTtctatctacctccgatgtttgcGCTTT

[0047] Hyal-F: agatagaAAGGAGGTATCAGATGAAAGAGATCGCGGTGAC

[0048] Hyal-R:TTACTAATGTGCTTGAATGGTTATTTTTTGCAGGCTTC

[0049] Hyal-down-F:GAAGCCTGCAAAAAATAACCATTCAAGCAATTAGTAAT

[0050] Hyal-down-R: attgctcagcgggagctcatGTCCCAAATCTGTTGAAGAT

[0051] 3) Artificially synthesized Streptococcus ribosome-binding site (RBS sequence):

[0052] AAGGAGGATGT

[0053] 4) Amplification of the signal peptide Q54873 fragment

[0054] Amplification primers are as follows:

[0055] HQ-up-F: gtaattctcatgttagtcatgcccAATCAGAAATCATGTTAAGGCT

[0056] HQ54873-up-R: CTTCTTTGTTTTTGTTTGCATCTGATACCTCCTTtctatc

[0057] HQ54873-down-F: GGGATACAAAAATTTAGATGAAAGAGATCGCGGTGAC

[0058] HQ-down-R: gttattgctcagcgggagctcatAACTTGTCCAATGTTAG

[0059] 5) Artificially synthesized promoter P170:

[0060] The promoter sequence of P170 is: ATTTTTGGTTGCCATTTGTTAACGCTGCCTCCTCTCCCTAGTGCTATAATA

[0061] 2. Construction of recombinant plasmid

[0062] The inducible promoter P170, the streptococcal RBS sequence and the signal peptide Q54873 sequence were sequentially inserted into the -13 bp position before the Hyal gene fragment to obtain a recombinant nucleotide fragment.

[0063] The recombinant nucleotide fragment was homologously recombined with the vector pNZ5319 fragment. The system was 10 μl: 2×AssemblyMix 5 μl. The amount of vector pNZ5319 and the recombinant fragment added was 0.01-0.25 pmol. The optimal molar ratio of the pNZ5319 fragment to the recombinant fragment was 1:2. Water was added to 10 μl and the reaction was connected at 50°C for 15 minutes. After the reaction was completed, the centrifuge tube was placed on ice for a few seconds to cool to obtain the recombinant plasmid, which was named: pNZ5319-P170-Q54873-hyal.

[0064] 3. Conversion

[0065] The recombinant plasmid pNZ5319-P170-Q54873-hyal constructed above was electroporated into the host Streptococcus equine (S. zooepidemicμs TS2023) as follows:

[0066] The concentration of the recombinant plasmid was controlled at about 100 ng / μl. 10 μl of the recombinant plasmid was taken and added to 100 μl of competent cells. The mixed system was transferred to a 2 mm electroporation cup, ice bathed for 10 min, and electroporated at 2500 V. The mixed system was transferred to a 1.5 ml centrifuge tube with 900 μl of pre-cooled seed culture medium, ice bathed for 30 min, recovered at 30 ° C, 220 rpm for 4 h, centrifuged at 6000 rpm for 5 min, and then centrifuged with 200 μl. Resuspend the bacteria in the seed culture medium and spread them on a resistance plate containing 0.1 μg / μl chloramphenicol. Incubate at 30°C until single colonies grow on the plates after 3 days (10 μl of competent cells are spread on brain heart infusion broth (BHI) plates and BHI-EmR plates as controls. The BHI-EmR medium formula is: 2% glucose, 10% peptone, 17.5% bovine brain heart infusion powder, 2.5% disodium hydrogen phosphate, 5g / L sodium chloride, and 5mg / L erythromycin (EmR).

[0067] 4. Screening

[0068] The above single colonies were selected for PCR verification, and the single colonies verified to be correct by electroporation were inoculated into BHI-EmR culture medium and cultured at 30°C and 220 rpm for about 24 hours to allow the plasmid to replicate in large quantities.

[0069] Then, 1% (V / V) inoculum was transferred to fresh BHI-EmR culture medium and cultured at 40°C and 220 rpm for about 12 h. A single colony appeared after streaking on a BHI-EmR plate. The plate was incubated at 40°C for 24 h to grow a single colony.

[0070] A single colony was inoculated into BHI-EmR culture medium and cultured at 30°C for 24 hours. The culture medium was then streaked on a BHI plate and cultured at 40°C for 24 hours to allow a single colony to grow on the BHI plate.

[0071] The same single colony was spotted on BHI and BHI-EmR plates respectively and placed in a 40°C incubator for 20 hours. When the same single colony was found to grow normally on the BHI plate but not on the BHI-EmR plate, the single colony was verified by PCR and sequenced to obtain a recombinant Streptococcus equine with the correct sequence, which was named: S-pNZ5319-P170-Q54873-hyal.

[0072] The recombinant Streptococcus equine plague S-pNZ5319-P170-Q54873-hyal with the correct sequence was deposited in the General Microbiology Center of China Culture Collection Administration, and the obtained deposit number was: CGMCC No. 30659. The recombinant Streptococcus equine plague S-pNZ5319-P170-Q54873-hyal was classified as Streptococcus equine plague; the deposit date was: May 16, 2024, and the deposit address was: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences.

[0073] Example 2 and Comparative Examples 1-15 The recombinant strains were constructed using the same method as in Example 1. The promoter and signal peptide information used are shown in Table 1.

[0074] Table 1: Promoter and signal peptide information in the recombinant strains of Examples 1-2 and Comparative Examples 1-15

[0075] Group Recombinant strain name promoter signal peptide Example 1 S-pNZ5319-P170-Q54873-hyal P170 Q54873 Example 2 S-pNZ5319-P170-Q53591-hyal P170 Q53591 Comparative Example 1 S-pNZ5319-P170-AmyX-hyal P170 AmyX Comparative Example 2 S-pNZ5319-P170-Bpr-hyal P170 Bpr Comparative Example 3 S-pNZ5319-Pspac-Q53591-hyal Pspac Q53591 Comparative Example 4 S-pNZ5319-Pspac-Q54873-hyal Pspac Q54873 Comparative Example 5 S-pNZ5319-P2-Csn-hyal P2 Csn Comparative Example 6 S-pNZ5319-P3-Npre-hyal P3 Npre Comparative Example 7 S-pNZ5319-P170-YvgO-hyal P170 Yj Y Comparative Example 8 S-pNZ5319-P170-YweA-hyal P170 YweA Comparative Example 9 S-pNZ5319-P170-YxaL-hyal P170 YxJ Comparative Example 10 S-pNZ5319-P3-Q54873-hyal P3 Q54873 Comparative Example 11 S-pNZ5319-P5-Q54873-hyal P5 Q54873 Comparative Example 12 S-pNZ5319-P5-OppA-hyal P5 OppA Comparative Example 13 S-pNZ5319-P2-Q53591-hyal P2 Q53591 Comparative Example 14 S-pNZ5319-P170-Csn-hyal P170 Csn Comparative Example 15 S-pNZ5319-P170-OppA-hyal P170 OppA Comparative Example 16 S-pNZ5319-Pspac-YvgOl-hyal Pspac Yj Y Comparative Example 17 S-pNZ5319-P3-Npre-hyal P3 Npre

[0076] Experimental example

[0077] Fermentation method: Single clones of the recombinant Streptococcus equine constructed above and the control bacteria (transformed with the pNZ5319 empty plasmid) were picked and inoculated into 5 ml of seed culture medium and cultured at 220 rpm and 38°C for 12-16 hours; then, a 5%-10% transfer volume was inoculated into a 500 ml baffled shake flask with fermentation medium, the liquid volume was 200 ml, and the culture was placed at 38°C and 220 rpm for 48 hours.

[0078] The seed culture medium formula is: glucose 2g / L, peptone 10g / L, ox brain heart extract powder 17.5g / L, sodium chloride 5g / L, sodium dihydrogen phosphate 2.5g / L.

[0079] The fermentation medium formula is: glucose 80g / L, peptone 15g / L, yeast powder 5g / L, dipotassium hydrogen phosphate 2g / L, magnesium sulfate 0.5g / L, vitamin B1 9mg / L, vitamin B2 4.5mg / L, vitamin B6 0.6mg / L, nicotinamide 30mg / L, and calcium pantothenate 3mg / L.

[0080] 1. Determination of enzyme activity in shake flask culture medium of recombinant Streptococcus equine

[0081] Take a sample of the fermentation broth at 20 hours and centrifuge it at 5000 rpm and 4°C for 5 minutes. Keep the supernatant and measure the extracellular crude enzyme activity of hyaluronidase in the supernatant. The determination method is as follows:

[0082] First, hyaluronic acid was dissolved in PBS buffer (0.1 M pH 7.0 PBS) and mixed with a 10-fold diluted enzyme solution at a 1:1 ratio (v / v). The mixture was reacted at 38°C for 10 minutes. After the reaction was terminated, DNS reagent was added and the mixture was boiled. The absorbance was measured at 540 nm using a spectrophotometer. A control group used hyaluronic acid solution. One unit of enzyme activity was defined as the amount of reducing sugar (μg) generated per 1 mL of enzyme solution within 1 hour.

[0083] 2. Determination of hyaluronic acid production of recombinant Streptococcus equine

[0084] After the fermentation is completed, 3 times the volume of anhydrous ethanol is added for precipitation. The precipitate is removed and washed in anhydrous ethanol for 2-3 times. The precipitate is then dried in an oven at 80°C to a constant weight, and the hyaluronic acid yield of different recombinant Streptococcus equine is measured.

[0085] 3. Determination of molecular weight of hyaluronic acid of recombinant Streptococcus equine

[0086] The molecular weight of HA was determined using multi-angle laser light scattering coupled with size exclusion chromatography (MALLS-SEC). The mobile phase consisted of 0.2 mol / L phosphate buffer, pH 7.2. Each sample was measured three times, and the average value was calculated. The results are shown in Table 2.

[0087] Table 2: Test results of fermentation broth of recombinant strains in Examples and Comparative Examples

[0088]

[0089]

[0090] By table 2 result display, compared with other recombinant bacteria, the enzyme activity of the recombinant Streptococcus equine pestis of embodiment is higher, and hyaluronic acid output is higher, and hyaluronic acid molecular weight is lower.As can be known by embodiment 1,2, as can be seen, when promotor is P170, when signal peptide is Q54873 or Q53591, can significantly improve the expression of hyaluronidase, thereby produce more hyaluronic acid, and can fully degrade hyaluronic acid, generate more oligomeric hyaluronic acid.Especially when promotor P170 and signal peptide Q54873 are combined, it is more remarkable to play biological synergistic effect, more can improve the expression of recombinant Streptococcus equine pestis hyaluronidase, thereby improve hyaluronic output.

[0091] Combining promoter P170 with other signal peptides (Comparative Examples 1-2, 7-9, 14-15) found that the production of hyaluronic acid was increased, and its molecular weight was also larger; combining signal peptides Q54873 or Q53591 with other promoters (Comparative Examples 3-4, 10-11, 13) did not increase the production of hyaluronic acid. In addition, the hyaluronic acid production of recombinant bacteria obtained by combining other promoters with other signal peptides (Comparative Examples 5-6, 12, 16-17) was also lower than that of the embodiment.

[0092] It can be seen that the present invention screened out promoter P170 and signal peptide Q54873 / Q53591 from numerous promoters and signal peptides to combine and reconstitute the plasmid, which can increase the expression level of hyaluronidase of Streptococcus equine, thereby increasing the production of hyaluronic acid with a molecular weight of less than 10kD.

[0093] The sequences involved in the present invention are shown in Table 3 below:

[0094] Table 3: Sequences involved in the present invention

[0095]

[0096]

[0097]

[0098]

[0099] Among them, the hyal gene is a hyaluronidase gene derived from leeches (exogenous), and hylB is the hyaluronidase gene (endogenous) of the host Streptococcus equine (S. zooepidemicμs TS2023). Since the recombinant Streptococcus equine of the present invention adds the exogenous hyaluronidase gene, the production of small molecule hyaluronic acid in the strain is increased.

[0100] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A Streptococcus equine plague that produces small molecule hyaluronic acid, characterized in that: The classification name of the Streptococcus equi is Streptococcus equi; the preservation number of the Streptococcus equi is: CG MCC No.30659, the preservation unit is: General Microbiology Center of China Culture Collection Administration of Microorganisms, and the preservation time is: May 16, 2024.

2. The Streptococcus equine pestis according to claim 1, wherein The Streptococcus equine pestis comprises a plasmid vector for heterologously expressing a hyaluronidase gene derived from leech; wherein, The plasmid vector is operably connected with a nucleotide fragment of the leech hyaluronidase gene, a promoter P170, a streptococcal ribosome binding site nucleotide fragment and a signal peptide nucleotide fragment; The promoter expresses the hyaluronidase gene derived from leech; The signal peptide is connected to the N-terminus of the expression product of the hyaluronidase gene derived from leech.

3. The Streptococcus equine pestis according to claim 2, wherein The signal peptide is signal peptide Q54873 or signal peptide Q53591.

4. The Streptococcus equine pestis according to claim 3, wherein The amino acid sequence of the signal peptide Q53591 is shown in SQE ID No: 19; or / and, the amino acid sequence of the signal peptide Q54873 is shown in SQE ID No:

20.

5. The Streptococcus equine pestis according to claim 2, wherein The nucleotide sequence of the promoter P170 is shown in SQEID No:

1.

6. A method for constructing the Streptococcus equine pestis according to any one of claims 1 to 5, characterized in that: The steps include: 1) inserting a promoter P170 nucleotide sequence fragment, a streptococcal ribosome binding site nucleotide sequence fragment, and a signal peptide Q54873 or a signal peptide Q53591 nucleotide sequence fragment into the first 13 bp of the hyaluronidase gene fragment to obtain a recombinant nucleotide fragment; 2) operably inserting the recombinant nucleotide fragment before the T7 terminator of the pNZ5319 backbone vector fragment to obtain a recombinant plasmid vector; 3) transferring the recombinant plasmid vector of step 2) into Streptococcus equine pestis by electroporation to obtain recombinant Streptococcus equine pestis; 4) Screening and sequencing the recombinant Streptococcus equine pestis described in step 3) for positive clones, and the recombinant Streptococcus equine pestis with the correct plasmid sequence is the recombinant Streptococcus equine pestis.

7. The method according to claim 6, wherein The method satisfies any of the following: (a) The nucleotide sequence of the promoter P170 is shown in SQEID No: 1; (b) the nucleotide sequence of the streptococcal ribosome binding site nucleotide sequence fragment is shown in SQE ID No: 29; (c) the amino acid sequence of the signal peptide Q53591 is shown in SQEID No: 19; (d) the amino acid sequence of the signal peptide Q54873 is shown in SQE ID No: 20; (e) The nucleotide sequence of the hyaluronidase gene fragment is shown in SQEID No:

17.

8. An inducible expression vector, characterized in that The vector uses the pNZ5319 vector as a backbone and also includes a promoter P170 element, a streptococcal ribosome binding site element, and a signal peptide element; The promoter P170 element, the streptococcal ribosome binding site element, and the signal peptide element are operably linked in sequence, and the linked fragments are inserted before the T7 terminator of the pNZ5319 vector; The promoter P170 expresses the target gene, and the N-terminus of the expression product of the target gene is connected to the signal peptide; The signal peptide is signal peptide Q54873 or signal peptide Q53591.

9. A composition for increasing the yield of low molecular weight hyaluronic acid in Streptococcus equine, characterized in that: The composition comprises: a promoter P170 nucleotide fragment and a signal peptide nucleotide fragment; The signal peptide is signal peptide Q54873 or signal peptide Q53591; The molecular weight of the low molecular weight hyaluronic acid is less than 9KD.

10. Use of the Streptococcus equine pestis according to any one of claims 1 to 5, or the inducible expression vector according to claim 8, or the composition for increasing the production of small molecular weight hyaluronic acid in Streptococcus equine pestis according to claim 9 in the production of small molecule hyaluronic acid.

Images