Phytobacterium plantarum with high yield of gamma-aminobutyric acid and application of phytobacterium plantarum

Abstract

The invention discloses a plant lactobacillus LT01 strain, a culture method and application of the plant lactobacillus LT01 strain, a method for producing GABA (gamma-aminobutyric acid), a microbial agent containing the plant lactobacillus LT01 strain and / or a fermentation product of the plant lactobacillus LT01 strain, and application of the plant lactobacillus LT01 strain or the microbial agent to food, health care products or medicines, and belongs to the technical field of microorganisms. The plant lactobacillus is preserved in the China Center for Type Culture Collection (CCTCC), the preservation address is Wuhan University, Wuhan, Hubei, China, and the preservation number is CCTCC NO: M 2025747. Compared with the existing disclosed strain, the strain provided by the invention has the advantages of excellent GABA production capacity, high product purity, high conversion rate, short conversion period, stable yield and strong operability, greatly saves the time and labor cost of industrial production, and is easy to popularize and apply. According to the present invention, the L-sodium glutamate is converted by using the thalli obtained by using the 6 L fermentation tank scale, the final yield of the GABA is 545 g / L, which is increased by 40% compared with the yield of 390 g / L disclosed in the prior art, and the substrate molar conversion rate is 99%;

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a Lactobacillus plantarum strain capable of producing high gamma-aminobutyric acid and application thereof. Background Art

[0002] γ-Aminobutyric acid (GABA), also known as 4-aminobutyric acid, is a non-protein amino acid widely found in eukaryotic and prokaryotic organisms. It is an excitatory and inhibitory neurotransmitter, accounting for approximately 30% of the total neurotransmitters in the central nervous system. It is synthesized from glutamate via glutamate decarboxylase. GABA has many important physiological functions, such as improving sleep, reducing anxiety, regulating blood pressure and heart rate, improving liver and kidney function, combating aging, and regulating hormone secretion. With the continuous exploration and research of GABA's physiological functions, researchers have discovered that GABA can not only be combined with pharmaceutical ingredients such as vitamin E as a compound drug to improve the sequelae of stroke and cerebral arteriosclerosis, but also as a new functional factor with health benefits, thus gaining widespread application in the food, health care, and pharmaceutical industries.

[0003] Currently, GABA is produced primarily through chemical synthesis and microbial fermentation. While chemical synthesis offers the advantage of rapid reaction times, it is also associated with high costs, numerous side effects, and significant environmental pollution, making it unsuitable for large-scale industrial production. Microbial fermentation, on the other hand, utilizes the activity of microorganisms to decarboxylate the substrate sodium glutamate or glutamic acid to produce GABA. This method offers low cost, high safety, and environmental friendliness, promising promising applications, making it the preferred method for GABA production.

[0004] In recent years, Lactobacillus plantarum has been widely used in the food and health product industries due to its safety. Furthermore, due to its glutamate decarboxylase activity, the biosynthesis of GABA using food-safe Lactobacillus plantarum is currently a research hotspot. However, existing Lactobacillus plantarum strains have low decarboxylase activity, resulting in low yields of GABA synthesized after fermentation. Patent application KR1020140087518A discloses that the GABA expression level produced by fermentation of kimchi-derived Lactobacillus plantarum DSR GB150 (KCCM11343P) was 389 mg / mL. Overall, from the perspective of controlling production costs, the ability to produce GABA using Lactobacillus plantarum needs to be further improved. Therefore, breeding a strain of Lactobacillus plantarum with high GABA production capacity is particularly important in the biofermentation process for GABA production. Summary of the Invention

[0005] To solve the above technical problems, the present inventors have been conducting research and have isolated and identified a new strain of Lactobacillus plantarum (Lactobacillus plantarum) that produces high GABA from kimchi containing a large number of microorganisms.Lactiplantibacillus plantarum ) LT01, a cultivation method of the strain, an application of the strain, a method for producing GABA by catalytic conversion through fermentation and cultivation of the strain, and a microbial agent containing the strain and / or the fermentation product of the strain, and applying the strain or the microbial agent containing the strain or the fermentation product of the strain in food, health products or medicines, thereby completing the present invention.

[0006] In order to achieve the above-mentioned object of the invention, the present invention discloses the following technical solutions.

[0007] The first object of the present invention is to provide a novel plant lactobacillus, named plant lactobacillus ( Lactiplantibacillus plantarum ) LT01, which was deposited with the China Center for Type Culture Collection (CCTCC) on April 10, 2025, at Wuhan University, Wuhan, Hubei Province, China, with the accession number: CCTCC NO: M2025747. The 16S rDNA sequence of Lactobacillus plantarum LT01 is shown in SEQ ID No: 1.

[0008] The strain of the present invention has a GABA production activity of 480 mg / mL-700 mg / mL, and optionally has a GABA production activity of 500 mg / mL-600 mg / mL.

[0009] The strain of the present invention can be isolated from kimchi, but the source of isolation is not limited thereto. The second object of the present invention is to provide a culture method for the above-mentioned Lactobacillus plantarum LT01, wherein the Lactobacillus plantarum LT01 is inoculated into an MRS medium to obtain a seed preculture solution, the seed preculture solution is then accessed into an MRS medium for cultivation to obtain a seed culture solution, and finally the seed culture solution is transferred to a fermentation medium for fermentation culture, wherein the formula of the fermentation medium is peptone 5.0~15.0g / L, beef extract powder 5.0~12.0 g / L, yeast powder 2.0~8.0 g / L, corn steep liquor powder 10.0~25.0 g / L, dipotassium hydrogen phosphate 1.0~5.0 g / L, diammonium hydrogen citrate 1.0~5.0 g / L, sodium acetate 2.0~10.0 g / L, magnesium sulfate 0.05~0.5 g / L, manganese sulfate 0.01~0.1 g / L, Tween 80 0.01~5.0 mL / L, and glucose 10~30 g / L.

[0010] As an embodiment of the present invention, the inoculation amount of the seed pre-culture solution and / or the seed culture solution is 1-20%, and can be further optionally 5%-15%, or 10%.

[0011] As one embodiment of the present invention, the MRS medium and / or fermentation medium may use a natural medium or a synthetic medium, which contains a carbon source, a nitrogen source, an inorganic salt, etc. that can be effectively utilized by the strain cells.

[0012] As an embodiment of the present invention, the formula of the MRS plate culture medium is: peptone 10.0 g / L, beef extract powder 10.0 g / L, yeast powder 5.0 g / L, dipotassium hydrogen phosphate 2.0 g / L, diammonium hydrogen citrate 2.0 g / L, sodium acetate 5.0 g / L, magnesium sulfate 0.1 g / L, manganese sulfate 0.05 g / L, Tween 80 1.0 mL / L, glucose 20 g / L, and agar powder 15 g / L.

[0013] As an embodiment of the present invention, the formula of the MRS liquid culture medium is: peptone 10.0 g / L, beef extract powder 10.0 g / L, yeast powder 5.0 g / L, dipotassium hydrogen phosphate 2.0 g / L, diammonium hydrogen citrate 2.0 g / L, sodium acetate 5.0 g / L, magnesium sulfate 0.1 g / L, manganese sulfate 0.05 g / L, Tween 80 1 mL / L, and glucose 20 g / L.

[0014] As a specific embodiment of the present invention, the formula of the fermentation medium is 10.0 g / L peptone, 8.0 g / L beef extract powder, 4.0 g / L yeast powder, 15.0 g / L corn steep liquor powder, 2.0 g / L dipotassium hydrogen phosphate, 2.0 g / L diammonium hydrogen citrate, 5.0 g / L sodium acetate, 0.2 g / L magnesium sulfate, 0.04 g / L manganese sulfate, 1.0 mL / L Tween 80, and 20 g / L glucose.

[0015] The third object of the present invention is to provide the use of the above-mentioned Lactobacillus plantarum LT01 in catalyzing L-glutamic acid or sodium L-glutamate to produce γ-aminobutyric acid.

[0016] The fourth object of the present invention is to provide a method for preparing γ-aminobutyric acid through biotransformation, using L-glutamic acid or sodium L-glutamate as a substrate and the Lactobacillus plantarum LT01 cell of claim 1 as a catalyst to obtain γ-aminobutyric acid.

[0017] As an embodiment of the present invention, the fermentation temperature is 20-37°C.

[0018] As an embodiment of the present invention, the pH of the fermentation is 4.0~6.5h.

[0019] As an embodiment of the present invention, the dissolved oxygen in the fermentation is controlled to be 0% to 10%.

[0020] As an embodiment of the present invention, the concentration of the substrate L-glutamic acid or sodium L-glutamate is 100 g / L to 400 g / L, and the substrate can be fed in batches.

[0021] A fifth object of the present invention is to provide a microbial agent comprising the aforementioned Lactobacillus plantarum LT01 or a fermentation product thereof, wherein the fermentation product may be γ-aminobutyric acid.

[0022] As an embodiment of the present invention, the microbial agent is a solid agent or a liquid agent.

[0023] The sixth object of the present invention is to provide the use of the above-mentioned Lactobacillus plantarum LT01 or the above-mentioned microbial agent in the preparation of food, health products and pharmaceutical compositions.

[0024] Compared to existing, publicly available Lactobacillus plantarum strains, the Lactobacillus plantarum LT01 strain of the present invention exhibits exceptionally excellent GABA production capacity, with high product purity, high conversion rate, a short conversion cycle, stable yield, and strong operability. This significantly reduces industrial production time and labor costs, making it easy to promote and apply. Using Lactobacillus plantarum LT01 cells obtained in a 6-liter fermenter, repeated catalysis of L-glutamic acid or sodium L-glutamate yields a final GABA yield of 545 g / L, a 40% increase over the 390 g / L yield disclosed in the prior art. The molar conversion rate (theoretical conversion rate) of the substrate is 99%. By cultivating and using this strain, GABA can be mass-produced as a raw material for functional foods, health products, and pharmaceuticals. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a photo of the colony morphology of Lactobacillus plantarum LT01.

[0026] Figure 2 It is the GABA concentration and molar conversion rate in the transformation liquid after each batch of LT01 bacteria transformation. DETAILED DESCRIPTION

[0027] To facilitate those skilled in the art to understand the contents of the present invention, the technical solutions of the present invention will be further described below in conjunction with specific embodiments. However, the following content is only used to explain the present invention and is not intended to limit the scope of protection of the present invention. Any simple improvements to the sequence and preparation method of the present invention based on the concept of the present invention fall within the scope of protection of the present invention.

[0028] Unless otherwise specified, the materials, reagents, etc. used in the following examples can be obtained from commercial sources or are commonly used formulas in the art.

[0029] The culture medium formulation used in the examples is as follows.

[0030] The formula of MRS plate medium is as follows: peptone 10.0 g / L, beef extract powder 10.0 g / L, yeast powder 5.0 g / L, dipotassium hydrogen phosphate 2.0 g / L, diammonium hydrogen citrate 2.0 g / L, sodium acetate 5.0 g / L, magnesium sulfate 0.1 g / L, manganese sulfate 0.05 g / L, Tween 80 1.0 mL / L, glucose 20 g / L, and agar powder 15 g / L.

[0031] The formula of MRS liquid culture medium is as follows: peptone 10.0 g / L, beef extract powder 10.0 g / L, yeast powder 5.0 g / L, dipotassium hydrogen phosphate 2.0 g / L, diammonium hydrogen citrate 2.0 g / L, sodium acetate 5.0 g / L, magnesium sulfate 0.1 g / L, manganese sulfate 0.05 g / L, Tween 80 1.0 mL / L, and glucose 20 g / L.

[0032] The formula of the fermentation medium was as follows: peptone 10.0 g / L, beef extract powder 8.0 g / L, yeast powder 4.0 g / L, corn steep liquor powder 15.0 g / L, dipotassium hydrogen phosphate 2.0 g / L, diammonium hydrogen citrate 2.0 g / L, sodium acetate 5.0 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.04 g / L, Tween 80 1.0 mL / L, and glucose 20 g / L. Example 1: Isolation, culture and purification of strains

[0033] The strain was isolated from a kimchi sample purchased from a vegetable market in Nanjing, Jiangsu Province. The specific method is as follows: A small amount of kimchi sample was minced and added with sterile 0.9% saline solution. The solution was homogenized to obtain kimchi bacteria suspension. The kimchi bacteria suspension was diluted 10-fold to 10-fold using sterile 0.9% saline solution. -10 . 100 μL of each gradient of diluted bacterial solution was evenly spread on the surface of the MRS plate culture medium and inverted in a 30°C constant temperature incubator for 40 h. Single colonies with white or light yellow round protrusions were picked, streaked on the MRS plate culture medium, and inverted in a 30°C constant temperature incubator for 40 h to obtain purified single colonies. 20 to 30 strains were selected based on colony morphology and screened in shake flasks. The supernatants were taken for GABA concentration detection. Among them, 10 strains could detect GABA production. Finally, 5 candidate strains #1 to #5 with higher expression levels were selected for subsequent fermentation comparison. Example 2: Fermentation of bacteria

[0034] The single colonies in Example 1 (5 candidate strains #1~#5) were picked up separately and placed in a shake flask filled with MRS liquid culture medium and cultured at 30°C for 48 h to obtain the seed pre-culture solution of strains #1~#5. The above seed pre-culture solution was inoculated into MRS culture medium at an inoculation rate of 10% (v / v), and fermented and cultured at 30°C for 48 h to obtain seed culture solution; the above seed culture solution was inoculated into 6 L fermentation medium at an inoculation rate of 10% (v / v) for culture. During the fermentation process, the pH of the fermentation liquid was controlled at 5.5, the temperature was controlled at 30°C, and the dissolved oxygen was controlled at 5%. After the fermentation was completed, the wet bacteria were collected by centrifugation. The bacteria were resuspended in acetic acid / sodium acetate buffer solution with a pH of 4.8, and the bacterial count OD 600 The control was set to 20. 250 g / L of sodium L-glutamate (the mass-to-volume ratio of sodium L-glutamate to the bacterial suspension was 250 g / L, i.e., the sodium L-glutamate concentration) and 1 g / L of pyridoxal phosphate (the mass-to-volume ratio of pyridoxal phosphate to the bacterial suspension was 250 g / L, i.e., the pyridoxal phosphate concentration) were added to the bacterial suspension for catalytic conversion. After 24 hours of conversion, the supernatant of the conversion solution was analyzed using HPLC (AccQ-tag amino acid analysis column, Waters, mobile phase A: ultrapure water, mobile phase B: 60% by volume acetonitrile). The GABA concentrations in the supernatants of the conversion solutions for different strains after 24 hours of conversion are shown in Table 1 below. The results showed that strain #1 produced a GABA concentration of 137 g / L, with the highest molar conversion rate (theoretical conversion rate) of 99%.

[0035] Table 1 GABA concentration in the conversion solution after 24 h catalytic conversion by different strains strain number #1 strain #2 strain #3 strain #4 strain #5 strain GABA concentration (g / L) 137 90 114 122 87 The strain #1 with the highest catalytic activity was subjected to molecular biological identification: the strain #1 was inoculated in MRS slant medium for expansion, and the 16s rDNA of the expanded strain was sequenced using 16s rDNA universal primers SEQ ID NO: 2 (AGAGTTTGATCCTGGCTCAG) and SEQ ID NO: 3 (GGTTACCTTGTTACGACTT). Homology comparison was performed using the Blast search program, and the sequencing result is shown in SEQ ID NO: 1. Combined with morphological and physiological characteristics observation, as well as physiological and biochemical identification, the strain of the present invention was finally identified as a new Lactobacillus plantarum, named Lactobacillus plantarum ( Lactiplantibacillus plantarum ) LT01. The above strain was deposited with the China Center for Type Culture Collection (CCTCC) on April 10, 2025, at Wuhan University, Wuhan, Hubei Province, China, with the deposit number: CCTCC NO: M2025747. The colony morphology of Lactobacillus plantarum LT01 is shown in the following figure. Figure 1Under laboratory conditions, Lactobacillus plantarum LT01 was activated with MRS liquid medium, mixed with freezing medium at a ratio of 1:1, and divided into glycerol tubes and stored at -78°C ultra-low temperature. Example 3: Fermentation of Lactobacillus plantarum

[0036] Take 100 μL of the glycerol bacteria of the strain LT01 in Example 2 and streak it on the MRS plate culture medium, and invert it in a constant temperature incubator at 30°C for 40 hours. Pick a single colony on the above plate and put it into a shake flask filled with MRS liquid culture medium and culture it at 20°C for 48 hours to obtain the seed pre-culture liquid of Lactobacillus plantarum LT01. The above seed pre-culture liquid is inoculated into the MRS culture medium at an inoculation volume of 20% (v / v), and fermented and cultured at 20°C for 48 hours to obtain the seed culture liquid; the above seed culture liquid is inoculated into 6 L fermentation medium at an inoculation volume of 20% (v / v) for culture. During the fermentation process, the pH of the fermentation liquid is controlled at 4.0, the temperature is controlled at 20°C, and the dissolved oxygen is controlled at 10%. After the fermentation is completed, the wet bacteria are collected by centrifugation. The bacteria are resuspended in acetic acid / sodium acetate buffer solution with a pH of 4.8, and the bacterial count OD 600 The control was 20. 250 g / L of sodium L-glutamate and 1 g / L of pyridoxal phosphate were added to the bacterial suspension for catalytic conversion. After 24 hours of conversion, the supernatant of the conversion solution was analyzed using HPLC (AccQ-tag amino acid analysis column, Waters, mobile phase A: ultrapure water, mobile phase B: 60% by volume acetonitrile) to determine the GABA concentration. The GABA concentration was 130 g / L, and the substrate molar conversion (theoretical conversion) was 94%. Example 4: Fermentation of Lactobacillus plantarum

[0037] Take 100 μL of the glycerol bacteria of the strain LT01 in Example 2 and streak it on the MRS plate culture medium, and invert it in a constant temperature incubator at 30°C for 40 hours. Pick a single colony on the above plate and put it into a shake flask filled with MRS liquid culture medium and culture it at 25°C for 48 hours to obtain the seed pre-culture liquid of Lactobacillus plantarum LT01. The above seed pre-culture liquid is inoculated into the MRS culture medium at an inoculation volume of 15% (v / v), and fermented and cultured at 25°C for 48 hours to obtain the seed culture liquid; the above seed culture liquid is inoculated into 6 L fermentation medium at an inoculation volume of 15% (v / v) for culture. During the fermentation process, the pH of the fermentation liquid is controlled at 4.5, the temperature is controlled at 25°C, and the dissolved oxygen is controlled at 8%. After the fermentation is completed, the wet bacteria are collected by centrifugation. The bacteria are resuspended in acetic acid / sodium acetate buffer solution with a pH of 4.8, and the bacterial count OD 600The control was 20. 250 g / L of sodium L-glutamate and 1 g / L of pyridoxal phosphate were added to the bacterial suspension for catalytic conversion. After 24 hours of conversion, the supernatant of the conversion solution was analyzed using HPLC (AccQ-tag amino acid analysis column, Waters, mobile phase A: ultrapure water, mobile phase B: 60% by volume acetonitrile) to determine the GABA concentration. The GABA concentration was 134 g / L, and the substrate molar conversion (theoretical conversion) was 97%. Example 5: Fermentation of Lactobacillus plantarum

[0038] Take 100 μL of the glycerol bacteria of the strain LT01 in Example 2 and streak it on the MRS plate culture medium, and invert it in a constant temperature incubator at 30°C for 40 h. Pick a single colony on the above plate and put it into a shake flask filled with MRS liquid culture medium and culture it at 30°C for 48 h to obtain the seed pre-culture liquid of Lactobacillus plantarum LT01. The above seed pre-culture liquid is inoculated into the MRS culture medium at an inoculation volume of 5% (v / v), and fermented and cultured at 30°C for 48 h to obtain the seed culture liquid; the above seed culture liquid is inoculated into 6 L fermentation medium at an inoculation volume of 5% (v / v) for culture. During the fermentation process, the pH of the fermentation liquid is controlled at 5.0, the temperature is controlled at 30°C, and the dissolved oxygen is controlled at 3%. After the fermentation is completed, the wet bacteria are collected by centrifugation. The bacteria are resuspended in acetic acid / sodium acetate buffer solution with a pH of 4.8, and the bacterial count OD 600 The control was 20. 250 g / L of sodium L-glutamate and 1 g / L of pyridoxal phosphate were added to the bacterial suspension for catalytic conversion. After 24 hours of conversion, the supernatant of the conversion solution was analyzed using HPLC (AccQ-tag amino acid analysis column, Waters, mobile phase A: ultrapure water, mobile phase B: 60% by volume acetonitrile) to determine the GABA concentration. The GABA concentration was 135 g / L, and the substrate molar conversion (theoretical conversion) was 98%. Example 6: Fermentation of Lactobacillus plantarum

[0039] Take 100 μL of the glycerol bacteria of the strain LT01 in Example 2 and streak it on the MRS plate culture medium, and invert it in a constant temperature incubator at 30°C for 40 hours. Pick a single colony on the above plate and put it into a shake flask filled with MRS liquid culture medium and culture it at 37°C for 48 hours to obtain the seed pre-culture liquid of Lactobacillus plantarum LT01. The above seed pre-culture liquid is inoculated into the MRS culture medium at an inoculation volume of 1% (v / v), and fermented and cultured at 37°C for 48 hours to obtain the seed culture liquid; the above seed culture liquid is inoculated into 6 L fermentation medium at an inoculation volume of 1% (v / v) for culture. During the fermentation process, the pH of the fermentation liquid is controlled at 6.0, the temperature is controlled at 37°C, and the dissolved oxygen is controlled at 0%. After the fermentation is completed, the wet bacteria are collected by centrifugation. The bacteria are resuspended in acetic acid / sodium acetate buffer solution with a pH of 4.8, and the bacterial count OD 600 The control was 20. 250 g / L of sodium L-glutamate and 1 g / L of pyridoxal phosphate were added to the bacterial suspension for catalytic conversion. After 24 hours of conversion, the supernatant of the conversion solution was collected and analyzed for GABA concentration using HPLC (AccQ-tag amino acid analysis column, Waters, mobile phase A: ultrapure water, mobile phase B: 60% by volume acetonitrile). The GABA concentration was 129 g / L, and the substrate molar conversion (theoretical conversion) was 93%. Example 7: Fermentation of Lactobacillus plantarum

[0040] Take 100 μL of the glycerol bacteria of the strain LT01 in Example 2 and streak it on the MRS plate culture medium, and invert it in a constant temperature incubator at 30°C for 40 h. Pick a single colony on the above plate and put it into a shake flask filled with MRS liquid culture medium and culture it at 30°C for 48 h to obtain the seed pre-culture liquid of Lactobacillus plantarum LT01. Inoculate the above seed pre-culture liquid into the MRS culture medium at an inoculation rate of 10% (v / v), ferment and culture it at 30°C for 48 h to obtain the seed culture liquid; inoculate the above seed culture liquid into 6 L fermentation medium at an inoculation rate of 10% (v / v) for culture. During the fermentation process, the pH of the fermentation liquid was controlled at 6.5, the temperature was controlled at 30°C, and the dissolved oxygen was controlled at 5%. After the fermentation was completed, the wet bacteria were collected by centrifugation. The bacteria were resuspended in acetic acid / sodium acetate buffer solution with a pH of 4.8, and the bacterial count OD 600 The control was 20. 250 g / L of sodium L-glutamate and 1 g / L of pyridoxal phosphate were added to the bacterial suspension for catalytic conversion. After 24 hours of conversion, the supernatant of the conversion solution was analyzed using HPLC (AccQ-tag amino acid analysis column, Waters, mobile phase A: ultrapure water, mobile phase B: 60% by volume acetonitrile) to determine the GABA concentration. The GABA concentration was 130 g / L, and the substrate molar conversion (theoretical conversion) was 94%. Example 8: Batch transformation of Lactobacillus plantarum

[0041] According to the technical scheme in Example 2, the fermentation wet cells of Lactobacillus plantarum LT01 were prepared, and the cells were resuspended in acetic acid / sodium acetate buffer solution at pH 4.8, and the bacterial count OD 600 The control was 20, and 250 g / L of sodium L-glutamate and 1 g / L of pyridoxal phosphate were added to the bacterial suspension for catalytic conversion. After 24 hours of conversion, the supernatant was taken to detect the GABA concentration. 250 g / L of sodium L-glutamate was added to the conversion system again, and the supernatant was taken to detect the GABA concentration after 24 hours of conversion. This method was repeated 5 times. The GABA concentration detected in the supernatant of each batch of conversion solution is shown in Table 2 and Figure 2 shown.

[0042] Table 2 GABA concentration and molar conversion rate in the transformation solution after each batch of LT01 bacterial transformation batch GABA concentration (g / L) Molar conversion 1 137 99% 2 275 100% 3 410 99% 4 545 99% 5 579 84% 6 595 72% 7 604 63% According to the data in Table 2, a single batch of fermented cells can undergo four repeated catalytic conversions. During the fifth catalytic conversion, the increasing trend in GABA concentration and the molar conversion rate in the conversion liquid significantly decreased. By the seventh conversion, the GABA concentration showed almost no increase, and the molar conversion rate was as low as 63%. Taking time and cost into consideration, the production process employed in the present invention utilizes a single batch of fermented cells for four catalytic conversions, resulting in a final GABA concentration of 545 g / L in the conversion liquid and a molar conversion rate of 99%. Example 9: Stability Study of Lactobacillus plantarum LT01

[0043] Lactobacillus plantarum LT01 obtained in Example 2 was inoculated at a 2% inoculum into filter-sterilized artificial gastric fluid at pH 3.0 and cultured at 37°C for 0 h, 1 h, 2 h, and 3 h. Samples were then taken and the number of viable bacteria was determined.

[0044] The bacteria-containing artificial gastric fluid cultured at 37°C for 3 h was aspirated from the above artificial gastric fluid and inoculated into the filter-sterilized artificial intestinal fluid at pH 8.0 at a 2% inoculum size. The culture was continued at 37°C and the number of viable bacteria was determined after 0 h, 3 h, 5 h, and 7 h, respectively.

[0045] Survival rate = N t / N o ×100% Where N t It indicates the number of viable bacteria after being cultured in artificial digestive fluid for different time periods; N o It indicates the number of viable bacteria after culture in MRS medium for different time periods.

[0046] After being exposed to artificial gastric juice at pH 3.0 for 1 h, 2 h, and 3 h, the survival rates of Lactobacillus plantarum LT01 reached 82%, 75%, and 66%, respectively. The high survival rate in artificial gastric juice indicates that it can tolerate the acidic environment of gastric juice and pepsin, and can pass through the stomach into the intestine and maintain activity.

[0047] After being treated with artificial gastric juice, the survival rates of Lactobacillus plantarum LT01 reached 85%, 78%, and 63% after being exposed to artificial intestinal juice for 3 h, 5 h, and 7 h, respectively. The results showed that Lactobacillus plantarum LT01 can maintain a certain activity in intestinal juice and has good tolerance to intestinal juice.

[0048] Therefore, the Lactobacillus plantarum LT01 of the present invention has good stability in simulated artificial gastric juice and artificial intestinal juice.

[0049] The Lactobacillus plantarum LT01, its fermentation products, or its microbial agents, or combinations thereof with other ingredients, can be used to prepare food, health product, and / or pharmaceutical compositions, thereby potentially having broad application prospects in the food, health product, and / or pharmaceutical industries. These food, health product, and / or pharmaceutical compositions can be taken orally or in other ways. Comparative Example 1

[0050] The disclosed plant lactobacillus DSR GB150 (KCCM11343P) bacterial strain of prior art and plant lactobacillus LT01 of the present invention are under the conditions identical with Example 2, and compare GABA production capacity.The GABA production capacity of plant lactobacillus DSR GB150 (KCCM11343P) bacterial strain is 390 g / L, and the GABA production capacity of plant lactobacillus of the present invention is 545 g / L, has improved by 40%.And under the conditions of the present invention, just produced GABA in 12 hours of fermentation, substrate has just been consumed completely substantially within 48 h time, illustrates that the conversion of GABA occurs in the shorter time, can greatly save the time and labor cost of suitability for industrialized production. Comparative Example 2

[0051] Take 100 μL of the glycerol bacteria of the strain LT01 in Example 2 and streak it on the MRS plate culture medium, and invert it in a constant temperature incubator at 30°C for 40 hours. Pick a single colony on the above plate and put it into a shake flask filled with MRS liquid culture medium and culture it at 30°C for 48 hours to obtain the seed pre-culture liquid of Lactobacillus plantarum LT01. The above seed pre-culture liquid is inoculated into the MRS culture medium at an inoculation volume of 10% (v / v), and fermented and cultured at 30°C for 48 hours to obtain the seed culture liquid; the above seed culture liquid is inoculated into 6 L fermentation medium at an inoculation volume of 10% (v / v) for culture. During the fermentation process, the pH of the fermentation liquid is controlled at 3.0, the temperature is controlled at 15°C, and the dissolved oxygen is controlled at 5%. After the fermentation is completed, the wet bacteria are collected by centrifugation. The bacteria are resuspended in acetic acid / sodium acetate buffer solution with a pH of 4.8, and the bacterial count OD 600 The control was 20. 250 g / L of sodium L-glutamate and 1 g / L of pyridoxal phosphate were added to the bacterial suspension for catalytic conversion. After 24 hours of conversion, the supernatant of the conversion solution was collected and analyzed using HPLC (AccQ-tag amino acid analysis column, Waters, mobile phase A: ultrapure water, mobile phase B: 60% by volume acetonitrile). The GABA concentration was 65 g / L, and the substrate molar conversion (theoretical conversion) was 47%. Comparative Example 3

[0052] Take 100 μL of the glycerol bacteria of the strain LT01 in Example 2 and streak it on the MRS plate culture medium, and invert it in a constant temperature incubator at 30°C for 40 h. Pick a single colony on the above plate and put it into a shake flask filled with MRS liquid culture medium and culture it at 30°C for 48 h to obtain the seed pre-culture liquid of Lactobacillus plantarum LT01. The above seed pre-culture liquid is inoculated into the MRS culture medium at an inoculation volume of 10% (v / v), and fermented and cultured at 30°C for 48 h to obtain the seed culture liquid; the above seed culture liquid is inoculated into 6 L fermentation medium at an inoculation volume of 10% (v / v) for culture. During the fermentation process, the pH of the fermentation liquid is controlled at 7.0, the temperature is controlled at 40°C, and the dissolved oxygen is controlled at 15%. After the fermentation is completed, the wet bacteria are collected by centrifugation. The bacteria are resuspended in acetic acid / sodium acetate buffer solution with a pH of 4.8, and the bacterial count OD 600 The control was 20. 250 g / L of sodium L-glutamate and 1 g / L of pyridoxal phosphate were added to the bacterial suspension for catalytic conversion. After 24 hours of conversion, the supernatant of the conversion solution was collected and analyzed using HPLC (AccQ-tag amino acid analysis column, Waters, mobile phase A: ultrapure water, mobile phase B: 60% by volume acetonitrile). The GABA concentration was 33 g / L, and the substrate molar conversion (theoretical conversion) was 24%.

[0053] It can be seen from the experimental data in Comparative Examples 2-3 and Example 2 that under the fermentation conditions of the present invention, by controlling the fermentation temperature to 20-37°C, the fermentation pH to 4.0-6.5 h, and the fermentation dissolved oxygen to 0%-10%, significantly better GABA concentration and substrate molar conversion rate were achieved.

[0054] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A strain of Lactobacillus plantarum that produces high levels of γ-aminobutyric acid ( Lactiplantibacillus plantarum )LT01, characterized by: The Lactobacillus plantarum LT01 was deposited in the China Center for Type Culture Collection (CCTCC) on April 10, 2025, with the deposit address being Wuhan University, Wuhan City, Hubei Province, China, and the deposit number being CCTCC NO: M 2025747.

2. The method for cultivating Lactobacillus plantarum LT01 according to claim 1, wherein: The plant lactobacillus LT01 was inoculated into an MRS medium to obtain a seed pre-culture solution, the seed pre-culture solution was then introduced into the MRS medium for culture to obtain a seed culture solution, and finally the seed culture solution was transferred to a fermentation medium for fermentation culture. The formula of the fermentation medium was 5.0-15.0 g / L of peptone, 5.0-12.0 g / L of beef extract powder, 2.0-8.0 g / L of yeast powder, and corn steep liquor powder. 15.0 g / L, dipotassium hydrogen phosphate 1.0~5.0 g / L, diammonium hydrogen citrate 1.0~5.0 g / L, sodium acetate 2.0~10.0 g / L, magnesium sulfate 0.05~0.5 g / L, manganese sulfate 0.01~0.1 g / L, Tween 80 0.01~5.0 mL / L, glucose 10~30 g / L.

3. The culture method according to claim 2, wherein: The inoculation amount of the seed pre-culture solution and / or the seed culture solution is 1-20% respectively.

4. The method according to claim 2, wherein: The fermentation temperature is 20-37°C.

5. The method according to claim 2, wherein: The pH of the fermentation is 4.0~6.5h.

6. The method according to claim 2, wherein: Control the dissolved oxygen in fermentation to 0%~10%.

7. Use of the Lactobacillus plantarum LT01 according to claim 1 in catalyzing the production of γ-aminobutyric acid from L-glutamic acid or sodium L-glutamate.

8. A method for preparing γ-aminobutyric acid by bioconversion, characterized in that: L-glutamic acid or sodium L-glutamate is used as a substrate and the Lactobacillus plantarum LT01 bacteria according to claim 1 is used as a catalyst to convert gamma-aminobutyric acid.

9. A microbial agent, characterized in that: The microbial agent contains the Lactobacillus plantarum LT01 according to claim 1 and / or its fermentation product.

10. Use of the Lactobacillus plantarum LT01 according to claim 1 or the microbial agent according to claim 10 in the preparation of food, health care products and pharmaceutical compositions.

Images